Wnt/β-Catenin Activation by iCRT3 Enhanced the Pluripotency of Bovine Expanded Pluripotent Stem Cells

Simple Summary

Maintaining pluripotent stem cells in bovine is crucial for breeding and biotech applications but remains challenging due to unclear signaling requirements. We investigated the role of the Wnt/β-catenin pathway in bovine stem cells. Surprisingly, we found that these cells need an exact balance of Wnt/β-catenin signaling to maintain pluripotency, rather than merely simple activation or inhibition. Even more surprisingly, the combination of the classic inhibitor iCRT3 and the activator CHIR99021 produced a synergistic effect. Instead of inhibiting the pathway, combining iCRT3 with CHIR99021 appears to enhance its activity and improve stemness. Our study reveals a unique wiring of this critical pathway in bovine, providing new insights for optimizing stem cell culture systems in livestock species.

Abstract

The Wnt/β-catenin signaling pathway is involved in regulating the pluripotency of mammalian stem cells. Fine-tuning of Wnt/β-catenin modulates the transition of naïve, formative or primed states with distinct lineage bias. However, its specific function in large domestic animals such as bovines remains unclear. Here we systematically investigated the role of Wnt/β-catenin signaling and its key effector TCF1 in bovine expanded pluripotent stem cells (bEPSCs) using a combination of small molecules (CHIR99021, XAV939, IWR-1, iCRT3). The results showed that prolonged Wnt/β-catenin activation with CHIR99021 induced morphological changes and downregulated the expression of core pluripotency genes POU5F1 (OCT4) and SOX2 in bEPSCs, while the existence of Wnt/β-catenin inhibitors XAV939 and IWR-1 upregulated these two genes. Knockdown of TCF1, a major nuclear effector of CTNNB1 (β-catenin), reduced the expression of pluripotency genes (POU5F1, SOX2) and key Wnt/β-catenin components (TCF3, LEF1 and CTNNB1). Combined treatment with CHIR99021 and the canonical β-catenin/TCF inhibitor iCRT3 resulted in the overactivation of Wnt/β-catenin signaling, and promoted the expression of core pluripotency genes, revealing extensive rewiring of the Wnt/β-catenin pathway in bovines. Consistent with these findings, global transcriptomics revealed that CHIR99021 combined with iCRT3 enhanced the expression of key pluripotency-related genes and further activated Wnt/β-catenin signaling target genes while simultaneously suppressing mitogenic pathways such as PI3K-Akt and MAPK signaling. Transcriptome profiling also demonstrated that this combination drives bEPSCs toward a hybrid naïve/formative pluripotency state. Together, these results demonstrate that Wnt/β-catenin signaling homeostasis is critical for bovine pluripotency regulation, which provides a foundation for refining livestock stem cell culture conditions and understanding the evolution of pluripotency networks.

1. Introduction

Bovines are important livestock that provide products such as meat, milk, and skin for humans. The derivation of stable bovine pluripotent stem cells (bPSCs) enables applications such as breeding, disease modeling, and cultured meat production [1]. At approximately day 6 post-fertilization, the inner cell mass (ICM) and trophectoderm (TE) arise during bovine embryogenesis [2]. By day 7, the ICM further differentiates into epiblast (Epi) and hypoblast (HYPO) [3]. Bovine embryonic stem cells (ESCs) including bovine expanded pluripotent stem cells (bEPSCs) can be obtained from ICM, Epi, or entire blastocysts [4,5]. In recent years, significant progress has been made in establishing bovine pluripotent stem cells by optimizing culture conditions and incorporating specific small-molecule inhibitors. Zhao et al. [1] successfully generated bEPSCs from preimplantation embryos. Their culture system consisted of mTeSR1 basal medium supplemented with XAV939 (or IWR-1, a WNT pathway inhibitor), CHIR99021 (a GSK3 inhibitor), WH-4-023 (SRC family kinase inhibitors), vitamin C, activin A, and leukemia inhibitory factor (LIF). This system supports the long-term self-renewal of bEPSCs under feeder-free conditions and maintains their differentiation potential toward both embryonic and extraembryonic lineages [1]. In addition, Xiang et al. successfully derived bEPSCs from bovine induced pluripotent stem cells (biPSCs) and bovine fetal fibroblasts (BFFs) using the LCDM culture medium, which comprises key components including LIF, CHIR99021, (S)-(+)-dimethindene maleate, and minocycline hydrochloride [6]. The medium supports bEPSCs in maintaining their ability to differentiate into both embryonic and extraembryonic tissues during long-term culture, and enables them to contribute to chimeras in bovine–mouse embryos. These studies provide essential insights into culture formulations and factor combinations critical for establishing stable bovine pluripotent stem cells.

The Wnt/β-catenin signaling pathway is a classic master regulator of pluripotency and cell fate decision in model animals such as mice and humans [7,8,9]. In mouse embryonic stem cells (mESCs), the pathway is recognized as a key driver of self-renewal. Stimulating this pathway with GSK-3 inhibitors maintains cells in an undifferentiated state. In contrast, persistent activation of Wnt/β-catenin signaling in human embryonic stem cells (hESCs) induces differentiation, notably into mesodermal lineages, rather than sustaining self-renewal. Despite these insights from model systems, little is known about its regulatory logic and functional output in pluripotent stem cells of major domestic animals, including bovines. Importantly, canonical Wnt/β-catenin agonists and inhibitors have been reported to exert divergent effects in bovine pluripotent systems compared with murine or human models, suggesting potential species-specific adaptations within this core pathway [10,11,12]. Furthermore, studies in bovine trophoblast stem cells have revealed a critical role for non-canonical Wnt-YAP/TAZ signaling activated by Wnt ligands, underscoring the complexity of Wnt/β-catenin pathway wiring in bovine systems [13]. This regulatory divergence extends to other large animals, where Wnt signaling also exhibits unique features compared to that in rodents [14].

In 2011, an Inhibitor named the Inhibitor of β-catenin Responsive Transcription 3 (iCRT3) was discovered [15]. It can specifically disrupt the interaction between β-catenin and TCF proteins and effectively inhibit the classical Wnt/β-catenin signaling pathway. Studies have shown that iCRT3 can regulate the pluripotency of mESCs by interfering with β-catenin/TCF-mediated pro-differentiation signals, thereby promoting their maintenance of a “basal state” [16]. In contrast, the role of the Wnt/β-catenin signaling pathway and its pharmacological inhibition in human pluripotent stem cells seems more complex and context-dependent, and is usually associated with promoting differentiation rather than maintaining self-renewal [8]. These known differences among species highlight the importance of experimentally validating the effects of iCRT3 in new species. At present, the effects of iCRT3 or any other inhibitors targeting β-catenin/TCF on the activity, specificity and function of bovine pluripotent stem cells remain to be clarified.

To address these questions, we employed an integrated strategy combining combinatorial pharmacology with Wnt/β-catenin modulators—including the canonical β-catenin/TCF inhibitor iCRT3—together with targeted knockdown of its key downstream effector TCF1, followed by multi-omics validation (RNA-seq, qRT-PCR, and immunofluorescence). This approach was designed to systematically evaluate the function of iCRT3 and the role of TCF1 in bovine pluripotent stem cells. Specifically, we aimed to (1) determine whether bovine pluripotency requires a balanced Wnt/β-catenin signaling homeostasis rather than simple activation or inhibition; (2) examine the phenotypic consequences of TCF1 knockdown; and (3) evaluate the species-specific pharmacological effects of iCRT3 on bovine pluripotency. Ultimately, this study seeks to define the regulatory logic of Wnt/β-catenin signaling in bovine pluripotent stem cells and to evaluate the applicability of targeted pharmacological inhibitors in livestock species.

2. Materials and Methods

2.1. Cell Culture

2.1.1. Preparation of Bovine Fetal Fibroblasts (BFFs)

Cryopreserved BFFs were quickly thawed in a 37 °C water bath. The cell suspension was diluted in BFF culture medium. BFF culture medium was composed of Dulbecco’s Modified Eagle Medium (DMEM; 11330-033, Gibco, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; F0193, Sigma, Uruguay) and 1% penicillin/streptomycin (15140-122, Gibco, USA). The cells were centrifuged at 1700 rpm for 5 min. After careful removal of the supernatant, the cell pellet was resuspended in fresh BFF culture medium and counted to seed the cells at a desirable density on cell culture plates coated with 0.2% gelatin. The plates were gently swirled to spread the cells evenly. Subsequently, the cells were cultured at 38.5 °C in a humidified incubator with 5% CO2 for the next passages or for the experiment.

2.1.2. Thawing and Culture of Bovine Extended Pluripotent Stem Cells (bEPSCs)

The bEPSCs used in this study were kindly provided by Professor Xihe Li. The bEPSC culture system was adapted from established protocols for bovine expanded pluripotent stem cells, primarily based on the work of Zhao et al. [1]. This system supports long-term self-renewal and maintains pluripotency under feeder-free conditions. Cryopreserved bEPSCs were rapidly thawed in a 37 °C water bath. The liquid cell suspension was gently diluted with pre-warmed bEPSC culture medium (bEPSCM) and centrifuged at 1700 rpm for 5 min to collect the cells. After removing the supernatant, the cell pellet was resuspended in fresh bEPSCM and plated on a feeder layer of BFFs. The cultures were cultured at 38.5 °C in a humidified atmosphere of 5% CO₂ and the medium was changed daily. When the cells reached ~50% confluency, the cells were passaged. Once stable growth was established, bEPSCs were routinely passaged every three days.

The bEPSCM was prepared using mTeSR1 basal medium (85850, STEMCELL Technologies, Canada) as the base. For a 50 mL preparation, 48.5 mL of mTeSR1 was supplemented with 1% penicillin/streptomycin, 0.1 mM β-mercaptoethanol (M3148, Sigma, Uruguay), and the following small molecules and cytokines: 1 μM CHIR99021 (HY-10182, MCE, USA), 0.3 μM WH-4-023 (S7565, Selleck Chemicals, USA), 5 μM XAV939 (X3004, Sigma, Uruguay) or 5 μM IWR-1 (S7086, Selleck Chemicals, USA), 50 μg/mL Vitamin C (A4403, Sigma, Uruguay), 10 ng/mL recombinant human Leukemia Inhibitory Factor (LIF; 300-05, PeproTech, USA), and 20 ng/mL Activin A (338-AC, R&D Systems, USA).

Treatment group definitions: All groups were based on modifications of the standard bEPSC medium (bEPSCM, containing CHIR99021, XAV939, WH-4-023, Vitamin C, LIF, and Activin A). Control: Standard bEPSCM. CHIR99021-only: Standard bEPSCM without XAV939. XAV939-only: Standard bEPSCM without CHIR99021. CHIR99021 + iCRT3: Standard bEPSCM + iCRT3. iCRT3-only: Standard bEPSCM without CHIR99021 or XAV939, but with iCRT3.

2.1.3. Passaging of bEPSCs

bEPSCs were passaged upon reaching approximately 80% confluency. The cells were first washed once with DPBS and then incubated with a sufficient volume of TrypLE™ Select enzyme (12563-029, Gibco, USA) to cover the cell monolayer. The culture plate was placed in a 38.5 °C incubator for 3 min to facilitate dissociation.

The enzymatic reaction was terminated by adding double the volume of K10 medium relative to the volume of TrypLE™ Select used. The resulting cell suspension was collected and centrifuged at 1700 rpm for 5 min. The supernatant was carefully aspirated, and the cell pellet was resuspended in fresh bEPSCM. The cells were then reseeded at an appropriate density onto a new feeder layer of BFFs.

The K10 medium consisted of DMEM/F12 basal medium (11330-032, Gibco, USA) supplemented with 10% KnockOut™ Serum Replacement (KSR; 10828-028, Gibco, USA), 1% penicillin/streptomycin (15140-122, Gibco, USA), and 1% MEM Non-Essential Amino Acids (11140-050, Gibco, USA).

2.2. Knockdown TCF1 by siRNA

Four siRNAs targeting the bovine TCF1 gene were designed based on its coding sequence and synthesized by GenePharma (Suzhou, China); the sequences are listed in Table 1. The transfection protocol was optimized based on standard RNA interference methodologies for stem cells [17]. Each siRNA was reconstituted with nuclease-free water to a stock concentration of 50 µM and stored at −80 °C. Prior to transfection, the siRNA was diluted in Opti-MEM (31985070, Gibco, USA) to a final working concentration of 5 nM.

Table 1.

Sequences of the four synthesized siRNAs targeting the bovine TCF1 gene.

Name	Sequence (5′-3′)
TCF1-siRNA-1	GCUGCACAACAAGGCCAGUTT
TCF1-siRNA-2	GCAGGAGCUACAGCCCUAUTT
TCF1-siRNA-3	GCCAAAGUCAUUGCGGAGUTT
TCF1-siRNA-4	GCACCAAGAAUCCAACUCATT

bEPSCs in good condition (>60% confluence) were seeded into 12-well plates. For transfection, 184 µL of Opti-MEM, 6 µL of HiPerFect Transfection Reagent (301705, Qiagen, Germany) and 10 µL of diluted siRNA solution were mixed together. After 20 min at RT, the transfection complex was formed (30). Before transfection, cells were washed twice with DPBS to remove the remaining serum from the culture medium. Then, 300 µL of serum-free Opti-MEM was added to the wells and dropwise added to transfection complexes. The plate was gently swirled to mix the contents and placed into the incubator (38.5 °C, 5% CO₂).

After 24 h, the medium with transfection complexes was aspirated and replaced with fresh bEPSCM. Cells were maintained in bEPSCM for another 24 h. The transfection efficiency was first examined by observing the fluorescence signals under an inverted fluorescence microscope (Leica, Germany). Subsequently, the cells were harvested for further RNA or protein analysis.

2.3. Alkaline Phosphatase (AP)

When bEPSCs reached approximately 70% confluence, they were fixed with 4% paraformaldehyde (PFA) at room temperature for 30 min. After fixation, the cells were washed three times with DPBS. Subsequently, the cells were incubated with an Alkaline Phosphatase Staining Solution (C3206, Beyotime Biotechnology, China) at room temperature for 15–30 min in the dark. The reaction was stopped by rinsing with DPBS upon the appearance of desired color development. Staining results were visualized and documented using an inverted fluorescence microscope (Nikon, Japan).

2.4. Real-Time Fluorescence Quantitative PCR (qRT-PCR)

2.4.1. Primer Design

Gene-specific primers for pluripotency and lipid metabolism-related genes were designed for qRT-PCR analysis. The coding sequence (CDS) region of each target gene was retrieved from the NCBI database (https://www.ncbi.nlm.nih.gov/, accessed on 25 August 2025). Primers were designed using Primer Premier 5.0 software to generate amplicons ranging from 100 to 300 bp. All oligonucleotides were subsequently synthesized by BGI Genomics (Beijing, China). The sequences and specific parameters for all primers used in this study are provided in Table 2.

Table 2.

Primer sequences used for qRT-PCR amplification of target genes.

Gene Name	Forward Primer	Reverse Primer	Accession Number	Product Size (bp)
GAPDH	GGGTCATCATCTCTGCACCT	GGTCATAAGTCCCTCCACGA	NM_001034034.2	176
TCF1	GCGGGACAACTATGGGAAGA	ACTGTCATCGGAAGGAACGG	XM_059888473.1	208
TCF3	CCGGGACAACTACGGTAAGAA	AGCACCGTCTGTCTCTTGGA	XM_024999428.2	97
TCF4	TGTACCCCATCACGACAGGA	TATGGGGAGGGAACCTGGAC	XM_024985753.2	87
POU5F1	GGTTCTCTTTGGAAAGGTGTT	ACACTCGGACCACGTCTTTC	NM_174580.3	314
SOX2	CATCCACAGCAAATGACAGC	TTTCTGCAAAGCTCCTACCG	XM_019959209.2	251
NANOG	TTCCCTCCTCCATGGATCTG	ATTTGCTGGAGACTGAGGTA	NM_001025344.1	214
LEF1	TTCTAGGCAGAAGGTGGCAT	GCAGCTGTCATTCTTGGACC	XM_019962331.2	196
CTNNB1	TGGTGAAGATGCTCGGTTCA	GCTAAACGCACGGCCATTTT	NM_001076141.1	109
SP5	CTCCTTCCTGTCCCAGGTTTC	AAGGTGCCACCCAAGATCG	XM_070803409.1	197
AXIN2	CTTGGATGGACACGCTCCTCTG	ACTTGCGTCCTGTCTCCTTCC	NM_001192299.3	146
CDX2	CTCCTGGACAAGGACGTGAG	ACATGGTATCCGCCGTAGTC	DQ126146.1	119
GFAP	CCTGCAGATCCGAGAAACCA	TCCACGGTCTTCACCACAAT	AY174179.1	84
FGF5	GTACGTGGCCCTGAACAAGA	GTGGGTAGAGACGTGCTGAG	NM_001078011.2	79
PAX6	GAATTCTGCAGGTGTCCAACG	GTCTGATGGAGCCAGTCTCG	NM_001040645.1	72
T	TGCTGAAGGTGAACGTGTCT	CACGATGTGGATTCGAGGCT	NM_001192985.1	299

2.4.2. qRT-PCR

Total RNA was extracted from collected cell samples with TRIzol™ Reagent (15596026, Invitrogen, USA) according to the manufacturer’s instructions. The concentration and purity of RNA were measured by a NanoDrop 2000c spectrophotometer (Thermo, USA). Complementary DNA (cDNA) was synthesized from 1 μg total RNA with the PrimeScript™ RT reagent Kit with gDNA Eraser (RR047A, Takara, Japan). Quantitative real-time PCR was performed using TB Green ^® Premix Ex Taq™ II (RR820A, Takara) on a 7500 Real-Time PCR System (Applied Biosystems, USA). All reactions were performed in triplicate, and gene expression levels were normalized to GAPDH and calculated using the 2^–ΔΔCt method.

2.5. Immunofluorescent Staining (IF)

When cells reached approximately 70% confluence, they were fixed with 4% paraformaldehyde for 30 min at room temperature. After permeabilization and blocking with a solution containing 10% goat serum and 0.5% Triton X-100, the cells were incubated overnight at 4 °C with the following primary antibodies: anti-NANOG (bs-0829R, BIOSS, China), anti-SOX2 (11064-1-AP, Proteintech, USA), anti-OCT4 (SC-5279, Santa Cruz Biotechnology, USA), anti-TCF1 (14464-1-AP, Proteintech), anti-TCF3 (21242-1-AP, Proteintech), anti-TCF4 (13838-1-AP, Proteintech), anti-LEF1 (abs158608, Absin, Chian), anti-β-catenin (51067-2-AP, Proteintech). Subsequently, the cells were incubated for 1 h at room temperature with species-appropriate secondary antibodies, including Donkey anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488 (A21206, Invitrogen), F(ab’)2-Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488 (A11017, Invitrogen). Nuclei were counterstained with DAPI (C1005, Beyotime Biotechnology, China) at a 1:1000 dilution for 5 min at room temperature in the dark. Images were captured using a Nikon laser scanning confocal microscope (Nikon, Japan).

Fluorescence intensity was quantified from the acquired images using ImageJ software (version 1.46r; National Institutes of Health, USA). For each experimental condition, at least three random fields of view from three independent biological replicates were analyzed. Briefly, after background subtraction, regions of interest (ROIs) were defined based on DAPI-stained nuclei. The mean fluorescence intensity of the target protein within each nuclear ROI was measured. To compare across groups, the intensities for each condition were normalized to the mean intensity of the control group (CHIR99021 + XAV939) within the same experiment. The resulting normalized intensities from all measured cells were then subjected to statistical analysis as described in Section 2.8.

2.6. Western Blotting (WB)

Cells were collected and lysed using ice-cold RIPA lysis buffer (P0013K, Beyotime, China) supplemented with protease and phosphatase inhibitors. The lysates were briefly sonicated and centrifuged at 14,000× g for 15 min at 4 °C. The supernatant was collected, and protein concentration was determined using a BCA protein assay kit (P0012, Beyotime). Protein samples were mixed with 5× SDS loading buffer and denatured by boiling at 100 °C for 10 min.

Equal amounts of protein (30 μg per lane) were separated by SDS-PAGE on 10% Bis-Tris gels (4561034, Bio-Rad, USA) and subsequently transferred onto nitrocellulose membranes (1620115, Bio-Rad). The membranes were blocked with 5% non-fat milk in TBST for 90 min at room temperature and then incubated overnight at 4 °C with the following primary antibodies: anti-GAPDH (10494-1-AP, Proteintech), anti-TCF1 (14464-1-AP, Proteintech), anti-β-catenin (51067-2-AP, Proteintech). After three washes with TBST, the membranes were incubated with appropriate HRP-conjugated secondary antibodies, HRP-conjugated Goat Anti-Rabbit IgG (SA00001-2, Proteintech), for 2 h at room temperature. Protein bands were visualized using an enhanced chemiluminescence (ECL) detection system (32106, Thermo, USA) and imaged with a Bio-Rad ChemiDoc imaging system (Bio-Rad, USA).

2.7. RNA-Seq Data Processing and Analysis

2.7.1. RNA Quality Evaluation

RNA-seq was performed on three independent biological replicates per treatment condition to ensure statistical robustness. RNA quality was assessed following extraction. Sample purity was measured using a spectrophotometer (IMPLEN, CA, USA). Total RNA concentration was determined with the Qubit^® RNA Assay Kit (Thermo Fisher Scientific), and integrity was evaluated using the RNA Nano 6000 Assay Kit on an Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).

2.7.2. Library Preparation

Sequencing libraries were generated from 1 μg of total RNA per sample with the NEBNext^® Ultra™ RNA Library Prep Kit for Illumina according to the manufacturer’s recommended protocol. After fragmentation, first-strand cDNA was synthesized using random hexamers. The cDNA was then amplified by PCR using Phusion High-Fidelity DNA polymerase, universal PCR primers, and index (X) primers. The PCR product was purified (AMPure XP system) and library quality was checked using the Agilent Bioanalyzer 2100 system. The sequencings were performed on an Illumina HiSeq platform (150 bp, 2nd generation).

2.7.3. Mapping

Clean reads were obtained by removing adapter sequences and low-quality bases using fastp (v0.20.0). The resulting high-quality reads were then aligned to the UCSC bosTau9 reference genome using HISAT2 (v2.0.4), which incorporates splice junction information from gene annotation files to enable accurate mapping of transcriptomic reads.

2.7.4. Transcript Quantification

Gene read counts were calculated using the featureCounts function within the Subread software package (v2.0.1). Gene expression levels were then quantified as fragments per kilobase of transcript per million mapped reads (FPKM), a normalized metric that accounts for both sequencing depth and gene length to enable accurate cross-sample comparisons.

The expression of genes in each sample was quantified to FPKM by Cuffnorm. For differential expression, we first counted the overlap of reads with genes by htseq-count with the parameter “-m union.” The 2 groups were then compared using default parameters in R package, DESeq2 (v1.40.2). A gene was considered significant if the Benjamini and Hochberg-adjusted p value (Padj) was less than 5% and the fold-change was greater than 2. Short Time-series Expression Miner (v1.3.11) was used for the analysis of gene expression trends.

2.8. Data Statistics and Analysis

All experiments were performed with at least three independent biological replicates. For qRT-PCR and Western blotting, each biological replicate was assayed in technical triplicates. Data are presented as the mean ± SEM of biological replicates (n ≥ 3). All experimental data were analyzed using GraphPad Prism 8.0 software. Statistical analyses were performed using Student’s t-test for comparisons between two groups and one-way ANOVA for comparisons among multiple groups. Significance levels were defined as follows: * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001; differences not reaching statistical significance (p ≥ 0.05) were labeled as “ns”.

3. Results

3.1. Combinatorial Wnt/β-Catenin Signaling Is Essential for bEPSC Homeostasis and Prevents Lineage Bias

We hypothesized that maintaining bovine pluripotent stem cells might require Wnt/β-catenin signaling homeostasis—an optimal range of pathway activity distinct from simple activation or inhibition. To investigate the consequences of Wnt/β-catenin pathway perturbation, we first examined the impact of Wnt/β-catenin signaling activation or inhibition on bEPSCs. We tested a panel of small molecules targeting distinct components of the Wnt/β-catenin signaling pathway: CHIR99021, a GSK3β inhibitor, to activate Wnt/β-catenin signaling and XAV939 or IWR-1, two Axin stabilizers, to inhibit Wnt/β-catenin signaling (representative morphological and AP staining results of P5 are shown in Figure 1A,B). The results show that treatment with all the combinations of small molecules, whether single inhibitors or in combination, can maintain bEPSCs for at least 15 passages (Figure 1A,B and Figure S1A). Although all the different small-molecule treatments (including single inhibitors or their combination) could preserve the typical dome-shaped clonal morphology and alkaline phosphatase activity, the continuous activation of Wnt/β-catenin signaling (CHIR99021 alone) led to significant morphological dynamics. This progressive change of CHIR99021 from dense cloning to flat dispersion and then to the emergence of heterogeneous subpopulations strongly suggests that the continuous activation of Wnt/β-catenin signaling disrupts cellular homeostasis and may promote the formation of different cell subpopulations through spontaneous differentiation or epigenetic adaptation. This finding echoes reports that porcine pluripotent stem cells require Wnt/β-catenin inhibition, but bovine cells show more complex regulatory requirements [18].

Figure 1.

Combinatorial Modulation of Wnt/β-catenin Signaling Influences the pluripotency of bEPSCs. (A) Phase-contrast images showing the morphology of bEPSCs. Cells were cultured in either the standard medium (Control, containing CHIR99021 + XAV939) or in medium where the inhibitor XAV939 was omitted (CHIR99021). Scale bars, 100 μm. (B) Alkaline phosphatase (AP) staining of cells from the same two groups as in (A). AP-positive colonies appear in purple/red. Scale bars, 100 μm. (C) Temporal evolution of colony morphology in the CHIR99021 condition. Representative images are shown at passages 1, 3, 6, and 9. Scale bars, 100 μm. (D) Immunofluorescence staining of core pluripotency transcription factors. Cells from the four indicated treatment groups (see panel (G) for group labels) were stained for NANOG, POU5F1, and SOX2 (green). Nuclei were counterstained with DAPI (blue). Scale bars, 200 μm. (E) Immunofluorescence analysis of β-catenin subcellular localization. Cells from the four treatment groups were stained for β-catenin (green) and DAPI (blue). Scale bars, 100 μm. (F) Quantification of nuclear fluorescence intensity. The mean fluorescence intensity for NANOG, POU5F1, SOX2, and β-catenin was measured from images as in (D,E) and is shown for the four treatment groups. Data are normalized to the Control group (set as 1). Each treatment contained three replicates. (G) qRT-PCR analysis of gene expression. mRNA levels of pluripotency genes (NANOG, POU5F1, SOX2), early lineage markers (CDX2, GATA4), and Wnt/β-catenin pathway genes (TCF1, TCF3, TCF4, β-catenin, SP5) were assessed in bEPSCs cultured under the four indicated conditions. Gene expression was normalized to the Control group (CHIR99021 + XAV939). Each treatment contained three replicates. Each black dot represents an independent experimental replicate. The p values in (F,G) were calculated by t test (** p < 0.01, **** p < 0.0001; ns, not significant).

We observed a dynamic morphological progression in the CHIR99021-only group, evolving from compact domes to flattened colonies at passage 1 (P1) and forming dispersed colonies by P3. Intriguingly, the morphological landscape transformed again by P6, with the emergence of dense secondary colonies from the flattened monolayer cells. This culminated in a strikingly heterogeneous mixture of morphologies by P9 (Figure 1C). This temporal shift suggests that constitutive Wnt/β-catenin signaling disrupts cellular homeostasis, fostering the emergence of distinct subpopulations potentially through spontaneous differentiation or epigenetic adaptation.

To characterize these cell states, we examined core pluripotency factors. Immunofluorescence showed that in NANOG, SOX2 and POU5F1 were nuclear-localized under all conditions but there was a striking depletion of POU5F1 and SOX2 protein levels following CHIR99021-only treatment (Figure 1D,F and Figure S1C–H). In examining transcript abundance, we found that this hyperactivation state was specifically downregulated in POU5F1, whereas cocktails containing inhibitors (XAV939+IWR-1) dramatically upregulated it (Figure 1G and Figure S1I). SOX2 was most sensitive to single-inhibitor treatments (XAV939 alone) (Figure S1I). Meanwhile, only CHIR99021-alone treatment significantly upregulated early lineage markers CDX2 (trophectoderm) and GATA4 (endoderm), suggesting a coincident loss of pluripotency and gain of lineage bias (Figure 1G and Figure S1I). This hierarchical response pattern indicates that in bEPSCs, different pluripotency factors may respond to changes in Wnt/β-catenin signaling through their own unique regulatory mechanisms.

We then detected the expression of downstream factors of the Wnt/β-catenin pathway. The membrane-localized CTNNB1 (encoding β-catenin) was maintained with CHIR99021 alone, but its level was reduced with XAV939 or IWR-1 (Figure 1E,F and Figure S2A). Transcript levels of critical mediators TCF1, TCF3, and CTNNB1 were potently upregulated by CHIR99021 alone, confirming pathway hyperactivation (Figure 1G and Figure S2B). However, this was accompanied by a paradoxical downregulation of other canonical targets such as TCF4 and SP5, suggesting a more complex, non-uniform transcriptional response to sustained activation (Figure 1G). This heterogeneous transcriptional response pattern indicates that the continuous activation of Wnt/β-catenin signaling in bEPSCs may trigger a complex feedback regulatory mechanism, leading to differential expression responses of different target genes. Our results further support the crucial role of Wnt/β-catenin signaling in maintaining pluripotency and self-renewal in bEPSCs [19]. This discovery suggests that there may be an involvement of other Wnt/β-catenin signaling components in bEPSCs.

3.2. TCF1 Functions as a Master Integrator of Pluripotency and Wnt/β-Catenin Signaling in bEPSCs

Given that TCF1 is a major nuclear effector of CTNNB1, it was considered as the first candidate to explore the connection between Wnt/β-catenin signaling and pluripotency in bEPSCs. We knocked down TCF1 in bEPSCs by siRNA. The successful downregulation of TCF1 at both mRNA and protein levels was verified by qRT-PCR and Western blot, and si-TCF1-2 was chosen due to the higher efficiency of depletion (Figure 2A–C). The results show that TCF1 knockdown caused obvious morphological defects, with flattened colonies that were loosely aggregated and borders poorly delineated, suggesting TCF1 depletion might impair self-renewal ability of bEPSCs (Figure 2A).

Figure 2.

TCF1 Knockdown Compromises Pluripotency and Alters Wnt/β-catenin Signaling in bEPSCs. (A) Phase-contrast images of bEPSC colonies. Colonies were transfected with either a non-targeting scramble siRNA (Control) or a TCF1-specific siRNA (si-TCF1-2). Images show colony morphology 48–72 h post-transfection. Scale bars, 100 µm. (B) Knockdown efficiency at the mRNA level. TCF1 mRNA expression was assessed by qRT-PCR in cells transfected as in (A). Expression is shown relative to the scramble control (set as 1). Each treatment contained three replicates. Each black dot represents an independent experimental replicate. (C) Knockdown efficiency at the protein level. Representative Western blot (top) and quantification (bottom) of TCF1 protein levels in the two groups. GAPDH served as a loading control. Band intensity was quantified using ImageJ and normalized to the Control. Each treatment contained three replicates. (D) Effect on core pluripotency factors. qRT-PCR analysis of NANOG, POU5F1, and SOX2 mRNA levels following TCF1 knockdown. Expression was normalized to the scramble control. Each treatment contained three replicates. Each black dot represents an independent experimental replicate. (E) Effect on early lineage markers. qRT-PCR analysis of trophectoderm (CDX2), ectoderm/neural (GFAP), primitive ectoderm (FGF5), endoderm (GATA4), and endoderm/forebrain (PAX6) marker genes. Expression was normalized to the scramble control. Each treatment contained three replicates. Each black dot represents an independent experimental replicate. (F) Effect on Wnt/β-catenin signaling components and targets. qRT-PCR analysis of key pathway genes: transcription factors (TCF3, TCF4, LEF1), the central mediator CTNNB1, and canonical targets (AXIN2, SP5). Expression was normalized to the scramble control. Each treatment contained three replicates. Each black dot represents an independent experimental replicate. The p values in (B) were calculated by t test. The p values in (C–F) were calculated by one-way ANOVA (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001; ns, not significant).

We then asked whether loss of colony integrity was associated with the breakdown of pluripotency. qRT-PCR analysis showed that TCF1 knockdown led to significant downregulation of the core pluripotency factors SOX2 and POU5F1, while NANOG was unaffected (Figure 2D). This specific repression of SOX2 and POU5F1 demonstrates a non-redundant and critical role for TCF1 in maintaining the bovine pluripotency transcriptional network. In addition, examination of early lineage markers showed a major reprogramming of differentiation potential. Expression of trophectoderm (CDX2), ectoderm/neural progenitor (GFAP), primitive ectoderm (FGF5) and endoderm (GATA4) markers was significantly suppressed. In contrast, the endoderm/forebrain marker PAX6 was dramatically upregulated, suggesting that TCF1 depletion results in a reprogramming of early lineage specification, such that cells are directed towards expressing a specific gene (PAX6) (Figure 2E). This unique “inhibitor-activation” coexistence pattern suggests that the absence of TCF1 does not lead to comprehensive differentiation inhibition, but rather triggers lineage-specific reprogramming, causing cells to shift towards specific developmental pathways.

Because TCF1 is an integral part of the Wnt/β-catenin pathway, we tested whether its effects were due to interference with canonical Wnt/β-catenin signaling. However, TCF1 knockdown not only significantly decreased the expression of other canonical Wnt/β-catenin signaling components such as TCF3, LEF1, and CTNNB1 but also had no effect on the expression level of TCF4 (Figure 2F). These findings indicate that TCF1 is required to maintain the expression of a core set of Wnt/β-catenin signaling mediators in bEPSCs. Interestingly, despite this, the expression of well-characterized canonical Wnt/β-catenin target genes such as AXIN2 and SP5 was significantly upregulated (Figure 2F). This contradictory pattern—the downregulation of key pathway components and the upregulation of typical target genes—highlights the unique regulatory logic in bovine cells. This indicates that the absence of TCF1 may trigger compensatory feedback or participate in alternative regulatory pathways, ultimately leading to the rewiring of signal output [20,21]. Overall, these findings suggest that TCF1 not only maintains the core pluripotency factor and guides lineage norms, but also coordinates the integrity and broader rewiring of the Wnt/β-catenin signaling network in bEPSCs.

In conclusion, our results indicate that TCF1 provides an integrated connection between the Wnt/β-catenin signaling pathway and the pluripotency network in bEPSCs. Depletion of TCF1 not only disrupts the pluripotent state and modulates lineage propensity but also induces global rewiring of the Wnt/β-catenin signaling circuitry, positioning TCF1 as a central master regulator in the species-specific control of pluripotency.

3.3. Disruption of β-Catenin/TCF Signaling with iCRT3 Reveals a Paradoxical, Species-Specific Activation in bEPSCs

Having identified TCF1 as an important component of the bovine pluripotency network, we then asked what phenotypic consequences would result from specifically disrupting the transcriptional complex between TCF1 and CTNNB1. We used the small-molecule inhibitor iCRT3, which is designed to specifically inhibit the β-catenin/TCF interaction, and tested it alone and in conjunction with CHIR99021.

Surprisingly, unlike its role in mouse ESCs where iCRT3 inhibits β-catenin/TCF signaling to promote naïve pluripotency, iCRT3 treatment in bEPSCs did not cause any pluripotency defects [16]. Under all tested conditions, including iCRT3 and CHIR99021 + iCRT3 co-treatment, typical dome-shaped colony morphology and alkaline phosphatase activity were maintained for multiple passages (Figure 3A). Importantly, at passages 10–15, CHIR99021 + iCRT3 co-treatment induced a strong activation of the pluripotency transcriptome. Immunofluorescence analysis revealed a significantly enhanced Sox2 protein signal (Figure 3B,C), and the mRNA levels of the core factors SOX2, POU5F1, and NANOG were significantly upregulated (Figure 3D). Consistent with its enhanced pluripotency, the same co-treatment uniquely induced a significant increase in trophectoderm marker CDX2 expression (Figure S3A).

Figure 3.

Co-treatment with CHIR99021 and iCRT3 Enhances Pluripotency Marker Expression. (A) Morphology and alkaline phosphatase (AP) activity of bEPSCs under long-term culture. Phase-contrast (left) and AP-stained (right) images of cells cultured for multiple passages in the four indicated conditions: (i) standard (CHIR99021 + XAV939), (ii) CHIR99021 + iCRT3, (iii) CHIR99021 alone, and (iv) iCRT3 alone. AP-positive colonies appear in purple/red. Scale bars, 100 μm. (B) Immunofluorescence analysis of core pluripotency transcription factors. Cells from the four treatment groups (A) were stained for NANOG, SOX2, and POU5F1 (green). Nuclei were counterstained with DAPI (blue). Representative merged images are shown. Scale bars, 200 μm. (C) Quantification of nuclear fluorescence intensity for pluripotency factors. The mean fluorescence intensity of NANOG, SOX2, and POU5F1 was measured from images as in (B) and is shown for the four treatment groups. Data are normalized to the standard group (CHIR99021 + XAV939, set as 1). Each treatment contained three replicates. Each black dot represents an independent experimental replicate. (D) qRT-PCR analysis of core pluripotency gene expression. mRNA levels of NANOG, SOX2, and POU5F1 4 were assessed in the four treatment groups. Expression was normalized to the standard group (CHIR99021 + XAV939). Each treatment contained three replicates. Each black dot represents an independent experimental replicate.The p values in (C,D) were calculated by one-way ANOVA.

Given that iCRT3 unexpectedly enhances rather than inhibits pluripotency, we next attempted to determine its direct impact on the Wnt/β-catenin pathway. Surprisingly, the CHIR99021 + iCRT3 treatment increased the protein levels of CTNNB1 and TCF4 (Figure 4A,B). Quantitative immunofluorescence analysis revealed a significant increase in the nuclear-to-cytoplasmic ratio of CTNNB1 upon CHIR99021 + iCRT3 co-treatment, indicating its enhanced nuclear translocation and functional activation (Figure 4C). Consistently, this co-treatment resulted in a significant up-regulation of a battery of Wnt/β-catenin pathway genes at the transcriptional level, including TCF1, TCF3, TCF4, CTNNB1 and its target SP5 (Figure 4D). Immunoblot analysis also revealed a substantial enrichment of CTNNB1 protein accumulation (Figure S3B,C). Thus, in bovine bEPSCs, the β-catenin/TCF interaction disruptor iCRT3 does not suppress Wnt/β-catenin signaling. Instead, when combined with CHIR99021, it synergistically enhances pathway output, as evidenced by increased total β-catenin and TCF4 protein levels (Figure 4A,B), enhanced nuclear accumulation of β-catenin (Figure 4C), and transcriptional upregulation of key pathway components and targets (Figure 4D).

Figure 4.

CHIR99021 and iCRT3 Combination Correlates with Synergistic Upregulation of Wnt/β-catenin Signaling Activity. (A) Immunofluorescence images showing the localization and expression levels of key Wnt/β-catenin signaling components (TCF1, TCF3, TCF4, and CTNNB1) in bEPSCs under indicated culture conditions. Cells were treated with: (i) standard medium (CHIR99021 + XAV939, Control), (ii) CHIR99021 combined with iCRT3, (iii) CHIR99021 alone, or (iv) iCRT3 alone. Nuclei were counterstained with DAPI (blue). Scale bars, 200 μm. (B) Quantitative analysis of nuclear fluorescence intensity for TCF1, TCF3, TCF4, and CTNNB1. Intensities were measured from images in (A), normalized to the Control group (set as 1). Each treatment contained three replicates. (C) iCRT3 enhances the nuclear translocation of β-catenin. Quantitative analysis of the nuclear-to-cytoplasmic (N/C) ratio of β-catenin from immunofluorescence staining. Bovine stem cells were treated as indicated. The N/C ratio was calculated for each individual cell (n > 50 cells per group from 3 independent experiments). (D) qRT-PCR analysis of Wnt/β-catenin pathway gene expression. mRNA levels of TCF1, TCF3, TCF4, CTNNB1, and SP5 were assessed under the four treatment conditions. Expression was normalized to the Control group (CHIR99021 + XAV939). Each treatment contained three replicates. The p values in 4B-D were calculated by one-way ANOVA.

TCF1 knockout eliminated the pluripotency of bEPSCs, while iCRT3 treatment induced compensatory overactivation of TCF4. However, TCF4 cannot functionally replace TCF1, indicating that these factors perform different functions in pluripotent networks. This supports the concept that TCF/LEF transcription factors have non-redundant functions and functional specialization [22]. The unique functions of TCF/LEF family members in bovine embryos further confirm this point, highlighting the species-specific connections within pluripotency networks.

3.4. Global Transcriptomics Uncover Wnt-Driven Pluripotency State Transitions and a Conserved Repression of Mitogenic Pathways

The paradoxical activation of the Wnt/β-catenin signal by iCRT3 and the distinct phenotypes resulting from TCF1 knockout prompt us to explore at the system level how these different perturbations reshape the pluripotency of bEPSCs. Knockout of the TCF1 gene leads to the loss of pluripotency, while the inhibition of iCRT3 (in combination with CHIR99021) instead enhances pluripotency. This contrast strongly indicates that the mechanism of action of iCRT3 in bovine cells is not simply the inhibition of TCF1. It may involve other members of the TCF/LEF family, or there may be compensatory effects achieved through new mediated feedback mechanisms. Therefore, in order to get a systems-level view of the two different phenotypic states, we used global transcriptomic analysis to overcome this paradox. RNA-seq was performed on bEPSCs under four conditions: CHIR99021 + XAV939, CHIR99021 alone, CHIR99021 + iCRT3 and iCRT3 alone.

Principal component analysis (PCA) demonstrated that each perturbation induced a separable and reproducible transcriptomic profile, such that the three treatment groups formed one distinct cluster away from the control, yet remained distinguishable from each other (Figure 5A), which was also evident from high Spearman correlation among the treatment groups (Figure 5B). Thus, different manipulations of Wnt/β-catenin converge on similar transcriptional programs, which are distinct from the homeostatic state maintained by the CHIR99021 + XAV939 (Figure 5B).

Figure 5.

Transcriptomic Analysis of bEPSCs under Different Wnt/β-catenin Signaling Modulations. (A) Principal component analysis (PCA) of RNA-seq data. The plot shows transcriptomic profiles of bEPSCs cultured under four conditions: (i) standard (CHIR99021 + XAV939), (ii) CHIR99021 alone, (iii) CHIR99021 + ICRT3, and (iv) ICRT3 alone. Each point represents one independent biological replicate. Ellipses (optional) indicate 95% confidence intervals for each group. PC1 and PC2 explain the indicated percentage of total variance. (B) Spearman correlation matrix of global gene expression. The matrix quantifies pairwise transcriptomic similarity between all samples. Color intensity and numbers in each cell represent the Spearman correlation coefficient (r), with darker red indicating higher similarity. (C) Heatmap of pluripotency state marker expression. Rows represent a curated set of marker genes for naïve, primed, and formative pluripotency states. Columns represent individual samples grouped by condition. Expression levels are shown as Z-scores (red, high expression relative to the mean; blue, low). (D) Heatmap of lineage-associated marker expression. Rows represent marker genes for core pluripotency, epiblast, mesoderm, and hypoblast lineages. Columns are as in (C). Visualization uses Z-scores (red, high; blue, low). (E) Volcano plot of differentially expressed genes (DEGs). The plot compares the CHIR99021 + ICRT3 group against the standard control (CHIR99021 + XAV939). Each point represents a gene. The x-axis shows log₂ fold change (positive values indicate upregulation in CHIR99021 + ICRT3). The y-axis shows -log₁₀ (p value). Genes with |log₂FC| > 1 and adjusted p value < 0.05 are highlighted in red (upregulated) and blue (downregulated). The total numbers of significant up- and down-regulated genes are indicated. (F) Gene Ontology (GO) enrichment analysis for biological processes. The bar chart shows the top significantly enriched GO terms (adjusted p value < 0.05) among the DEGs identified in (E) for the CHIR99021 + ICRT3 comparison. (G,H) KEGG pathway enrichment analysis. (G) Bar chart of the top enriched KEGG pathways among the upregulated DEGs from the CHIR99021 + ICRT3 comparison. (H) Bar chart of the top enriched KEGG pathways among the downregulated DEGs from the same comparison. For both (G,H), enrichment significance is shown as −log₁₀ (p value) or adjusted p value.

We further analyzed these changes, specifically examining known markers for pluripotency and lineage commitment. The results demonstrated that precise modulation of Wnt/β-catenin signaling can drive bEPSCs into distinct pluripotent states, each with an inherent lineage bias (Figure 5C,D). Cells treated with CHIR99021 + XAV939 co-expressed naïve and primed markers. CHIR99021 alone induced a formative-like state with ectoderm bias. CHIR99021 combined with iCRT3 enhanced a hybrid naïve/formative transcriptional profile and primed the cells toward mesoderm differentiation. In contrast, iCRT3 alone induced a naïve-like state but with a trophectoderm bias. These findings were consistent with our qRT-PCR data.

DEG and pathway analysis refined the functional impacts of each condition. CHIR99021 and CHIR99021 + iCRT3 groups had significantly upregulated genes involved in neurogenesis and organ development; KEGG enrichment analysis showed enrichment of the Wnt/β-catenin and Hippo signaling pathways (Figure 5E–H and Figure S4A,B). iCRT3 alone was enriched for Wnt/β-catenin and phosphatidylinositol signaling (Figure S4C,D). A highly significant common result across all Wnt-perturbed conditions was the downregulation of PI3K-Akt and MAPK signaling. This suggests that the deviation from the signaling homeostasis of the standard culture condition results in a conserved shutdown of the major mitogenic and metabolic networks, which may be a general cellular response to Wnt/β-catenin pathway imbalance in bEPSCs [23,24]. This novel crosstalk module might function as an important checkpoint to maintain the pluripotent state of bovine cells to avoid unbalanced growth signals pulling the system out of the pluripotent state.

Our transcriptomic data indicate that the Wnt/β-catenin pathway regulates both the pluripotent state and lineage propensity of bEPSCs. iCRT3 induces distinct gene expression programs, an effect that is enhanced upon co-administration with CHIR99021, confirming its non-canonical, activating role in bovine pluripotent stem cells. Moreover, perturbation of the Wnt/β-catenin pathway leads to sustained suppression of the PI3K-Akt and MAPK signaling pathways. This crosstalk may represent an important mechanism for maintaining pluripotency in domestic animals.

4. Discussion

The derivation and maintenance of stable pluripotent stem cells (PSCs) in major livestock species have remained challenging. Although progress has been made, the signaling networks that control pluripotency in these species are not as well characterized as those in mouse and human models [25]. For instance, porcine PSCs can only be derived and maintained with Wnt/β-catenin inhibitors like XAV939 and IWR-1 to suppress differentiation [18]. Here we investigated the role of the Wnt/β-catenin homeostasis in maintaining the pluripotency of bEPSCs. Our results reveal that bovine cells have a specific signal balance demand in comparison with the mouse and human pluripotent stem cell systems—neither too high nor too low. The resulting fine regulation requirement might be an indication of the evolutionary plasticity of large domestic animals to the pluripotency regulatory system. More specifically, early lineage markers such as CDX2 and GATA4 are selectively upregulated only under CHIR99021 treatment, indicating that Wnt signaling imbalance directly drives lineage-specific differentiation. These results provide a significant theoretical foundation on how to optimize the culture system of pluripotent stem cells in large domestic animals. The concept of signaling homeostasis, rather than binary on/off states, is emerging as a key principle in stem cell biology across species [26].

Furthermore, our findings suggest that the Wnt/β-catenin transcriptional network is rewired in bEPSCs. In mouse ESCs, iCRT3 preserves pluripotency by interfering with the interaction between β-catenin and TCF7 and inhibiting the pro-differentiation gene program [16]. In human ESCs, the Wnt/β-catenin signaling pathway is actively inhibited by POU5F1 to maintain an undifferentiated state, and the activation of this pathway promotes differentiation rather than self-renewal [8]. In contrast, iCRT3 treatment of bEPSCs (and particularly in conjunction with CHIR99021) induced a synergistic upregulation of β-catenin, and our data reveal an in vivo antagonism of TCF/LEF members in bEPSCs [27]. Our finding shows that the absence of TCF1 impairs pluripotency and the compensatory activation of TCF4 fails to salvage this phenotype, which further reinforces the view that members of the TCF/LEF family are functionally non-redundant in the regulatory network. The critical and specialized roles of TCF/LEF factors in pluripotency exit have been starkly demonstrated in mESCs, where their combined ablation fundamentally rewires cell state [28]. The specific manifestation of this phenomenon in bovine pluripotent stem cells may reflect the uniqueness of this species in the configuration of pluripotency regulatory networks. Thus, our data support the notion of non-redundant functions of TCF/LEF transcription factors and the concept of functional specialization [22]. This concept is also valid for other systems, as recently shown for human pluripotent stem cells and for the different signaling requirements of porcine EPSCs [29]. The dramatic rewiring of the TCF1/TCF4 pair in bovine cells provides an intriguing example of evolutionary divergence within this highly conserved transcription factor family.

We propose several, non-mutually exclusive mechanisms that could lead to this paradox: First, our data show that combining iCRT3 with CHIR99021 leads to a significant upregulation of TCF4 at both protein and transcript levels (Figure 4). This suggests that iCRT3-mediated inhibition of specific TCF/LEF family members may disrupt a repressive transcriptional complex, thereby relieving suppression and triggering compensatory activation of other members such as TCF4. This contrasts with the previously reported role of iCRT3 in hepatocellular carcinoma, where it inhibits β-catenin/TCF4-mediated oncogenesis [30]. Second, the combination of iCRT3 and CHIR99021 can synergistically overactivate the Wnt/β-catenin signaling pathway. This phenomenon suggests that iCRT3 may have interfered with the inherent negative feedback inhibition mechanism of this pathway. This notion is supported by our finding that TCF1 knockdown upregulates AXIN2 (Figure 2), consistent with its role as a canonical transcriptional target of the Wnt/β-catenin pathway [31]. This remains a hypothesis that requires direct experimental testing in the future. Our data reveal a paradoxical, species-specific outcome of iCRT3 treatment in bovine EPSCs: it is associated with a synergistic upregulation of Wnt/β-catenin pathway components and target genes, concomitant with enhanced pluripotency marker expression. Since non-canonical Wnt-YAP/TAZ signaling has been reported to play an essential role in bovine stem cell populations, future studies should examine the possibility of whether the effects of iCRT3 overlap this or other β-catenin-independent pathways [13]. The context-dependent properties of iCRT3, shown by its opposite functions in different systems, suggest that any of these possibilities could occur.

Beyond the Wnt/β-catenin pathway itself, we further asked which downstream pathways are consistently altered. We hypothesize that this repressed coordination could be an evolutionary mechanism to preserve pluripotency of bovine cells. PI3K-Akt and MAPK inhibition have the potential to reprogram metabolism to a more quiescent state and at the same time induce cell cycle arrest, especially in the G1 phase, which are both synonymous with naïve pluripotency [32,33]. By decreasing these proliferative signals, bEPSCs can establish a protective mechanism against premature differentiation, thereby maintaining the undifferentiated state even under suboptimal Wnt/β-catenin signaling conditions. Our study establishes that iCRT3, particularly with CHIR99021, reinforces the core pluripotency transcriptional network. This is evidenced by the upregulation of key markers (NANOG, SOX2, OCT4) and a global transcriptomic shift supportive of pluripotency (Figure 5). While these data strongly indicate a stabilized pluripotent state, definitive proof of enhanced functional potency through differentiation assays remains a crucial goal for future research.

In conclusion, we identify two pillars of the bovine pluripotency network: Wnt/β-catenin signaling homeostasis and the critical, non-redundant role of TCF1. The unexpected agonist-like effect of iCRT3 highlights the remarkable species-specific rewiring of this core pathway. The precise mechanism—whether via compensatory feedback, network rewiring, or crosstalk with non-canonical pathways—presents a compelling question for future investigation. Similarly, our observation that Wnt perturbations can prime bEPSCs toward distinct lineage biases, although inferred from robust transcriptional signatures, opens the door for future functional validation using differentiation assays. This work provides a refined framework for understanding and manipulating livestock pluripotency, with broad implications for agriculture and biomedicine.

In summary, we propose that basic biology and practical application studies should go hand in hand. This study not only addresses the iCRT3 puzzle, but also illustrates the flexibility of pluripotency during evolution, and enables further studies to obtain species-specific stem cell cultures with revolutionary applications in agriculture and biomedicine.

5. Conclusions

In this study, the detailed mechanism through which Wnt/β-catenin signaling homeostasis upholds bEPSCs was systematically elucidated, and we demonstrated that this homeostasis operates within a species-specific regulatory network. We initially discovered that, contrary to simple activation or inhibition, the pluripotent homeostasis of bEPSCs can be preserved only under the conditions of the fine balance of the Wnt/β-catenin signal (Result 1). Subsequent research suggested transcription factor TCF1 as a central hub for merging the Wnt/β-catenin signaling and pluripotent networks, and a lack thereof would directly interfere with stem cell conditions (Result 2). We uncovered a striking, species-specific pharmacological response where iCRT3, in combination with CHIR99021, is associated with enhanced Wnt/β-catenin signaling output and pluripotency. While the exact mechanism warrants further investigation (e.g., via TOPFlash assays or detailed analysis of β-catenin complex composition), this finding underscores the extensive rewiring of core pluripotency pathways in livestock species and provides a novel strategy for modulating bovine stem cell states (Result 3). It was demonstrated using global transcriptome profiles that various Wnt/β-catenin signals may induce bEPSCs to various pluripotent phases and simultaneously suppress pro-mitotic pathways including PI3K-Akt/MAPK, which exposed a common transcriptional answer to the treatments (Result 4).

Overall, in this work we not only identified TCF1 as the central hub of the bovine pluripotency regulatory network but also revealed a deeper, fundamental signaling reprogramming phenomenon manifested by the iCRT3 effect. This understanding establishes a critical theoretical foundation for refining livestock stem cell culture systems. It further demonstrates the feasibility of a non-genetic regulatory paradigm, in which pluripotent stem cell fate can be precisely guided through small-molecule modulation alone. The iCRT3 co-regulatory mechanism identified in this study offers a novel strategy for constructing bovine blastoid-like and gastruloid-like structures in vitro, which can be used to model key events of early embryonic development [25]. This will provide a more realistic in vitro model platform for livestock breeding, disease modeling, and developmental biology research.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani16040535/s1, Figure S1: Analysis of Pluripotency Marker Expression under Different Wnt Modulation Conditions; Figure S2: Analysis of Wnt Pathway Activity upon Pharmacological Perturbation; Figure S3: Related Analysis of Lineage Markers and Protein Expression; Figure S4: Differential Expression and Pathway Analysis for CHIR99021 and iCRT3 Groups.

Author Contributions

Conceptualization, B.Q., J.W., X.H. and M.S.; Methodology, D.L., B.Q., J.W., X.H. and M.S.; Software, J.W.; Validation, D.L., B.Q., J.W., X.H. and M.S.; Formal analysis, D.L. and B.Q.; Investigation, D.L. and B.Q.; Resources, X.L. (Xihe Li), Y.L. and X.L. (Xueling Li); Data curation, D.L. and B.Q.; Writing—original draft, D.L., B.Q., Y.L. and X.L. (Xueling Li); Writing—review and editing, D.L., B.Q., Y.L. and X.L. (Xueling Li); Visualization, D.L. and B.Q.; Supervision, D.L., X.L. (Xihe Li), Y.L. and X.L. (Xueling Li); Project administration, X.L. (Xihe Li), Y.L. and X.L. (Xueling Li); Funding acquisition, Y.L. and X.L. (Xueling Li). All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

The bEPSCs used in this study were kindly provided by Xihe Li.

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw RNA-seq data generated in this study have been deposited in the CNCB database under accession number PRJCA057677.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This research was funded by the Science and Technology Major Project of the Inner Mongolia Autonomous Region of China to the State Key Laboratory of Reproductive Regulation and Breeding of Grassland Livestock (2023KYPT0010 & 2021ZD0048), the National Natural Science Foundation of China (32160172), the development plan for young scientific and technological talents in colleges and universities of Inner Mongolia Autonomous Region of China (NMGIRT2204). And Natural Science Foundation of Inner Mongolia Autonomous Region (2024QN03010 to Y.L.).