Early Growth and Serum Metabolic Profiling of One-Month-Old MSTN-Knockout Xinjiang Brown Cattle via CRISPR/Cas12Mix

Simple Summary

Improving growth efficiency in beef cattle is an important goal in animal farming. This study focused on a gene that limits muscle growth and examined whether genetic modification could improve early growth in cattle. A group of Xinjiang Brown cattle with changes in this gene was produced, and body development and blood composition were evaluated at one month of age. The results showed that these cattle had higher body weight and better body development than normal cattle, along with clear changes in blood substances related to energy use. These findings suggest that regulating genes involved in muscle growth can promote early growth and influence overall metabolism. This study provides new scientific evidence for developing more efficient beef cattle and supports the sustainable development of animal agriculture.

Abstract

Myostatin (MSTN) is a key negative regulator of skeletal muscle development, and its deficiency can markedly enhance muscle growth. However, the application of CRISPR/Cas12Mix in large livestock remains limited. In this study, 11 Xinjiang Brown calves were generated via embryo-stage CRISPR/Cas12Mix editing, among which five were confirmed as MSTN-knockout. These five edited calves were compared with five unedited controls to evaluate early growth traits and serum untargeted metabolomics at one month of age. MSTN-knockout calves exhibited significantly higher body weight, hip width, chest girth, and abdominal girth than controls (p < 0.05). Untargeted metabolomics identified 225 and 129 differential metabolites in positive and negative ion modes, mainly enriched in lipid, organic acid, and amino acid metabolism. KEGG pathway analysis revealed significant alterations in arginine and proline, tryptophan, and carbohydrate metabolism. These results demonstrate that CRISPR/Cas12Mix efficiently mediates MSTN knockout in cattle, conferring early growth advantages, accompanied by systemic metabolic reprogramming.

1. Introduction

Myostatin (MSTN, also known as growth differentiation factor-8, GDF-8) is a key member of the transforming growth factor β (TGF-β) superfamily and serves as a major negative regulator of skeletal muscle development [1]. It can inhibit the proliferation and differentiation of myogenic precursor cells and satellite cells via autocrine and paracrine mechanisms, thereby restricting muscle growth and development [2]. The MSTN gene is highly conserved across various species, including mammals and birds, and its loss or functional deficiency leads to skeletal muscle fiber hypertrophy and a significant increase in muscle mass, typically presenting as the “double-muscled” phenotype [3]. This phenomenon has been reported in cattle [4], sheep [5], pigs [6], chickens [7], and rabbits [8]. In bovine breeding, MSTN has been a major research focus and is considered a potential target for improving growth and production traits [9,10].

Meanwhile, the regulation of MSTN not only affects the morphological phenotype of skeletal muscle but also participates in energy metabolism and metabolic regulatory networks at multiple levels. Significant alterations in serum and tissue metabolomic profiles have been observed in MSTN gene-edited or naturally mutated models, involving pathways such as carbohydrate metabolism, lipid metabolism, amino acid metabolism, and bile acid metabolism [11,12,13,14,15], suggesting that MSTN deficiency may trigger systemic metabolic reprogramming. As an unbiased, high-throughput approach for detecting metabolites, metabolomics can capture the systemic metabolic reprogramming induced by gene editing, providing critical insights into the comprehensive effects of MSTN editing on physiological functions and molecular mechanisms.

Cas12i is a newly identified CRISPR gene-editing system characterized by a relatively small protein size (approximately 1033–1093 amino acids), the ability to autonomously process pre-crRNA, and the recognition of flexible PAM sequences, exhibiting high editing efficiency along with enhanced fidelity [16,17]. Based on Cas12i, CRISPR/Cas12Mix is a derived genome-editing system that integrates optimized Cas12i variants for efficient multiplex and high-fidelity gene editing. This editor has achieved efficient gene knockout in mammalian models such as mice and pigs [18,19], yet its application in large livestock remains limited. Therefore, further evaluation of Cas12i-derived editing systems, particularly CRISPR/Cas12Mix, for MSTN gene editing in cattle is of great significance for expanding the repertoire of gene-editing tools in livestock. In this study, we employed the CRISPR/Cas12Mix system to generate MSTN-knockout Xinjiang brown cattle and systematically compared the body measurements and blood metabolomic profiles between the edited and control groups at one month of age. The aim was to investigate the overall effects of MSTN knockout on growth, development, and metabolic networks in cattle, providing both theoretical support and practical basis for the application of gene editing in bovine breeding.

2. Materials and Methods

2.1. Experimental Animals

Last year, our team performed MSTN gene editing at the embryo stage using the CRISPR/Cas12Mix system. Briefly, the Cas12Mix editor together with sgRNAs targeting the bovine MSTN locus was delivered into fertilized embryos via microinjection, followed by embryo transfer to recipient cows, which ultimately resulted in the birth of 11 calves. Preliminary validation confirmed that five calves were successfully edited, including two females and three males. In the present study, a total of ten calves were selected, including five MSTN-edited Xinjiang Brown cattle as the experimental group (MT) and five non-edited Xinjiang Brown cattle as the control group (WT). Both the MT and WT groups consisted of two females and three males. All animals were raised at Mu Jun Cattle Farm in Xinyuan County, Ili Kazakh Autonomous Prefecture, Xinjiang Uygur Autonomous Region, under identical feeding and management conditions, and the animals were randomly selected from this population. Animal care and experimental procedures were approved by the Animal Ethics Committee of the Xinjiang Academy of Animal Science and were conducted in accordance with the committee’s guidelines for animal research.

2.2. Sample Collection and Processing

After birth, blood was collected from the jugular vein of the calves using anticoagulant tubes for the purpose of gene-editing validation. At one month of age, a total of ten calves—five successfully edited and five non-edited—were selected for blood sampling following a 12 h fasting period. Blood was drawn into sodium heparin tubes and processed for plasma separation by centrifugation at 3000 rpm and 4 °C for 15 min. The supernatant was aliquoted (0.2 mL per tube) into 1.5 mL centrifuge tubes and stored at −80 °C. Samples were then shipped on dry ice to Novogene Co., Ltd. (Beijing, China) for untargeted metabolomic analysis.

2.3. Experimental Procedures

2.3.1. Validation of Gene Editing

Genomic DNA was extracted from blood samples using a Tiangen DNA Extraction Kit. Two pairs of primers were designed at approximately 800 bp and 400 bp upstream and downstream of the target sequence (acactacatcctcaagacta) for nested PCR amplification, as listed in Table 1. Nested PCR was carried out using 2× Taq-HS PCR SuperMix (+dye) in a 25 μL reaction system. The first round of PCR consisted of 35 cycles, followed by 30 cycles in the second round. After verifying the expected fragment sizes by agarose gel electrophoresis, the PCR products were sent to Sangon Biotech Co., Ltd (Shanghai, China). for Sanger sequencing.

Table 1.

Primer information.

Name	Primer Sequences (5′→3′)
MSTN-out-F	ATCACAGATCCCGACGACAC
MSTN-out-R	CCTCCTTACATACAAGCCAGCA
MSTN-in-F	TCACTGGTGTGGCAAGTTGT
MSTN-in-R	AGTCAGCAGAGTCGTTGCTC

The sgRNA target sequence (acactacatcctcaagacta) corresponds to positions 140–159 of the bovine MSTN reference mRNA sequence (NCBI RefSeq: NM_001001525.3), which was used as the coordinate reference for subsequent mutation annotation.For representative edited individuals with clean and interpretable Sanger sequencing chromatograms, BLASTn analysis (NCBI BLAST+ v2.15.0+) was performed using the NCBI nucleotide database to confirm alignment of the sequencing reads to the bovine MSTN reference sequences (RefSeq: NM_001001525.3; GenBank: AB076403.1).

2.3.2. Body Measurements

Body measurements were conducted on one-month-old gene-edited and non-edited calves. The measured traits included body weight (kg), withers height (cm), hip height (cm), rump length (cm), ischial width (cm), chest depth (cm), hip width (cm), chest width (cm), body diagonal length (cm), cannon circumference (cm), chest girth (cm), abdominal girth (cm), and hind leg circumference (cm).

Body weight was measured using an electronic scale to ensure accuracy. Withers height was defined as the vertical distance from the highest point of the withers to the ground, while hip height was measured as the vertical distance from the midpoint of the line connecting the bilateral tuber coxae to the ground. Rump length was measured as the horizontal distance from the anterior edge of the tuber coxae to the posterior edge of the tuber ischii, and ischial width was defined as the horizontal distance between the outer edges of the bilateral tuber ischii. Chest depth was measured as the vertical distance from the highest point of the withers to the lower edge of the sternum. Hip width and chest width were defined as the horizontal distances between the bilateral hip joints and the widest points of the chest, respectively. Body diagonal length was measured from the anterior point of the shoulder to the posterior edge of the tuber ischii. Cannon circumference was measured at the narrowest part of the metacarpus of the forelimb. Chest girth was measured as the vertical circumference immediately posterior to the scapula, while abdominal girth was measured at the widest part of the abdomen. Hind leg circumference was measured as a semicircumference passing anterior to the stifle joints and beneath the tail.

All physical measurements were performed by the same trained operator to minimize inter-observer variation, and all measurements were taken in the morning before feeding to ensure data accuracy and comparability.

2.3.3. Metabolite Extraction

Untargeted metabolomics analysis was performed on plasma samples, with technical support provided by Novogene (Beijing, China). An untargeted LC-MS/MS strategy was selected to comprehensively capture global metabolic alterations associated with MSTN gene knockout at an early developmental stage, allowing unbiased detection of a wide range of metabolites without prior assumptions regarding specific metabolic pathways.

Plasma samples (100 μL) were transferred into Eppendorf tubes and mixed with prechilled 80% methanol by vortexing to precipitate proteins. The mixtures were incubated on ice for 5 min and then centrifuged at 15,000× g at 4 °C for 20 min. The resulting supernatants were diluted with LC-MS-grade water to achieve a final methanol concentration of 53%, followed by a second centrifugation under the same conditions. The clarified supernatants were subsequently transferred to fresh tubes and subjected to LC-MS/MS analysis.

To monitor analytical stability and data quality throughout the analysis, a pooled quality control (QC) sample was prepared by combining 10 μL of extract from each individual sample.

2.3.4. LC-MS Analysis

UHPLC-MS/MS analyses were performed using a Vanquish UHPLC system (Thermo Fisher, Bremen, Germany) coupled with an Orbitrap Q Exactive TM HF mass spectrometer, Orbitrap Q Exactive TM HF-X mass spectrometer, Orbitrap Exploris™ 120 mass spectrometer or Orbitrap Exploris™ 480 mass spectrometer (Thermo Fisher, Bremen, Germany) in Novogene Co., Ltd. (Beijing, China). Samples were injected onto a Hypersil Goldcolumn (100 × 2.1 mm, 1.9 μm) using a 12 min linear gradient at a flow rate of 0.2 mL/min. The eluents for the positive and negative polarity modes were eluent A (0.1% FA in Water) and eluent B (Methanol).The solvent gradient was set as follows: 2% B, 1.5 min; 2–85% B, 3 min; 85–100% B, 10 min; 100–2% B, 10.1 min; 2% B, 12 min. Q Exactive TM HF mass spectrometer was operated in positive/negative polarity mode with spray voltage of 3.5 kV, capillary temperature of 320 °C, sheath gas flow rate of 35 psi and aux gas flow rate of 10 L/min, S-lens RF level of 60, Aux gas heater temperature of 350 °C.

2.3.5. Statistical Analysis

For the analysis of body measurements in one-month-old calves, an independent-samples t-test was performed using IBM SPSS Statistics software 26.0 (IBM Corp., Armonk, NY, USA). For the untargeted blood metabolomics analysis, the raw mass spectrometry data were first converted to mzXML format using ProteoWizard [20]. Peak detection, alignment, and retention time correction were subsequently carried out using XCMS software (version 4.0) [21]. The total peak area within each sample was then normalized, and peaks with a missing rate greater than 50% across samples in each group were filtered out. Metabolite identification was performed by searching the Novogene in-house database based on the corrected and filtered data. Multivariate statistical analyses, including principal component analysis (PCA) and orthogonal partial least squares discriminant analysis (OPLS-DA), were applied to the identified metabolites to explore overall metabolic patterns and visualize group-level differences between the MT and WT groups. Hierarchical clustering analysis (HCA) and metabolite correlation analysis were applied to explore relationships among samples and between metabolites. In addition, functional analyses such as metabolic pathway analysis were performed to interpret the biological significance associated with the identified metabolites.

3. Results

3.1. Gene-Editing Results

Genomic DNA was extracted from blood samples of 11 newborn calves, and the MSTN target locus was amplified by PCR followed by Sanger sequencing to evaluate gene-editing outcomes. As shown in Figure 1, five calves exhibited clear nucleotide alterations at the target site, whereas the remaining six calves displayed wild-type sequences (Figure 1A–F).

Figure 1.

Sanger sequencing analysis of MSTN gene-editing outcomes. Sanger sequencing chromatograms of the MSTN target site from the five edited calves, illustrating different types of insertion/deletion (indel) mutations (A–E); a representative chromatogram from a wild-type calf, showing clean and single peaks across the target region (F). Different colored peaks represent the four nucleotides (A, T, C, and G).

Sequence analysis revealed heterogeneity in mutation patterns among the edited calves, which mainly manifested as different types of insertion/deletion (indel) mutations. Specifically, two calves showed continuous nucleotide deletions within the MSTN coding region (Figure 1A,B), with clean sequencing peaks flanking the deleted region, indicating relatively well-defined deletion events. Two additional calves exhibited evident mixed sequencing peaks near the target site (Figure 1C,D), suggesting the presence of complex indel mutations and mosaic editing events. The remaining calf displayed a small deletion accompanied by several base substitutions (Figure 1E), while the overall chromatogram remained interpretable.

BLASTn analysis of representative edited samples showed high sequence similarity to the bovine MSTN reference mRNA and coding sequences. The aligned regions encompassed the CRISPR/Cas12Mix target site (positions 140–159 of NM_001001525.3), confirming that the detected nucleotide deletions were localized within the intended target region. Samples exhibiting mixed sequencing peaks were not suitable for BLAST-based analysis due to mosaicism.

All identified mutations were located within the open reading frame of the MSTN gene. Based on their positions relative to the target site and the observed indel patterns, these mutations were predicted to cause frameshift events, local disruption of the coding sequence, or potential premature termination of translation, thereby compromising the integrity of the MSTN protein-coding sequence. The mutation types, nucleotide-level features, and their predicted functional consequences in individual calves are summarized in Table 2.

Table 2.

Summary of MSTN gene-editing outcomes in edited calves.

Calf ID	Mutation Type	Nucleotide-Level Feature (Relative to NM_001001525.3)	Predicted Effect on Coding Sequence	Functional Interpretation
MT-1	Deletion	Deletion detected at or adjacent to the CRISPR/Cas12Mix target site (positions 140–159)	Predicted disruptive indel affecting the MSTN coding sequence	Likely loss of MSTN function
MT-2	Deletion	Deletion detected adjacent to the CRISPR/Cas12Mix target site (positions 140–159)	Predicted disruptive indel affecting the MSTN coding sequence	Likely loss of MSTN function
MT-3	Indel (mixed peaks)	Mixed sequencing peaks detected near the CRISPR/Cas12Mix target site (positions 140–159), consistent with mosaic indel mutations	Disruption of coding sequence; precise allelic configuration unresolved	Likely functional impairment of MSTN
MT-4	Indel (mixed peaks)	Mixed sequencing peaks detected near the CRISPR/Cas12Mix target site (positions 140–159), consistent with mosaic indel mutations	Disruption of coding sequence; precise allelic configuration unresolved	Likely functional impairment of MSTN
MT-5	Small indel with base substitutions	Small indel accompanied by nucleotide substitutions detected adjacent to the CRISPR/Cas12Mix target site (positions 140–159)	Local disruption of MSTN coding sequence	Likely partial or complete impairment of MSTN function

Note: MT-1 to MT-5 correspond to the five edited calves shown in Figure 1A–E. All mutations were annotated relative to the bovine MSTN reference mRNA sequence (NCBI RefSeq: NM_001001525.3). Due to the presence of mixed sequencing peaks in some edited individuals, exact deletion breakpoints, allelic configurations, and corresponding amino acid sequence changes could not be unambiguously resolved by Sanger sequencing alone.

Given that MSTN functions as a secreted negative regulator of skeletal muscle development, such loss-of-function or functionally disruptive mutations are expected to release MSTN-mediated inhibition of muscle growth. Accordingly, the five edited calves confirmed by PCR and Sanger sequencing were classified as functionally MSTN-deficient (MT) and were used for all subsequent phenotypic measurements and serum metabolomic analyses. Age- and sex-matched wild-type calves were selected as the control group (WT).

3.2. Body Measurement Results

The body measurements of one-month-old calves in the MT and WT groups are summarized in Table 3. Compared with the WT group, the MT group at one month of age exhibited significant differences in body weight, hip width, chest girth, and abdominal girth (p < 0.05).

Table 3.

Calves at 1 month old body size data.

Body Size	MT Group	WT Group	p-Value
body weight (kg)	56.68 ± 5.45	40.20 ± 7.92	0.005
withers height (cm)	78.40 ± 2.51	74.20 ± 4.44	0.103
hip height (cm)	84.60 ± 3.78	78.60 ± 6.02	0.096
rump length (cm)	28.40 ± 1.52	26.40 ± 4.28	0.353
ischial width (cm)	10.20 ± 3.11	8.40 ± 2.30	0.329
chest depth (cm)	34.80 ± 3.03	33.60 ± 3.21	0.560
hip width (cm)	25.20 ± 2.59	21.80 ± 2.68	0.023
chest width (cm)	17.80 ± 2.68	16.20 ± 1.10	0.252
body diagonal length (cm)	81.40 ± 4.98	76.20 ± 7.73	0.242
cannon circumference (cm)	13.20 ± 0.84	11.60 ± 1.52	0.073
chest girth (cm)	86.40 ± 4.72	78.00 ± 6.44	0.047
abdominal girth (cm)	93.80 ± 5.22	81.80 ± 5.07	0.006
hind leg circumference (cm)	65.60 ± 10.31	54.40 ± 5.68	0.066

Note: All data are presented as mean ± standard deviation (Mean ± SD). Differences in growth traits of one-month-old calves, including body weight, withers height, hip height, rump length, ischial width, chest depth, hip width, chest width, body diagonal length, cannon circumference, chest girth, abdominal girth, and hind leg circumference, were analyzed using an independent samples t-test. Statistical significance was defined as p < 0.05.

3.3. Metabolomics

3.3.1. Multivariate Statistical Analysis

A total of 1164 metabolites in positive ion mode and 550 metabolites in negative ion mode were detected in the MT and WT samples. The identified metabolites were subjected to chemical classification analysis, and pie charts were generated to illustrate the compositional proportions and numerical distributions of different metabolite categories (Figure 2A,B). The results showed that, among the metabolites detected in positive ion mode, lipids and lipid-like molecules constituted the predominant class, accounting for 35.14%, followed by organic acids and derivatives (16.24%), organoheterocyclic compounds (16.07%), and benzenoids (9.11%). In negative ion mode, lipids and lipid-like molecules also represented the largest category (42.00%), followed by organoheterocyclic compounds (13.27%), benzenoids (11.09%), and organic acids and derivatives (10.55%).

Figure 2.

Metabolite classification pie charts in positive (A) and negative (B) ion modes; principal component analysis (PCA) in positive (C) and negative (D) ion modes; correlation analysis of QC samples in positive (E) and negative (F) ion modes.

To explore the overall metabolic differences between sample groups, principal component analysis (PCA) was performed, and the results are shown in Figure 2C,D. In the positive ion mode, the first principal component (PC1) and the second principal component (PC2) explained 28.0% and 14.4% of the total variance, respectively. In the negative ion mode, PC1 and PC2 accounted for 37.6% and 17.4% of the total variance, respectively. The PCA score plots revealed a clear separation trend between the MT and WT groups. In addition, quality control (QC) samples exhibited good clustering and reproducibility (Figure 2E,F), indicating stable instrument performance throughout the analytical process and high data quality.

OPLS-DA analysis showed good within-group reproducibility and an apparent separation between the MT and WT groups (p < 0.05) (Figure 3A,B). In the positive ion mode, the model yielded an R²Y value of 0.987 with a Q² value of −0.201, while in the negative ion mode, the corresponding R²Y and Q² values were 0.909 and −0.408, respectively. A 200-time permutation test indicated that all permuted Q² values were located to the left of the original Q² value along the negative axis (p < 0.05) (Figure 3C,D), suggesting that the observed group discrimination was not driven by model overfitting.

Figure 3.

OPLS-DA score plots in positive (A) and negative (B) ion modes; 200-times permutation test results of the OPLS-DA models in positive (C) and negative (D) ion modes.

3.3.2. Identification of Differential Metabolites

Differential metabolites were screened using the criteria of p ≤ 0.05, VIP > 1.0, and |log₂(FC)| > 1.0. In the positive ion mode, compared with the WT group, 90 metabolites were significantly upregulated and 135 metabolites were significantly downregulated in the MT group (Figure 4A). In the negative ion mode, 84 metabolites were significantly upregulated and 45 metabolites were significantly downregulated in the MT group relative to the WT group (Figure 4B).

Figure 4.

Volcano plots of differential metabolites in positive (A) and negative (B) ion modes; clustering analysis of differential metabolites in positive (C) and negative (D) ion modes; correlation analysis of differential metabolites in positive (E) and negative (F) ion modes; lollipop plots of differential metabolites in positive (G) and negative (H) ion modes. Asterisks in the figure indicate levels of statistical significance (* p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001).

To further explore the expression patterns of differential metabolites between the MT and WT groups, hierarchical clustering analysis was performed on the top 30 differential metabolites (Figure 4C,D). The results showed a clear separation of metabolic profiles between the two groups in both positive and negative ion modes, indicating distinct group-level metabolic patterns.

To assess the correlations among differential metabolites between the MT and WT groups, correlation heatmaps of differential metabolites were constructed (Figure 4E,F), providing further insight into their co-expression relationships. In the positive ion mode correlation heatmap (Figure 4E), Urolithin A, Urolithin B, and Harmane showed strong positive correlations with each other but were negatively correlated with Daphnioldhanin B, Flavokawain C, and N-acetylasparagine. In the negative ion mode correlation heatmap (Figure 4F), 7,8-dehydrocyclosponqiaquinone, Glaucocalyxin A, and Hydrocortisone 17-butyrate exhibited strong positive correlations, forming a relatively stable co-expression module, while showing significant negative correlations with Urolithin-3-sulfate and 4-hydroxyhippuric acid. These results suggest that gene editing may be associated with the formation of specific metabolite co-expression modules, reflecting alterations in metabolic network organization and regulatory patterns.

Lollipop plots were generated to visualize 12 metabolites exhibiting significant fold changes in both positive and negative ion modes (Figure 4G,H). In the positive ion mode, comparison between the MT and WT groups showed that the three most significantly upregulated metabolites were 4-guanidinobutanoate, Ala–Glu–Arg, and beta,beta-dimethylacrylalkannin, whereas the three most significantly downregulated metabolites were PC(MonoMe(9,5)/DiMe(9,5)), Kermadecin E, and Urolithin A (Figure 4G). In the negative ion mode, the most prominently upregulated metabolites were tetrahydroalstonine, Arisugacin E, and methoxydihydrosorgoleone, while the most significantly downregulated metabolites were 4-hydroxyhippuric acid, (S)-2,3-dihydro-7-hydroxy-2-methyl-4-oxo-4H-1-benzopyran-5-acetic acid, and Maryal (Figure 4H).

3.3.3. Functional Enrichment Analysis of Differential Metabolites

To investigate the metabolic pathways involved in the differential metabolites between the MT and WT groups, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was performed, and the results are shown in Figure 5A,B. In the positive ion mode, differential metabolites were enriched in a total of 10 metabolic pathways, among which two pathways reached statistical significance (p < 0.05), namely arginine and proline metabolism and tryptophan metabolism. Notably, enrichment of the arginine and proline metabolism pathway was primarily driven by altered levels of creatine and 4-guanidinobutanoic acid, whereas tryptophan metabolism was mainly characterized by changes in tryptamine and melatonin, which clearly distinguished the MT group from the WT group. In the negative ion mode, differential metabolites were enriched in five metabolic pathways, with two pathways showing significant enrichment (p < 0.05), including ascorbate and aldarate metabolism and pentose and glucuronate interconversions. Both pathways were predominantly associated with altered levels of D-glucuronic acid, which contributed to the separation between the MT and WT groups. Collectively, these results indicate that the KEGG-enriched pathways are supported by a limited number of representative differential metabolites, which clearly discriminate MSTN knockout cattle from wild-type controls at the metabolic level.

Figure 5.

KEGG enrichment bubble plots in positive (A) and negative (B) ion modes; ROC curves of differential metabolites in positive (C) and negative (D) ion modes.

To further evaluate the discriminatory performance of the identified differential metabolites between the MT and WT groups, receiver operating characteristic (ROC) curve analysis was conducted on the significantly altered metabolites. The results showed that most metabolites exhibited area under the curve (AUC) values greater than 0.9, indicating strong discriminatory power and suggesting that these metabolites have potential value as biomarkers for distinguishing MSTN gene-edited status (Figure 5C,D).

4. Discussion

In this study, MSTN gene–knockout Xinjiang Brown cattle were successfully generated using the CRISPR/Cas12Mix gene-editing system, demonstrating that the CRISPR/Cas12Mix system is capable of mediating effective genome editing in large-animal embryos. Through an integrated analysis of early growth-related body measurement traits and blood metabolomic characteristics, the functional loss of MSTN was further validated. Although individual variability in editing efficiency was observed for the CRISPR/Cas12Mix system in large-animal embryos, this phenomenon is consistent with previous studies employing the CRISPR/Cas12Mix editing system in sheep [22]. Notably, the high concordance among genotypic, phenotypic, and metabolic phenotypes observed in the present study indicates that this editing system can stably mediate functional knockout of the MSTN gene in cattle, thereby providing an experimental foundation for the further optimization and application of this system in bovine breeding programs.

MSTN is a key negative regulator of skeletal muscle development, and its presence under physiological conditions restrains muscle fiber proliferation and hypertrophy, thereby limiting overall muscle growth [3]. In contrast, functional loss or deficiency of MSTN abolishes this inhibitory constraint, leading to enhanced muscle development through increased muscle fiber size and, in some cases, fiber number [23]. This fundamental biological distinction between MSTN presence and deficiency provides the mechanistic basis for the growth-promoting effects observed in MSTN-deficient animals.

In the present study, Xinjiang Brown cattle with MSTN knockout generated using the CRISPR/Cas12Mix system exhibited significantly higher body weight, hip width, chest girth, and abdominal girth at one month of age compared with wild-type controls. These results indicate that MSTN deficiency can give rise to detectable growth phenotypes at a very early postnatal stage, consistent with the expected biological consequences of releasing MSTN-mediated suppression of muscle growth.

It should be noted that the observed increases in body measurements likely reflect a combined contribution of muscular and skeletal components, which cannot be fully distinguished at this early developmental stage. Hip width, as a composite trait influenced by both pelvic skeletal structure and surrounding hindquarter musculature, may reflect enhanced hindquarter muscle deposition accompanied by coordinated skeletal development [24]. Similarly, increases in chest girth and abdominal girth are more likely associated with expansion of trunk musculature and soft tissues, while potential contributions from thoracic and abdominal skeletal growth cannot be excluded.

The early growth advantages observed in this study are highly consistent with recent reports of increased body weight and body size traits in MSTN knockout sheep models generated using the CRISPR/Cas12Mix editing system [25], and are also in agreement with growth phenotypes previously reported in MSTN knockout cattle, pigs, and sheep produced using Cas9- or ZFN-based gene-editing systems [26,27,28]. Collectively, these findings indicate that the CRISPR/Cas12Mix editing system exerts stable and reproducible phenotypic effects at the MSTN locus, providing strong phenotypic evidence to support its application in large livestock species.

Untargeted metabolomics analysis enables a systematic characterization of global metabolic responses following genetic interventions. In this study, an untargeted serum metabolomics analysis was performed in one-month-old MSTN gene-edited calves, identifying 225 differential metabolites in the positive ion mode and 129 differential metabolites in the negative ion mode. Multivariate statistical analyses demonstrated that these differential metabolites could stably discriminate individuals in the MT group from those in the WT group, and were predominantly enriched in organic acids and their derivatives, lipids and lipid-like molecules, amino acid and amine metabolism, as well as microbiota-related metabolites. These findings indicate that MSTN deficiency induces pronounced systemic metabolic reprogramming at an early postnatal stage. The identified differential metabolites not only reflect alterations in energy metabolism and substrate utilization, but may also reveal changes in structural and signaling molecules required for muscle growth.

Organic acids and their derivatives are key intermediates in central metabolic pathways, including the tricarboxylic acid cycle, amino acid metabolism, and fatty acid metabolism, and play critical roles in energy supply, redox regulation, and extracellular matrix metabolism [29]. Alterations in their abundance often reflect metabolic reprogramming in response to growth demands or genetic perturbations [30,31], involving adjustments in amino acid utilization efficiency, the balance between protein synthesis and degradation, and antioxidant status. In the present study, both L-proline and L-arginine exhibited significant changes in the serum of MSTN gene-edited cattle. These two amino acids belong to the glutamate family and are closely interconnected through glutamate as a central metabolic node [32]. Glutamate serves as a metabolic precursor for proline and as the final product of both proline and arginine catabolism, while proline itself is also an important metabolic product of arginine metabolism [33]. Therefore, the proline–arginine metabolic axis plays an important role in coordinating cellular growth, energy supply, and redox homeostasis.

From a functional perspective, proline is not only a major constituent amino acid of collagen, but its metabolism can also be converted into glutamate and subsequently enter the tricarboxylic acid cycle, thereby providing energy and carbon skeletons for cells. In addition, proline metabolism is closely associated with collagen synthesis and extracellular matrix remodeling, which may have potential effects on muscle tissue architecture and meat quality traits [34,35]. Previous studies have demonstrated that proline-related metabolic reprogramming can promote skeletal muscle hypertrophy and favor the formation of oxidative muscle fiber types [36]. Arginine, as the direct precursor of nitric oxide (NO), also participates in polyamine and creatine synthesis, and can enhance muscle protein synthesis and tissue growth by improving local blood flow and nutrient supply, as well as by activating signaling pathways such as Akt/mTOR [37,38]. Moreover, multiple livestock studies have confirmed that dietary arginine supplementation can improve growth performance and meat quality [39,40]. Taken together, the alterations in L-proline and L-arginine observed in this study may reflect metabolic adaptations that occur following MSTN deficiency to support accelerated muscle growth.

In terms of lipid metabolism, lipids and lipid-like molecules constitute a structurally and functionally diverse class of hydrophobic or amphipathic small molecules in living organisms, mainly including fatty acyls, glycerolipids, glycerophospholipids, sphingolipids, as well as sterols and their derivatives [41]. Beyond serving as fundamental structural components of cellular and organelle membranes, lipid metabolites also participate in key biological processes such as energy metabolism, signal transduction, inflammatory regulation, and tissue remodeling through various bioactive molecular forms [42]. In the present study, the abundances of multiple acylcarnitines were significantly altered, encompassing short-chain as well as medium- and long-chain species, among which propionyl-carnitine and tiglyl carnitine were downregulated, whereas 3-hydroxyoctanoylcarnitine and undeca-2,5,8-trienoylcarnitine were markedly upregulated. Acylcarnitines are critical intermediates that facilitate the transport of fatty acids into mitochondria via the carnitine shuttle system for subsequent β-oxidation [43], and their plasma levels are commonly regarded as important metabolic indicators reflecting mitochondrial fatty acid oxidation status [44]. One study has demonstrated that abnormal accumulation of medium- and long-chain acylcarnitines can disrupt intracellular calcium homeostasis in skeletal muscle and impair muscle fiber contractile function, potentially exerting a direct negative impact on force generation in models with compromised fatty acid oxidation [45]. Therefore, the differential up- or downregulation of acylcarnitines with distinct chain lengths observed in this study may reflect adaptive remodeling of energy substrate utilization and mitochondrial fatty acid oxidation efficiency following MSTN deficiency.

In addition to energy metabolism–related lipids, this study also observed significant alterations in multiple membrane lipids and signaling lipids, including sphingolipids, lysophospholipids (such as Lyso-PAF C-18), and several lysophosphatidylcholine (LPC) molecules. Sphingolipids are not only essential structural components of cellular membranes but also act as key bioactive signaling molecules, widely involved in the regulation of cell proliferation, differentiation, inflammatory responses, and stress signaling [46]. Previous studies have demonstrated that, in aging or metabolically impaired skeletal muscle, the abnormal accumulation of sphingolipids—particularly ceramides and their derivatives—is closely associated with declines in muscle mass and function, whereas inhibition of sphingolipid biosynthetic pathways can partially alleviate muscle atrophy and improve muscle strength, highlighting the critical regulatory role of sphingolipid metabolism in maintaining skeletal muscle homeostasis [47]. Lysophospholipids are known to participate in membrane lipid remodeling, mitochondrial function regulation, inflammatory responses, and modulation of insulin sensitivity [48]. Earlier studies have indicated that plasma LPC levels are closely linked to skeletal muscle mitochondrial oxidative capacity, and changes in LPC abundance are significantly associated with phenotypes such as muscle weakness and reduced physical performance, suggesting that LPC may be involved in the regulation of muscle energy metabolism and functional maintenance [49].

In further exploration of metabolic pathway enrichment, this study integrated analyses from both positive and negative ion modes and identified several key pathways closely associated with energy supply and signaling regulation. Compared with wild-type controls, MSTN-knockout Xinjiang Brown cattle exhibited coordinated alterations in multiple KEGG-enriched metabolic pathways, indicating systematic metabolic remodeling rather than isolated pathway perturbations.

Under the positive ion mode, the arginine and proline metabolism pathway was significantly enriched, and circulating creatine levels were markedly decreased in MSTN-knockout calves relative to wild-type controls. Creatine is a core component of the phosphocreatine energy system, providing rapidly mobilizable energy for muscle contraction and sustaining ATP regeneration [50], and its circulating level is commonly considered to reflect substrate utilization and metabolic demand for muscular energy [51]. The accelerated muscle growth and increased body weight induced by MSTN deficiency may promote enhanced uptake and utilization of creatine by skeletal muscle, thereby leading to reduced plasma creatine concentrations. Consistent with this observation, previous studies have reported significant alterations in arginine- and proline-related metabolic pathways in MSTN-knockout cattle and smooth muscle tissues, suggesting an important role of this pathway in muscle metabolic remodeling triggered by MSTN deficiency [52].

Meanwhile, within the tryptophan metabolism pathway, the key enriched metabolites identified in this study, tryptamine and melatonin, were both significantly downregulated in MSTN-knockout calves compared with wild-type controls. Tryptamine is a low-molecular-weight signaling molecule produced by gut microbiota through the decarboxylation of tryptophan and has been shown to influence host insulin sensitivity and energy metabolism [53]. Melatonin, acting as an antioxidant and a regulator of circadian rhythms [54], exhibited reduced levels, indicating that MSTN deficiency may be associated with dynamic alterations in oxidative stress status. These changes may represent adaptive metabolic responses accompanying accelerated skeletal muscle development and elevated anabolic demand in MSTN-deficient calves. Collectively, these findings suggest that tryptophan metabolism may represent a metabolically sensitive node in the systemic metabolic reprogramming associated with MSTN deficiency. Although direct evidence demonstrating a definitive regulatory role of MSTN deficiency on the tryptophan metabolism pathway is currently lacking, previous studies have shown that loss of MSTN function can markedly affect whole-body energy homeostasis, oxidative stress status, and gut microbial composition [55,56]. Given the critical role of tryptophan metabolism in energy regulation and redox balance, the present results further indicate that tryptophan metabolism may act as a metabolically sensitive node within the MSTN-regulated systemic metabolic network.

Under the negative ion mode, the ascorbate and aldarate metabolism and pentose and glucuronate interconversions pathways were significantly enriched, and D-glucuronic acid levels were consistently reduced in MSTN-knockout calves compared with wild-type controls. D-glucuronic acid is a key intermediate in glucuronate metabolism and is widely involved in hepatic detoxification reactions, antioxidant processes, and carbohydrate conversion [57]. Its reduction in circulation may reflect a preferential redistribution of carbon sources and energy substrates toward skeletal muscle growth and structural remodeling during early postnatal development, with a relative reduction in flux through the glucuronate cycle and related detoxification pathways. In addition, glucuronic acid serves as an important precursor for polysaccharide biosynthesis and influences collagen synthesis and extracellular matrix remodeling [58], processes that are closely associated with muscle tissue growth and ECM (extracellular matrix) reorganization [59]. Previous studies have demonstrated that pathways related to hepatic glucose metabolism and energy allocation are broadly reprogrammed in MSTN-knockout animals [12,60], providing a plausible explanation for the alterations in glucuronic acid metabolism observed in the present study.

Taken together, the results of this study suggest that MSTN gene editing promotes a shift in energy utilization patterns required for muscle growth through a series of integrated metabolic reconfigurations, accompanied by the relative downregulation of amino acid metabolic branches as well as antioxidant and detoxification-related metabolic networks. These findings not only provide systematic evidence for understanding the early metabolic responses to MSTN deficiency but also offer theoretical guidance for future strategies aimed at optimizing growth performance and health management in gene-edited livestock through targeted metabolic support.

Although the present study verified the feasibility and preliminary biological effects of CRISPR/Cas12Mix-mediated MSTN gene knockout in Xinjiang Brown cattle based on early body size phenotypes and untargeted blood metabolomics, several limitations remain. First, the sample size was relatively small; therefore, future studies should expand the number of gene-edited cattle under standardized feeding conditions and uniform genetic backgrounds to enhance the robustness and representativeness of the conclusions. Second, although the experimental and control groups were matched for sex composition, sex-specific effects were not independently analyzed due to the limited sample size, and potential sex-related differences in metabolic responses to MSTN deficiency cannot be excluded. Third, this study focused on blood metabolic characteristics at a single early developmental time point (one month of age), which is insufficient to comprehensively capture the long-term effects of MSTN deficiency on growth performance and metabolic regulation during later growth stages. Future work will involve longitudinal tracking of body size development and phenotypic changes in gene-edited cattle across different growth stages to systematically evaluate the dynamic evolution of their growth advantages. In addition, while blood metabolomics provides an overview of systemic metabolic status, it has limited capacity to resolve tissue-specific molecular regulatory mechanisms. Therefore, future studies will integrate skeletal muscle–specific transcriptomic and qPCR-based validation, together with other omics approaches, to enable multi-omics analyses in key tissues. Such integrated analyses will allow a more in-depth elucidation of the molecular regulatory mechanisms underlying growth regulation and metabolic remodeling induced by MSTN gene knockout.

5. Conclusions

In conclusion, this study demonstrates that CRISPR/Cas12Mix can be effectively applied to generate MSTN-knockout Xinjiang Brown cattle. The functional loss of MSTN resulted in enhanced early growth performance and was accompanied by systematic metabolic alterations at one month of age. These findings provide experimental evidence supporting the feasibility of Cas12Mix-mediated genome editing in large livestock and offer insight into the early phenotypic and metabolic consequences of MSTN deficiency, with potential implications for future beef cattle breeding.

Abbreviations

MSTN	Myostatin
GDF8	Growth Differentiation Factor 8
TGF-β	Transforming growth factor-beta
PAM	Protospacer Adjacent Motif
MT	MSTN gene-edited cattle
WT	Wild-type control cattle
PCR	Polymerase chain reaction
LC-MS/MS	Liquid Chromatography—Tandem Mass Spectrometry
PCA	Principal component analysis
OPLS-DA	Orthogonal Partial Least Squares Discriminant Analysis
KEGG	Kyoto Encyclopedia of Genes and Genomes
ZFN	Zinc-finger nucleases
LPC	lysophosphatidylcholine
ECM	extracellular matrix

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani16040596/s1, Table S1: Metabolites detected under negative ion mode; Table S2: Metabolites detected under positive ion mode.

Author Contributions

Validation, J.M. and L.Z.; formal analysis, M.K. and J.M.; investigation, P.L. and G.D.; data curation, J.M. and Y.X.; writing—original draft preparation, J.M.; writing—review and editing, S.L.; visualization, M.K. and J.M.; funding acquisition, W.W. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Review Board of the Institute of Animal Husbandry, Xinjiang Academy of Animal Science (Animal Husbandry Institute of Xinjiang Academy of Animal Husbandry Sciences (2025) No. 13).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author(s).

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This study was supported by the Autonomous Region Major Breeding Project—Research on Efficient Cattle Breeding Technology (grant number 2023A02011-1); the Third Batch of the “2 + 5” Key Talent Program—Science and Technology Innovation Team Project for Precision Breeding of Cattle and Sheep (grant number 2024TSYCTD0012); and the Xinjiang Uygur Autonomous Region Sheep and Goat Engineering Research Center.