Anthropogenic Underwater Noise Induces Anxiety-like Behavior in Zebrafish

Simple Summary

Anthropogenic underwater noise is an emerging environmental pollutant, yet its impacts on fish remain poorly understood. This study examined the effects of continuous daytime and nighttime noise exposure on adult zebrafish. We found that noise triggered anxiety-like responses, including increased bottom-dwelling and reduced exploration, with more pronounced effects during the night. Physiological and molecular analyses revealed that these behavioral changes were linked to a dysregulated stress hormone response and altered levels of key neurotransmitters in the brain, specifically serotonin and dopamine. Our findings demonstrate that underwater noise pollution can adversely affect fish welfare by disrupting core neuroendocrine pathways. This evidence is crucial for informing environmental policies aimed at mitigating the ecological impacts of anthropogenic noise.

Abstract

Underwater noise pollution, driven by human activities, is an emerging environmental concern, yet its effects on fish behavior and physiology remain poorly understood. As a vertebrate model with conserved stress pathways, zebrafish (Danio rerio) is well-suited for investigating the mechanistic basis of such impacts. We hypothesized that daytime and nighttime noise exposure would differentially induce anxiety-like behavior and associated neuroendocrine disruptions in zebrafish, with effects varying by sex. To evaluate this hypothesis, adult zebrafish were exposed to anthropogenic noise (100–1000 Hz, 130 dB) for seven days, specifically during daytime (08:00–20:00) and nighttime (20:00–08:00) periods. Behavioral assays revealed that noise exposure delayed the first entry of females into the top zone during daytime, while both sexes exhibited prolonged bottom-dwelling and reduced exploratory behavior under nighttime noise. Physiological analyses showed elevated plasma cortisol levels in females, accompanied by up-regulated HPI-axis genes, whereas males displayed a non-significant cortisol increase. Neurotransmitter profiling indicated a sex-specific response to nighttime noise: In females, brain 5-hydroxytryptamine (5-HT) showed a non-significant increasing trend, whereas in males it was significantly elevated, while dopamine (DA) decreased in both sexes. Gene expression analysis further revealed disruptions in 5-HT and DA pathways. These findings demonstrate that underwater noise induces anxiety-like behavior in zebrafish by dysregulating endocrine and neurotransmitter systems, with nighttime noise exhibiting more pronounced effects, suggesting that chronic exposure to anthropogenic noise may impair natural behavior and stress regulation in aquatic species, particularly during nighttime periods.

1. Introduction

In recent years, accelerated global industrialization and increasingly frequent human aquatic activities have led to underwater noise pollution becoming a critical environmental concern worldwide. Anthropogenic underwater noise can be categorized into two types based on intensity: short-term, high-intensity noise and continuous, low-intensity noise. Sources of high-intensity noise include pile driving, geological exploration airguns, sonar operations, and underwater explosions, which have been shown to cause immediate physical harm to aquatic animals [1,2,3]. In contrast, low-intensity noise originates from activities such as wind farm operations and vessel traffic [4,5]. Although lower in intensity, this noise is typically chronic and spectrally confined to frequencies below 1000 Hz, which significantly overlaps the auditory range of many fishes [6,7,8]. Consequently, prolonged exposure to anthropogenic noise can mask biologically relevant acoustic signals, disrupt behavioral patterns, and ultimately threaten the health and ecological fitness of fish populations. This impact has been documented across a wide range of marine and freshwater ecosystems globally [9,10].

Anxiety response, an adaptive element of the stress response, is characterized by persistent worry and heightened vigilance toward the environment, representing a natural emotional reaction to unknown or potential threats in animals [11,12]. Fish are highly sensitive to various aquatic environmental stressors, including physical and chemical parameters such as dissolved oxygen, pH, and temperature, as well as external stimuli like noise, light, and chemical contaminants [13,14,15]. Among these stressors, anthropogenic noise has emerged as a pervasive pollutant of increasing concern, with demonstrated potential to disrupt neural function and induce system-wide physiological alterations.

In humans, chronic noise exposure is associated with anxiety and depression, adversely affecting social functioning. Parallel evidence from mammalian models indicates that sub-chronic noise exposure can alter brain serotonergic and dopaminergic neurotransmission, potentially leading to psychological disorders [16]. These findings in mammals provide a mechanistic framework for understanding how noise may disrupt conserved neural and endocrine pathways across vertebrates. In fish, underwater noise has been well-documented to trigger generalized neuroendocrine stress responses, such as a significant elevation in plasma cortisol levels, as observed in species including common carp (Cyprinus carpio), European perch (Perca fluviatilis), and gilthead sea bream (Sparus aurata) following exposure to ship noise and other anthropogenic acoustic disturbances [17,18]. Although a few studies have reported behavioral alterations indicative of anxiety-like states in fish [19,20], direct evidence remains limited and the underlying physiological and molecular mechanisms are still poorly understood.

Zebrafish (Danio rerio) is a widely used model organism in fields such as developmental biology, toxicology, drug discovery, and environmental monitoring. Due to the presence of Weberian ossicles, which connect the swim bladder to the inner ear, zebrafish exhibit high auditory sensitivity and serve as an ideal model for studying noise-induced stress [21,22]. Adult zebrafish can rapidly learn to discriminate between complex sounds [23]. This suggests that they rely on the acoustic landscape for key behavioral and ecological interactions. The acoustic parameters used in this study (continuous noise, 100–1000 Hz, 130 dB re 1 μPa) were intended to simulate common anthropogenic underwater noise. This sound pressure level falls within the typical range of near-field noise for medium and small vessels and represents a widespread source of chronic noise pollution in aquatic environments [24]. However, the fundamental justification for employing zebrafish transcends their established auditory acuity and ecological reliance on complex soundscapes. This model system uniquely bridges behaviorally relevant acoustic disruption with mechanistic resolution at the cellular and molecular levels. Moreover, zebrafish possesses a robust capacity for hair cell regeneration, which is absent in mammals and remains underexplored in other piscine models [25]. This unique attribute provides an unprecedented opportunity to dissect endogenous protective mechanisms against noise-induced trauma, thereby transcending the descriptive limitations of traditional ichthyological approaches that are confined to documenting injury phenotypes. For these reasons, studying the effect of anthropogenic noise in adult zebrafish provides key advantages over similar research conducted earlier in other vertebrate species. Anthropogenic noise acts as an unnatural and unpredictable stressor. Stress can activate the HPI-axis in fish, leading to elevated cortisol levels, which in turn trigger a series of anxiety-like behaviors, including avoidance behaviors and reduced feeding [26]. Furthermore, given the critical role of sex hormones in regulating neuroendocrine and behavioral responses, as well as the well-documented sexual dimorphism in stress responses among vertebrates [27,28], we further hypothesize that the anxiety-like behaviors induced by such noise may exhibit sex-dependent differences.

This study aims to investigate and compare the effects of daytime vs. nighttime noise exposure on anxiety-like behaviors in zebrafish and to explore potential neuroendocrine and molecular mechanisms. We exposed adult zebrafish to daytime noise (100–1000 Hz, 130 dB, from 08:00 to 20:00) or nighttime noise (100–1000 Hz, 130 dB, from 20:00 to 08:00) for 7 days. We assessed anxiety-related behavioral parameters, plasma cortisol levels, brain concentrations of 5-hydroxytryptamine (5-HT) and dopamine (DA), and the expression of genes associated with stress and anxiety. The findings are expected to contribute to a scientific basis for the management of underwater noise pollution and the conservation of aquatic living resources.

2. Materials and Methods

2.1. Chemicals

Cortisol, 5-HT and DA ELISA kits were obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). RNAiso Plus, PrimeScript^TM RT reagent Kit with gDNA Eraser, and TB Green^® Premix EX Taq™ II were purchased from TaKaRa (Dalian, China).

2.2. Noise Exposure

Adult zebrafish of the AB strain were acquired from the National Zebrafish Resource Center (Wuhan, China). After a two-week acclimatization period in an indoor soundproof recirculating aquaculture system, a total of 540 healthy fish (270 females: 0.59 ± 0.10 g; 270 males: 0.47 ± 0.07 g) were selected for the experiment. All procedures were approved by the Animal Care and Use Committee of Key Laboratory of Animal Biology of Chongqing at Chongqing Normal University (approval No. Zhao-20231012-03).

The fish were randomly distributed into three experimental groups: (1) control group (no additional noise); (2) daytime noise group (100–1000 Hz, 130 dB, applied continuously from 08:00 to 20:00); (3) nighttime noise group (100–1000 Hz, 130 dB, applied continuously from 20:00 to 08:00). Each group consisted of three replicate tanks (50 × 40 × 30 cm), with 60 fish per tank (1:1 sex ratio) and a water volume of 50 L.

Noise exposure was conducted using specialized acoustic equipment following the methodology described in our recent studies [27,29]. The tanks were placed on polystyrene foam boards and surrounded by sound-absorbing cotton to isolate external acoustic interference. Following established methodologies [30], a signal generator (DG1022Z, RIGOL, Beijing, China) was used to generate sound signals, which were amplified and transmitted via an underwater speaker (UW-30, Burnsville, MN, USA) to simulate anthropogenic underwater noise. The emitted noise in tanks was recorded using a digital hydrophone (VST-DH series, Nanjing Haohai Ocean Technology Co., Ltd., Nanjing, China), and the sound files were analyzed using a MATLAB (version R2023b) script to calculate sound pressure levels (reference: 1 μPa underwater). In this study, the frequency range of 100–1000 Hz was selected to reflect the dominant energy distribution of human-generated underwater noise, which overlaps with the auditory sensitivity of many fish species, and the applied noise intensity (130 dB) is consistent with values reported in studies on anthropogenic underwater noise [4,31,32]. To verify the uniformity of the acoustic exposure, we quantified the power spectral density (PSD) at multiple spatial points within the experimental aquaria. Statistical analysis revealed no significant differences in PSD profiles across measurement locations. Given the free-swimming behavior of the fish, this spectral homogeneity demonstrates that the acoustic field was spatially consistent, ensuring all individuals within a given treatment experienced an identical sound environment (Supplementary Figures S1 and S2). During the experimental period, all fish were maintained under a 12 h:12 h light–dark cycle and were fed twice daily (09:00 and 17:00) with commercial feed. Each tank was equipped with filtration systems to maintain water quality. Half of the water was replaced every two days using dechlorinated and aerated tap water. Water parameters were maintained at approximately 28 °C for temperature, 7.4 for pH, and not less than 6 mg/L for dissolved oxygen.

After 7 days of exposure, sampling was conducted. Six fish per sex were randomly selected from each tank for anxiety behavior testing within a fixed daily time window to control for circadian influences. All behavioral trials were video-recorded using a high-resolution camera, and subsequent scoring was performed manually by an observer who was blinded to the treatment groups, and subsequent scoring was performed manually by an observer who was blinded to the treatment groups. The remaining fish were fasted for 24 h and then anesthetized with MS-222 (Sigma-Aldrich, St. Louis, MO, USA). Nine individual fish per sex from each tank were selected for tissue collection: the brains of three fish were pooled and homogenized in 1 mL of RNAiso Plus reagent (TaKaRa, Dalian, China) for RNA extraction and RT-qPCR analysis, and another six brains per sex were flash-frozen in liquid nitrogen and stored at −80 °C for 5-HT and DA quantification. The remaining fish were used for plasma cortisol analysis.

2.3. Anxiety-like Behavior Test

Anxiety-like behavior was assessed using the Novel Tank Diving test [33,34] in a glass tank (25 × 15 × 20 cm) filled with 4 L of water. The tank was virtually divided into two equal vertical zones (top and bottom) to quantify exploratory activity. Individual fish were gently placed into the test tank, and their behavior was immediately recorded for 5 min. Behavioral scoring was performed by an observer who was blinded to the experimental groups. The following parameters were analyzed: (1) latency to first enter the top zone, (2) total time spent in the bottom zone, and (3) frequency of entries into the top zone [35,36].

2.4. Biochemical Analyses

2.4.1. Cortisol

Blood was collected by making an incision at the posterior region of the head using sterile dissecting scissors. The blood welling up from the incision was immediately collected with heparinized capillary tubes and transferred into heparinized microcentrifuge tubes. Blood samples from approximately 15 fish of the same sex within each tank were pooled to form a single biological replicate. Thus, for cortisol measurement, the sample size (n) represents the number of independent tank replicates (n = 3 tanks per sex per treatment condition). Samples were centrifuged at 4 °C, 5000 r/min for 15 min to separate plasma. The plasma supernatant was aliquoted and stored at −80 °C until analysis. Blood samples from fish of the same sex within each tank were pooled to form a single biological replicate. Cortisol concentrations were determined using a commercial ELISA kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) strictly following the manufacturer’s protocol.

2.4.2. 5-HT and DA

Brain tissues were homogenized in normal saline (1:9 w/v) and centrifuged at 3000 r/min for 20 min. The supernatant was collected and stored at −80 °C until analysis. Levels of 5-HT and DA were quantified using ELISA kits in strict accordance with the instructions.

2.5. RNA Extraction and RT-qPCR Analysis

Total RNA was extracted from pooled brain samples (three fish per sample) using RNAiso Plus reagent. Pooling was necessary to obtain sufficient RNA yield and enabled the assessment of group-level, sex-specific responses, though it precludes analysis of individual variability. RNA concentration and purity were assessed spectrophotometrically, and integrity was confirmed via 1% agarose gel electrophoresis. cDNA was synthesized using the PrimeScript™ RT Reagent Kit (TaKaRa, Dalian, China) with gDNA Eraser and stored at –80 °C after dilution. Quantitative PCR was performed using TB Green^® Premix EX Taq™ II on a CFX96 real-time PCR system. The thermal cycling conditions were: 95 °C for 30 s; 40 cycles of 95 °C for 5 s, 60 °C for 30 s, and 72 °C for 30 s; followed by melting curve analysis. Gene-specific primers are listed in Table 1. The reference genes ef1α and β-actin were used for normalization, and relative expression was calculated using the 2^−ΔΔCt method.

Table 1.

Primers sequences for RT-qPCR of genes associated with stress response and anxiety-like behavior in zebrafish.

Gene	Sequence (5′ to 3′)	Size (bp)	Accession NO.
crha	F 1: AGACAGCAGACTCTCACCGACA R 2: GGACACCGCAACGACAACCA	100	XM009298729.3
crhb	F: GGAGCCGCCGATTTCCCTAGAT R: GCTGATGGGTTCGCTTGTGGTT	147	NM001007379.1
crhbp	F: ACAGCAGAGCGACCGCAGTTA R: ACCCTTCATCACCCAGCCATCA	144	NM001003459.1
crhr1	F: GTGGCATCGCTGGCAAGACAA R: ACGGCTGACGACTGCTTGATAC	114	XM691254.6
crhr2	F: GGCGACCTCAACTGTACTCTCC R: TTCATCCGTGGTGGCGTTACAA	111	NM001113644.1
actha	F: CGAGCAAACGCAAAGACAACCA R: CCAAGAGCCAAGCAGGACACAA	127	NM181438.3
acthb	F: GCACCACCAGACAAACGATACG R: GAACTGCTGTCCATTGCCGATG	108	NM001083051.1
tph1b	F: TCGGAGGACTTGTCAAGGCATT R: TGTCACAATCCACCAGCACTTC	120	NM001001843.2
tph2	F: GTGCTACCAGGAGTGCCTCATT R: ATGCTCTGCGTGTAAGGGTTGT	147	NM214795.2
slc6a4a	F: TCAGTGCAAGAGGACCACCATC R: CACAACCAGCCTGCCGTTCT	139	NM001039972.1
htr1aa	F: GCGACGAGTGTCAGCGAAGTTG R: TCCAAGGCGATAGCAGCGATGA	119	NM001123321.1
htr1ab	F: GCGTGTGTTGTGGCGGCTAT R: AGCACGAGCACCGACACCAT	107	NM001145766.1
htr1b	F: TGCGTTTGTCATTGCCACCATT R: CACGAGCACCGACACCAGAA	106	NM001128709.1
mao	F: ACACGGACGGACAGCACCAT R: TCTTCCACCAACACGGCTTCTG	147	NM212827.3
th	F: GACTGAGCGAGCAGATCGTGTT R: TTCGGCTGGGTCTGGTTTCAAG	162	NM131149.1
drd2a	F: CCAAGAGGAGAGTCACCGTCAT R: AAGGCAGGATTCGCAATCACAC	133	NM183068.1
drd2b	F: TGCCATGCTCCTGACTCTCCTC R: GCCACCGCCAAGCTGACAAT	126	NM197936.1
slc6a3	F: TTCAGTTCACCTCCTCCAGCCT R: ATCCACAGCGAAGCCGATGAC	146	NM131755.1
comta	F: TGGTGGTGGTGTTGGCATCTG R: CGCTGTGGTCGTGATAGTCCTG	127	NM001030157.2
comtb	F: TGTTGGAGATGAGAAAGGCTGT R: CGAGCGATGCGAACTGTAGA	111	NM001083843.1
slc18a2	F: CACAGATGACGAGGAACGAGGA R: TGCCAGCACTGCCAGGATAAG	145	NM001256225.2
ef1α	F: GATCACTGGTACTTCTCAGGCTGA R: GGTGAAAGCCAGGAGGGC	121	FJ915061
β-actin	F: CGAGCTGTCTTCCCATCCA R: TCACCAACGTAGCTGTCTTTCTG	86	AF025305.1

¹ F: forward primer; ² R: reverse primer.

2.6. Statistical Analysis

All data are expressed as mean ± SEM. Data were analyzed using SPSS 26.0 software (IBM, Armonk, NY, USA). Normality of the data distribution was verified using the Shapiro–Wilk test. One-way ANOVA was employed for intergroup comparisons, with Tukey’s HSD test applied for post hoc multiple comparisons. Differences were considered statistically significant at p < 0.05. All graphs were generated using GraphPad Prism 8 (GraphPad Software, San Diego, CA, USA).

3. Results

3.1. Anxiety-like Behavior

In the novel tank test, anxiety-like behavior is indicated by delayed top entry, prolonged bottom dwelling, and reduced zone transitions. In females, both daytime and nighttime noise exposure significantly delayed the latency to first enter the top zone compared to the control group (p = 0.014, partial η² = 0.16; Figure 1A). Although there was an increasing trend in the time spent in the bottom zone, no statistically significant difference was observed among the groups (Figure 1B). Additionally, the frequency of entries into the top zone decreased significantly following nighttime noise exposure (p = 0.03, partial η² = 0.13; Figure 1C).

Figure 1.

Effects of daytime and nighttime noise on anxiety-like behavior in zebrafish. (A,D) Latency to first enter the top zone, (B,E) total time spent in the bottom zone, and (C,F) frequency of entries into the top zone in female (A–C) and male (D–F) zebrafish. Data represent mean ± SEM (n = 18). Different lowercase letters indicate significant differences between groups by Tukey’s HSD post hoc test (p < 0.05).

In males, nighttime noise exposure produced significant effects across all measures. It significantly increased the latency to first enter the top zone (p = 0.003, partial η² = 0.20; Figure 1D) and the total time spent in the bottom zone (p = 0.001, partial η² = 0.23; Figure 1E) compared to both the control and daytime noise groups. Concurrently, it significantly decreased the frequency of entries into the top zone (p = 0.002, partial η² = 0.22; Figure 1F).

3.2. Plasma Cortisol Levels and Expression of HPI Axis-Related Genes

To investigate the impact of noise on the neuroendocrine stress axis, we measured plasma cortisol levels and the expression of key genes along the HPI axis. In females, plasma cortisol levels increased significantly after exposure to both daytime and nighttime noise compared to the control group (p = 0.005, partial η² = 0.83; Figure 2A). crhb (p = 0.02, partial η² = 0.75) expression was significantly up-regulated under both daytime and nighttime noise, while crhbp (p = 0.02, partial η² = 0.645) and actha (p = 0.009, partial η² = 0.79) expression was up-regulated only after nighttime noise. The expression levels of crha, crhr1, crhr2, and acthb showed no significant changes under either noise condition (Figure 2B).

Figure 2.

Plasma cortisol levels and HPI axis gene expression in zebrafish. (A,C) Plasma cortisol concentrations and (B,D) relative mRNA expression levels of HPI axis-related genes in female (A,B) and male (C,D) zebrafish. Data represent mean ± SEM (n = 3 replicates. Each replicate included approximately 15 fish for cortisol, 3 fish for gene expression). Different lowercase letters indicate significant differences between groups by Tukey’s HSD post hoc test (p < 0.05).

In males, cortisol levels showed a slight increase under noise exposure, but the difference was not statistically significant (Figure 2C). Nighttime noise exposure significantly down-regulated the expression of crhr1 (p = 0.02, partial η² = 0.72), while the expression levels of other tested genes showed no significant changes among groups (Figure 2D).

3.3. Brain 5-HT Levels and Expression of 5-HT Pathway-Related Genes

To assess serotonergic system alterations under noise stress, we measured brain 5-HT levels and key pathway gene expression. In females, 5-HT concentrations showed a slight increase after both daytime and nighttime noise exposure (Figure 3A). The expression of tph1b (p = 0.03, partial η² = 0.71) was significantly up-regulated after nighttime noise exposure, while the expression levels of tph2, slc6a4a, htr1aa, htr1ab, htr1b, and mao showed no significant changes among groups (Figure 3B).

Figure 3.

Brain serotonin (5-HT) levels and related gene expression in zebrafish. (A,C) Brain 5-HT concentrations and (B,D) relative mRNA expression levels of 5-HT pathway-related genes in female (A,B) and male (C,D) zebrafish. Data represent mean ± SEM (n = 3 replicates. Each replicate included 6 fish for 5-HT, 3 fish for gene expression). Different lowercase letters indicate significant differences between groups by Tukey’s HSD post hoc test (p < 0.05).

In males, a significant increase in 5-HT levels was observed exclusively in the nighttime noise group (p = 0.005, partial η² = 0.83), with no significant changes detected in the daytime noise group (Figure 3C). Nighttime noise exposure significantly up-regulated the expression of tph2 (p = 0.02, partial η² = 0.72), but down-regulated the expression of slc6a4a (p = 0.001, partial η² = 0.89) and mao (p = 0.05, partial η² = 0.19). The expression levels of tph1b, htr1aa, htr1ab, and htr1b showed no significant changes under both noise conditions (Figure 3D).

3.4. Brain DA Levels and Expression of DA Pathway-Related Genes

To determine dopaminergic system involvement, we measured brain dopamine (DA) levels and key pathway gene expression. In females, both daytime and nighttime noise exposure led to a significant decrease in brain DA concentrations (p = 0.004, partial η² = 0.841) compared to the control group (Figure 4A). Daytime and nighttime noise significantly down-regulated drd2b (p = 0.007, partial η² = 0.81) and up-regulated comta (p = 0.01, partial η² = 0.78) and comtb (p = 0.005, partial η² = 0.44). The expression levels of th, drd2a, slc6a3, and slc18a2 showed no significant changes under either noise condition (Figure 4B).

Figure 4.

Brain dopamine (DA) levels and related gene expression in zebrafish. (A,C) Brain DA concentrations and (B,D) relative mRNA expression levels of DA pathway-related genes in female (A,B) and male (C,D) zebrafish. Data represent mean ± SEM (n = 3 replicates. Each replicate included 6 fish for DA, 3 fish for gene expression). Different lowercase letters indicate significant differences between groups by Tukey’s HSD post hoc test (p < 0.05).

In males, a significant decrease in brain DA concentrations was observed after both daytime and nighttime noise exposure compared to the control group (p = 0.009, partial η² = 0.79; Figure 4C). Nighttime noise exposure significantly down-regulated drd2b (p = 0.02, partial η² = 0.74) and slc6a3 (p = 0.07, partial η² = 0.81) compared to both the control and daytime groups. The expression levels of th, drd2a, comta, comtb and slc18a2 showed no significant changes under either noise condition (Figure 4D).

4. Discussion

When zebrafish are exposed to a novel environment, their instinctive response is to seek refuge at the bottom of the tank. As they acclimate and perceive the environment as safe, they gradually begin to explore the upper zone. Therefore, a longer latency to first enter the top zone, increased time spent in the bottom zone, and reduced frequency of transitions between zones are established indicators of heightened anxiety-like behavior [37]. Our behavioral assessments revealed that both daytime and nighttime noise exposure significantly delayed the latency for females to first enter the top zone. In males, however, significant increases in this latency and in the time spent in the bottom zone, alongside a decreased frequency of top-zone entries, were observed specifically after nighttime noise exposure. Furthermore, this pattern of noise-induced anxiety is consistent with the findings of Wong et al. [20], who demonstrated that exposure to various temporal patterns of noise (including continuous, fast and slow regular intermittent, and irregular intermittent regimes at 150 dB) for 24 h induced anxiety-like behavior, with all noise-exposed fish spending > 98% of the first minute in the bottom zone compared to 82% in controls. Collectively, these results robustly demonstrate that underwater noise can induce anxiety-like behavior in zebrafish, and our study further reveals that nighttime exposure elicits more pronounced effects, particularly in males. This pattern of heightened nighttime vulnerability is consistent with our recent findings that underwater noise causes more severe developmental impairments in zebrafish embryos during the night than during the day [29].

Cortisol, the primary glucocorticoid in fish, is a key physiological indicator of stress and anxiety, typically elevated in anxious states [38]. Consistent with studies in other fish species exposed to anthropogenic noise [17,18,39], we found that plasma cortisol levels were significantly elevated in female zebrafish following both daytime and nighttime noise exposure. The stress-induced secretion of cortisol is regulated by the hypothalamus–pituitary–interrenal (HPI) axis, wherein corticotropin-releasing hormone (CRH) produced by the hypothalamus plays a pivotal role in modulating physiological and behavioral stress responses in teleosts. CRH activates the endocrine stress response by stimulating the pituitary secretion of adrenocorticotropin hormone (ACTH), and its biological activity is further fine-tuned by the soluble binding protein CRH-BP [40,41]. In females, we observed significant up-regulation of crhb after daytime noise stress, and up-regulation of crhb, crhbp, and actha after nighttime noise stress, which aligned with the observed increase in plasma cortisol concentrations. Given that CRH overexpression can directly induce stress and anxiety-like responses [42], our results suggest that noise may promote anxiety behavior in females both directly via CRH signaling and indirectly by activating the HPI axis to enhance cortisol synthesis and secretion. It is important to note that the observed HPI axis activation and cortisol elevation could stem from two distinct, yet possibly interrelated, mechanisms: the direct physiological stress response to noise itself, as evidenced in prior studies [32], or the secondary effects of noise-induced sleep disruption. Unlike females, male zebrafish displayed only a slight and statistically insignificant rise in plasma cortisol after noise exposure. This attenuated cortisol response may reflect an adaptive mechanism, as prolonged stress can trigger negative feedback to downregulate HPI axis activity and prevent excessive glucocorticoid production [43]. Nevertheless, the persistence of anxiety-like behavior despite the blunted cortisol response implies that other neurochemical systems may play a more critical role in mediating noise-induced anxiety in males.

5-HT is a key inhibitory neurotransmitter that regulates anxiety, depression, and other emotional states within the central nervous system [44]. Dysregulation of 5-HT levels, whether too high or too low, has been linked to anxiety-like behavior [45]. Studies in zebrafish have reported significant increases in brain 5-HT concentration during anxiety states [44,46]. In this study, we observed a slight increase in brain 5-HT levels in females following both daytime and nighttime noise stress, whereas a significant increase was detected in males specifically after nighttime noise exposure. These neurochemical changes align with the observed enhancement of anxiety-like behaviors in both sexes following noise stress and are supported by previous findings that prolonged noise exposure elevates brain 5-HT [47]. The concentration of 5-HT in the brain is tightly controlled by its biosynthesis and metabolic pathways. Tryptophan hydroxylase (TPH) is a rate-limiting enzyme for 5-HT synthesis, and increased TPH activity can lead to higher 5-HT levels [48]. After release into the synaptic cleft, 5-HT homeostasis is maintained through reuptake by the serotonin transporter (SERT) or degradation by monoamine oxidase (MAO) [49,50]. Our molecular data revealed that nighttime noise stress significantly up-regulated the expression of tph1b in female brains. Furthermore, in the nighttime noise group, we observed significant up-regulation of tph2 and slc6a4a (which encodes SERT), alongside significant down-regulation of mao. This pattern of gene expression is consistent with the observed increase in brain 5-HT concentration and resonates with previous reports that noise can activate TPH and reduce SERT in the central auditory system [48,51]. Collectively, our results suggest that noise stress likely elevates brain 5-HT levels by modulating the expression of key genes in the 5-HT pathway, consequently promoting anxiety-like behavior in zebrafish. A comparison of daytime vs. nighttime effects on both 5-HT levels and gene expression further supports that nighttime noise inflicts more severe adverse effects on zebrafish.

DA also plays a pivotal role in the regulation of anxiety-like behavior, in addition to 5-HT. Subchronic noise exposure has been reported to reduce DA concentration in the brain of rat (Rattus norvegicus) [16]. Similarly, our study found that both daytime and nighttime noise exposure significantly decreased brain DA levels in both female and male zebrafish compared to the control group. The biosynthesis of DA, derived from tyrosine, is regulated by the rate-limiting enzyme tyrosine hydroxylase (TH) [52]. Furthermore, synaptic DA concentrations are primarily governed by its reuptake via presynaptic dopamine transporters (DAT), which are critical for maintaining DA homeostasis and signal duration [53]. Our results showed significant downregulation of drd2b expression in female brains after daytime noise and in both sexes after nighttime noise. Moreover, slc6a3 (encoding DAT) expression in male brains was significantly lower after nighttime noise than in control and daytime noise groups. These molecular changes align with the observed reduction in brain DA concentrations. Additionally, catechol-O-methyltransferase (COMT) is involved in the metabolic inactivation of DA [54]. In this study, the expression of comta and comtb was significantly upregulated in female brains after both noise regimes, consistent with the decreased DA levels. These molecular changes suggest that noise interferes with DA signaling by altering its receptor expression, reuptake, and metabolism, thereby promoting anxiety-like behavior.

It should be noted that the findings of this study are constrained by its experimental context. While the controlled laboratory conditions allowed for precise noise exposure, this simplification limits the direct extrapolation of the results to more complex and variable natural acoustic environments. Additionally, the present design does not permit a rigorous dissection of whether the observed effects are driven by noise as a direct physiological stressor or are mediated indirectly through behavioral interference such as sleep disruption. Future work incorporating targeted controls, such as continuous light exposure to isolate sleep effects, would be valuable in delineating the contributions of these potential mechanisms.

5. Conclusions

The present study demonstrated that underwater noise increased anxiety-like behavior in zebrafish by interfering with the endocrine system and neurotransmission. Specifically, noise exposure elevated plasma cortisol levels in female zebrafish through altered expression of HPI axis-related genes. Concurrently, noise affected brain neurotransmission by increasing 5-HT and decreasing DA concentrations, mediated by changes in the expression of key genes involved in the 5-HT and DA pathways. These alterations in plasma cortisol and neurotransmitter levels collectively contributed to the observed increase in anxiety-like behavior. Furthermore, compared with daytime noise, nighttime noise induced more pronounced anxiety-like responses in zebrafish, underscoring the importance of temporal factors in noise impact assessment.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ani16040536/s1, Figure S1: Power spectral density (PSD) during noise playback in a representative experimental tank; Figure S2: Power spectral density (PSD) of the ambient background noise.

Author Contributions

Conceptualization, Q.C., W.Y. and Z.Z.; methodology, Q.C. and Y.D.; software, W.Y. and M.X.; validation, Y.D. and T.Z.; formal analysis, Y.D. and Y.L.; investigation, Y.D. and W.Y.; resources, Q.C. and H.H.; data curation, T.Z. and Y.D.; writing—original draft preparation, Y.D. and T.Z.; writing—review and editing, Q.C., W.Y., Z.Z. and M.X.; visualization, T.Z. and Y.L.; supervision, Q.C.; project administration, Q.C. and H.H.; funding acquisition, Q.C., W.Y. and H.H. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

The animal study protocol was approved by the Animal Care and Use Committee of the Key Laboratory of Animal Biology of Chongqing at Chongqing Normal University (approval No. Zhao-20231012-03, date of approval 12 October 2023).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Conflicts of Interest

Hui Huang is from Chongqing Southern Sheatfish Original Breeding Farm. The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Funding Statement

This research was funded by the Natural Science Foundation of Chongqing Municipality (CSTB2023NSCQ-MSX0754, CSTB2024NSCQ-LZX0094) and the Water Ecological Compensation Project for Shituo Yangtze River Bridge of the Newly built Chongqing-Wanzhou High-speed Railway (YWGT-AH-202511-002).