Skip to main content
Animals : an Open Access Journal from MDPI logoLink to Animals : an Open Access Journal from MDPI
. 2026 Feb 16;16(4):628. doi: 10.3390/ani16040628

Effects of Lipopolysaccharide Challenge on Growth Performance and Immune Function of Yellow-Feathered Broilers

Junwei Cheng 1, Zaixing Cai 1, Xiaoming Gu 1, Haixuan Lv 1, Yun Yang 1, Changkang Wang 1, Ling Jin 2,*, Yuyun Gao 1,*
Editor: Sylwester Świątkiewicz
PMCID: PMC12937451  PMID: 41751089

Simple Summary

This study investigated the effects of repeated lipopolysaccharide (LPS) injections on growth performance and immune function of yellow-feathered broilers. Broilers injected with LPS (1 mg/kg body weight) on days 21, 23, 25, and 27 exhibited progressively more severe effects: growth performance declined significantly after the second and third injections, and key immune organs atrophied. LPS consistently induced a strong inflammatory response, increasing the levels of IL-1β, IL-6, and IFN-γ in the liver and jejunal mucosa, and upregulating the TLR4/MyD88 immune pathway genes after the third injection. These findings demonstrate that three LPS injections are sufficient to induce significant immune damage and establish an immune stress model in the broilers.

Keywords: yellow-feathered broiler, LPS, immunity, growth performance

Abstract

This study aimed to investigate the effect of lipopolysaccharide challenge on growth performance and immune function in yellow-feathered broilers. A total of 140 yellow-feathered broilers (1-day-old) were randomly assigned to two treatments (control group and LPS group) with seven replicates of 10 chicks each. Broilers in the LPS group were injected intraperitoneally with LPS (1 mg/kg body weight) on days 21, 23, 25, and 27, while broilers in the control group were injected intraperitoneally at an equivalent volume of sterile saline on the corresponding days. After 24 h of each injection, one chicken from each replicate was randomly selected for slaughter and sampling. The results indicate that the first LPS challenge significantly elevated jejunal mucosal IL-6 levels compared with the control group (p < 0.05). After the second injection, average daily feed intake (ADFI), average daily weight gain (ADG), and body weight gain (BWG) of broilers were decreased in the LPS group compared to the control group (p < 0.05). Additionally, IL-1β levels were increased in the liver and jejunal mucosa of broilers in the LPS group (p < 0.05). After the third injection, the ADFI, ADG, BWG and feed conversion ratio (FCR) were reduced in the LPS group compared to the control group. LPS also caused a decrease in the broiler thymus index and bursa index. In addition, the levels of IL-1β, IL-6 and IFN-γ in the jejunal mucosa of broilers in the LPS group were higher than those in the control group (p < 0.05). The levels of IL-1β and IFN-γ in the liver of the LPS group were significantly higher than those of the control group (p < 0.05). The mRNA expression of IL-1β, IL-6, and IFN-γ in the jejunum and liver of the LPS group was significantly higher than that of the control group (p < 0.05). Furthermore, the mRNA expression of TLR4 and MyD88 in both the liver and jejunal mucosa of broilers in the LPS group was significantly higher than that in the control group (p < 0.05). Following the fourth LPS injection, the ADFI, ADG, BWG, and spleen index of LPS group decreased significantly compared to the control group. Concurrently, a significant increase in the content of IFN-γ in the liver was observed. In conclusion, three times of LPS stimulation can cause significant immune damage and induce an immune stress model.

1. Introduction

Yellow-feathered broilers are an important part of the local breed and quality broilers industry in Asia. Consumers prefer them for their tasty meat and distinctive flavor, and they hold a crucial role in the Asian poultry market. In China, around four billion yellow-feathered broilers are sold each year, similar to the sales of white-feathered broilers [1]. The health of poultry is closely linked to their immune systems. In actual production, various stressors, including bacterial infection, are common occurrences and constantly threaten the immune system and production efficiency of chickens [2].

Endotoxin LPS is a vital component of the outer coats of Gram-negative bacteria. LPS consists of three components: lipid A, core polysaccharide, and O antigen [3]. Lipid A is the hydrophobic part of the LPS molecule. It is an acylated beta-1′6-glucosamine disaccharide [4]. The ability of toxic LPS to induce an immune response is mainly found in lipid A [5]. Core polysaccharides usually consist of residues of 3-deoxy-D-manno-oct-2-ulosonic acid [6]. The O antigen is a polysaccharide attached to a core oligosaccharide, which is composed of 2–8 repeating oligosaccharides [7]. LPS is responsible for activating the inflammatory response and causing symptoms that are typical of infection [8].

Cytokines are a class of biologically active molecules synthesized and secreted by immune cells and certain non-immune cells when these cells are stimulated. Cytokines are cell–cell communication factors used by immune cells to coordinate an immune response [9]. Cytokines can be divided into interleukin (IL), interferon (IFN), tumor necrosis factor (TNF), colony-stimulating factor (CSF), growth factor (GF), chemokine, and so on. Depending on the role they play, cytokines can also be divided into factors that are pro-inflammatory and factors that are anti-inflammatory [10]. Pro-inflammatory cytokines such as IL-1β, IL-6, IL-8, IL-12, TNF-α, and interferon can promote the inflammatory response and stimulate active cells of the immune system [11]. Anti-inflammatory cytokines, including IL-4, IL-10, IL-11, IL-13, receptor antagonist (IL-1RA), and TGF-β, can inhibit inflammation and immune cells. In addition, some cytokines have both pro-inflammatory and anti-inflammatory properties, such as IL-6 [12].

Injection of LPS has emerged as a prevalent technique to establish animal models of stress, though the number and dose of injections vary among different breeds and with the age of the subjects [13]. Table 1 summarizes the relevant experimental conditions for LPS challenges in poultry reported by various researchers, encompassing multiple poultry breeds. The age of the birds at the time of injection is mostly concentrated between 12 and 28 days old, with the LPS dose ranging from 0.25 to 1.5 mg/kg body weight. The primary LPS serotypes employed are Escherichia coli O55:B5 and O111:B4, while the predominant injection route is intraperitoneal injection. Injection frequencies vary across studies, including single injection, multiple injections, and consecutive injections over 7 days.

Table 1.

Summary of experimental conditions for LPS challenge in poultry.

Researcher Poultry Breed Age at Injection LPS Dose LPS Serotype Injection Route Injection Frequency
Yu et al. [14] White-feathered broilers 28 days old 1.5 mg/kg BW Not specified Intraperitoneal Single injection
Li et al. [15] White-feathered broilers 12, 15, 18, 21 days old Low-dose: 0.25 mg/kg BW Not specified Intraperitoneal Multiple injections (4 times)
High-dose: 0.5 mg/kg BW
Ruan et al. [16] White-feathered broilers 14, 17, 21 days old 0.5 mg/kg BW E. coli O55:B5 Intraperitoneal Multiple injections (3 times)
Wang et al. [17] Lohman pink-shell laying hens 53 weeks old 1.5 mg/kg BW E. coli O111:B4 Intravenous Every 24 h for 7 days
Feng et al. [18] Jingfen No. 6 laying hens 54 weeks old 1 mg/kg BW E. coli O55:B5 Intraperitoneal For 3 consecutive days
Wang et al. [19] Yellow-feathered broilers 17, 19 days old 0.5 mg/kg BW E. coli O55:B5 Intramuscular Multiple injections (2 times)
Jiang et al. [20] Yellow-feathered broilers 17, 19 days old 0.5 mg/kg BW E. coli O111:B4 Intramuscular Multiple injections (2 times)

The novelty of this study lies in: (1) targeting yellow-feathered broilers to clarify the frequency-dependent characteristics of LPS-induced stress, which complements the breed-specific differences in LPS response; (2) using a higher dose (1 mg/kg BW) than previous studies on yellow-feathered broilers to simulate severe bacterial infection conditions; (3) integrating growth performance, immune organ development, inflammatory cytokine production, and molecular pathway activation to comprehensively validate the stability of the immune stress model. This research seeks to provide a theoretical foundation and practical reference for establishing a clinical model of LPS stress and developing targeted immune regulation strategies for yellow-feathered broilers. In this study, a stress model was established in yellow-feathered broilers by intraperitoneal injection of a higher dose (1 mg/kg BW) of LPS at 21, 23, 25, and 27 days of age. This study aimed to: (1) systematically evaluate the effects of different frequencies of LPS injection on the growth performance of yellow-feathered broilers; (2) investigate the changes in immune organ indices (thymus, spleen, bursa of Fabricius) and inflammatory cytokine levels in the liver and jejunal mucosa; (3) explore the molecular mechanism of LPS-induced immune stress by analyzing the expression of TLR4/MyD88 pathway-related genes; (4) determine the minimum number of LPS injections required to establish a stable immune stress model in yellow-feathered broilers. This research seeks to provide a theoretical foundation for establishing a clinical model of LPS stress.

2. Materials and Methods

2.1. Materials

140 one-day-old yellow-feathered male chickens (initial body weight, 35.00 ± 1.95 g) were purchased from Putian (Guangdong) Wens Poultry Co., Ltd. (Putian, China). Escherichia coli O55: B5 LPS (L2880) was purchased from Sigma Aldrich Chemical Co. (St. Louis, MO, USA).

2.2. Feeding Experiment Design and Bird Management

All animals used in this study were treated following the guidelines for experimental animals established by the Council of China. Animal experiments were approved by the Science Research Department of the Committee of Animal Care, Fujian Agriculture and Forestry University, Fuzhou, China. This study was conducted at the Animal Experiment Center of Fujian Agriculture and Forestry University. The ethical approval number for the animal experiment is PZCASFAFU22009. A single factorial design was used in this experiment. A total of 140 1-day-old commercial yellow-feathered male broilers were weighed and randomly distributed into 2 treatment groups according to body weight, with seven replicates per group and 10 chickens per replicate. At 21, 23, 25, and 27 days of age, the LPS group was intraperitoneally injected with 1 mg/kg body weight (BW) of E. coli LPS, and the control group was injected with the same amount of sterile saline. After 24 h of each injection, all groups were weighed. Then, one chicken per replicate was slaughtered and sampled near the average body weight of the replicate. Throughout the feeding period, the room temperature was maintained between 25 °C and 32 °C, and the heat-maintaining lamp was activated when the temperature dropped. The humidity level was maintained at 60–80%. The ventilation system consisted of exhaust fans and fresh air intake devices, which operated continuously throughout the experiment to maintain stable air circulation and environmental conditions. Feed and fresh water were available ad libitum. This experiment lasted for 28 days.

The basal diet was formulated in accordance with the Chinese Feeding Standard of Chicken (2004), and its ingredient composition and nutrient level are listed in Table 2.

Table 2.

Basal diet and calculated nutrient content of broilers (air-dry basis, %).

Ingredients Contents
Rice 61.98
Soybean meal 32.83
Expanded soybean 0.65
Limestone powder 1.21
Calcium monohydrogen phosphate 1.87
DL-Methionine 0.21
NaCl 0.25
Premix compound 1 1.00
Metabolic Energy, MJ/kg 12.13
Crude Protein, % 21.00
Calcium, % 1.00
Available Phosphorus, % 0.45
Lysine, % 1.13
Methionine + Cystine, % 0.85

1 The premix provided per kilogram of diet: vitamin A, 10,000 IU; vitamin D3, 2600 IU; vitamin E, 26 mg; vitamin K3, 2.6 mg; vitamin B1, 2.6 mg; vitamin B2, 6.5 mg; vitamin B6, 2.6 mg; vitamin B12, 0.01 mg; nicotinic acid, 26 mg; pantothenic acid, 13 mg; biotin, 0.10 mg; folic acid, 1.3 mg; choline, 1300 mg; Cu, 10 mg; Zn, 60.2 mg; Mn, 78 mg; Fe, 72 mg; I, 0.4 mg; Se, 0.24 mg.

2.3. Sample Collection

On the 22nd, 24th, 26th, and 28th days, one bird per replicate was chosen for sample collection. The serum was prepared by centrifuging each tube at 3000 rpm for 10 min at 4 °C and stored at −80 °C.

After the blood was drawn, the chickens were euthanized by neck incision. The weights of the spleen, thymus, and bursa of Fabricius were measured, and the thymus index, spleen index, and bursa of Fabricius index of broilers were calculated. Meanwhile, a 2 cm segment of the midjejunum was collected, and the liver and jejunum samples were gently rinsed with 4 °C normal saline. The samples were aliquoted into 2 mL cryopreservation tubes, immediately placed in liquid nitrogen, and subsequently transferred to a −80 °C refrigerator for long-term storage. The expression analysis (e.g., qRT-PCR) was performed within one month of sample collection to ensure the integrity and stability of RNA. All sampling procedures were completed within 15 min after euthanasia to minimize tissue degradation.

2.4. Growth Performance

Feed intake was recorded daily for each replicate. The amount of feed added to each replicate cage was recorded in the morning, and the residual feed was weighed the next morning to calculate the daily feed intake per replicate. All broilers in each replicate were weighed individually on days 22, 24, 26, and 28 (24 h after each injection) using an electronic balance. Based on the recorded data, the following growth performance indicators were calculated for each period:

Average daily feed intake (ADFI) = Total feed intake of the replicate during the period/(Number of broilers in the replicate × Number of days in the period)

Average daily gain (ADG) = (Final average body weight of the replicate − Initial average body weight of the replicate)/Number of days in the period

Body weight gain (BWG) = Final body weight of the broiler − Initial body weight of the broiler during the period

Feed conversion ratio (FCR) = ADFI/ADG

2.5. Immune Organ Index

Each treatment group was weighed 24 h after each LPS challenge. For each replicate cage, one chicken was randomly selected and euthanized by neck incision. After exsanguination, the thymus, spleen, and bursa of each bird were removed and weighed. Weights of the thymus, spleen, and bursa of Fabricius were individually recorded. The index was expressed as follows:

Immune organ index = immune organ weight (g)/live body weight (kg).

2.6. Determination of Inflammatory Cytokine Content in Jejunal Mucosa and Liver

The concentrations of interleukin-1beta (IL-1β), interleukin-6 (IL-6), and interferon-gamma (IFN-γ) in jejunal mucosa and liver were determined with commercially available chicken cytokine ELISA kits (Jiancheng Bioengineering Institute, Nanjing, China), according to the manufacturer’s protocol.

Sample preparation: Thawed liver tissue and jejunal mucosa samples (0.1 g each) were homogenized in 9 volumes of pre-cooled (4 °C) physiological saline using a tissue homogenizer. After homogenization, the homogenates were centrifuged at 3000 rpm for 10 min at 4 °C, and the supernatants were collected for cytokine assays.

ELISA operation:

Add 100 μL of standard solutions (concentrations: 0, 20, 40, 80, 160, 320 pg/mL for IL-1β; 0, 15, 30, 60, 120, 240 pg/mL for IL-6; 0, 10, 20, 40, 80, 160 pg/mL for IFN-γ) and sample supernatants to the corresponding wells of the ELISA plate, respectively. Each standard and sample was assayed in duplicate.

Cover the plate with a sealing film and incubate at 37 °C for 90 min.

Discard the liquid in the wells, wash the plate 5 times with washing buffer (30 s soak per wash), and pat dry with absorbent paper.

Add 100 μL of enzyme-conjugated secondary antibody to each well, incubate at 37 °C for 60 min, and then wash the plate 5 times following the same procedure described above.

Add 100 μL of substrate solution (TMB) to each well, and incubate at 37 °C in the dark for 15 min.

Add 50 μL of stop solution to each well to terminate the reaction.

Measure the absorbance (OD value) at 450 nm using a microplate reader within 15 min after adding the stop solution.

Calculation: Plot a standard curve with the standard solution concentration as the abscissa and the corresponding OD value as the ordinate. Calculate the target cytokine concentration in the samples based on the standard curve and the sample OD values.

2.7. Gene Expression Analysis

In this study, the expression of mRNA for IL-1β, IL-6, IFN-γ, TLR4, and the MyD88 signaling pathway in the jejunal mucosa were analyzed by RT-qPCR. RNA was extracted using the RNAprep Pure Tissue Kit from Beijing Tiangen Biotechnology Co., Ltd. (Beijing, China). Then the RNA was reverse transcribed using the Re-verse Transcription System kit from Promega (Madison, Wisconsin, CA, USA). The cDNA was subjected to an RT-qPCR reaction using GoTaq® qPCR Master Mix (Promega, Madison, Wisconsin, CA, USA). The reference gene and primers for the upstream and downstream regions of the target gene were synthesized by Shanghai Shenggong Bioengineering Co., Ltd. (Shanghai, China). The primer sequence and amplification parameters are listed in Table 3. Relative mRNA expression levels of selected genes were calculated using the 2−ΔΔCt method.

Table 3.

Primer sequence and amplification parameters of reference genes and target genes.

Target Gene GenBank No. Primer Sequence (5′–3′) Fragment Length/bp Annealing Temperature
IL-1β NM204524 F: ACACCCGCTCACAGTCCTT
R: GCCTCACTTTCTGGCTGGA
120 60 °C
IL-6 NM204628 F: AAATCCCTCCTCGCCAATCT
R: CCCTCACGGTCTTCTCCTAAA
106 60 °C
IFN-γ DQ470471 F: AAGTCATAGCGCACATCAAAC
R: CTGAATCTCATGTCGTTCATCG
132 60 °C
TLR4 NM001030693 F: ATCTTTCAAGGTGCCACATC
R: GGATATGCTTCTTTCCACCA
167 60 °C
MyD88 NM001030962 F: CTGGCATCTTCTGAGTAGT
R: TTCCTTATAGTTCTGGCTTCT
76 60 °C

The specific steps of RNA extraction were as follows:

(1) Take 20 mg of tissue and add 300 μL of lysis buffer RL, then homogenize by 5000 rpm bead beating.

(2) To the homogenate, add 590 μL of RNase-Free ddH2O and 10 μL of Proteinase K, mix well, and incubate at 56 °C for 20 min in a water bath.

(3) Centrifuge the mixture at 12,000 rpm for 1 min.

(4) Transfer the supernatant to a new tube, add anhydrous ethanol at a volume equal to 1/2 of the supernatant, then load the mixture onto an adsorption column placed in a collection tube.

(5) Centrifuge the column at 12,000 rpm for 1 min, then discard the flow-through in the collection tube.

(6) Add 350 μL of protein removal solution to the adsorption column, centrifuge at 12,000 rpm for 1 min, and discard the flow-through.

(7) Prepare DNase I working solution by mixing 10 μL of DNase I stock solution with 70 μL of RDD buffer. Add 80 μL of this working solution to the adsorption column and incubate at room temperature for 15 min.

(8) Add another 350 μL of protein removal solution to the column, centrifuge at 12,000 rpm for 1 min, and discard the flow-through.

(9) Add 500 μL of wash buffer to the adsorption column.

(10) Let it stand at room temperature for 2 min.

(11) Centrifuge at 12,000 rpm for 1 min, then discard the flow-through.

(12) Repeat this wash step once more.

(13) After the second wash. Let the column stand at room temperature for 3 min. Centrifuge at 12,000 rpm for 2 min to remove residual wash buffer. Transfer the adsorption column to a new RNase-Free centrifuge tube. Add 50 μL of RNase-Free ddH2O to the center of the column membrane:Let it stand at room temperature for 2 min. Centrifuge at 12,000 rpm for 2 min to elute the RNA.

Determination of RNA Sample Concentration and Purity:

Aliquot 1 µL of the RNA sample, add 99 µL of RNase-Free ddH2O, and mix thoroughly. Measure the absorbance ratio at 260 nm and 280 nm using a NanoDrop 2000 spectrophotometer, then calculate the sample concentration.

cDNA Preparation:

(1) RNA reverse transcription system—the reverse transcription system was prepared with the following components in a total volume: 3.0 μL of total RNA, 0.5 μL of RNase Inhibitor, 1.0 μL of Oligo dT Primer, 1.0 μL of Random Primers, 1.0 μL of PCR Nucleotide Mix, 1.0 μL of Reverse Transcriptase, 2.0 μL of MgCl2, 4.0 μL of 5 × Reaction Buffer, and 6.5 μL of Nuclease-free Water.

(2) RNA reverse transcription program—The reverse transcription reaction was performed under the following conditions: incubation at 42 °C for 15 min, followed by a heat inactivation step at 70 °C for 15 min.

RTQ-PCR Reaction:

(1) RTQ-PCR reaction system—The 20 μL RTQ-PCR reaction system was assembled on ice with the following reagents: 10.0 μL of SYBR Green Master Mix, 0.5 μL of forward primer (10 μM), 0.5 μL of reverse primer (10 μM), 1.0 μL of cDNA template, and 7.5 μL of nuclease-free water.

(2) RTQ-PCR reaction program—The amplification procedure was implemented on a real-time PCR instrument with the following conditions: a single cycle of hot-start activation at 95 °C for 10 min; followed by 40 cycles of denaturation at 95 °C for 15 s and combined annealing/extension at 60 °C for 1 min; and a final dissociation stage (one cycle) consisting of 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s, and 60 °C for 15 s.

2.8. Statistical Analysis

All data were preliminarily processed using Excel 2010. The statistical analyses were performed using statistical software SPSS 22.0 (SPSS Inc., Chicago, IL, USA) with replicates (n = 7) as an experimental unit, and the results were presented as mean  ±  SD. The data were analyzed by means of the T-test statistical method. Differences were regarded as significant at p < 0.05, and 0.05 ≤ p ≤ 0.10 was considered to indicate a trend. p > 0.10 was considered to indicate no significant difference.

3. Results

3.1. Growth Performance

Table 4 shows that LPS reduced the ADFI, ADG, and BWG of the LPS group from the second injection compared to the control group (p < 0.05). The third injection of LPS led to a significant reduction in ADFI, ADG, BWG, and FCR of experimental broilers (p < 0.05). The fourth LPS injection led to a significant decrease in ADFI, ADG, and BWG of the LPS group (p < 0.05).

Table 4.

Effects of LPS on the growth performance of broilers.

Times Group ADFI (g) ADG (g) BWG (g) FCR
1st LPS (−) 26.56 ± 0.18 14.67 ± 0.59 322.84 ± 13.00 1.82 ± 0.07
LPS (+) 25.87 ± 0.85 14.15 ± 0.32 311.33 ± 7.12 1.81 ± 0.04
2nd LPS (−) 28.83 ± 0.32 a 16.06 ± 0.34 a 385.37 ± 8.11 a 1.80 ± 0.03
LPS (+) 28.09 ± 0.47 b 15.04 ± 0.49 b 361.00 ± 11.46 b 1.82 ± 0.03
3rd LPS (−) 29.79 ± 0.51 a 16.38 ± 0.42 a 425.71 ± 10.90 a 1.82 ± 0.02 a
LPS (+) 28.61 ± 0.40 b 15.32 ± 0.45 b 398.33 ± 11.65 b 1.87 ± 0.03 b
4th LPS (−) 31.27 ± 0.50 a 17.00 ± 0.30 a 475.85 ± 8.28 a 1.84 ± 0.01
LPS (+) 30.08 ± 0.82 b 16.08 ± 0.49 b 450.36 ± 13.70 b 1.87 ± 0.04

a,b Means (n = 7) with different letters within a row are significantly different (p < 0.05). The same applies to other tables and figures. LPS (+), LPS; LPS (−), normal saline; ADFI, average daily feed intake; ADG, average daily gain; BWG, body weight gain; FCR, feed conversion ratio.

3.2. Immune Organ Index

Figure 1 shows that, compared to the control group, the LPS group had significantly lower thymus and bursal indices after the third LPS injection (p < 0.05). The spleen index of the LPS group was reduced after the fourth LPS injection (p < 0.05). After the third injection, the thymus index of the LPS group was 0.33 ± 0.03%, lower than that of the control group (0.40 ± 0.04%); the bursa index was 0.23 ± 0.02%, lower than that of the control group (0.29 ± 0.03%). After the fourth injection, the spleen index of the LPS group was 0.27 ± 0.02%, lower than that of the control group (0.32 ± 0.03%). No significant differences were observed in the thymus, bursa, and spleen indices between the LPS group and the control group after the first and second injections (p > 0.05).

Figure 1.

Figure 1

Effects of LPS on the immune organ index of broilers (%).

3.3. Cytokine Content in Jejunal Mucosa and Liver

Figure 2 shows that the third LPS injection significantly increased the contents of IL-1β, IL-6, and IFN-γ in the jejunum mucosa of broilers compared to the control group (p < 0.05). The first injection of LPS resulted in a significant increase in IL-6 content in the jejunum mucosa of the broilers (p < 0.05). The content of IL-1β in the jejunum mucosa of broilers was significantly increased by the second LPS injection (p < 0.05). After the second injection, the IL-1β content of the LPS group was 42.34 ± 3.56 ng/L, higher than that of the control group (36.78 ± 3.12 ng/L). After the third injection, the IL-1β content of the LPS group was 43.11 ± 3.45 ng/L, higher than that of the control group (35.42 ± 2.87 ng/L); the IL-6 content was 78.52 ± 5.74 ng/L, higher than that of the control group (70.63 ± 4.51 ng/L); the IFN-γ content was 43.89 ± 3.54 ng/L, higher than that of the control group (38.23 ± 2.98 ng/L).

Figure 2.

Figure 2

Effects of LPS on the jejunal mucosa cytokine content of broilers.

Figure 3 shows that the content of IFN-γ in the liver of broilers significantly increased with LPS injection compared to the control group from the third and fourth injection (p < 0.05). The second and third LPS injections significantly increased the IL-1β content in the liver of the LPS group (p < 0.05). However, four consecutive injections of LPS did not significantly affect the IL-6 content in the liver of broilers (p > 0.05). After the second injection, the IL-1β content of the LPS group was 43.11 ± 3.45 ng/L, higher than that of the control group (36.78 ± 3.12 ng/L). After the third injection, the IL-1β content of the LPS group was 42.34 ± 3.56 ng/L, higher than that of the control group (35.42 ± 2.87 ng/L); the IFN-γ content was 46.89 ± 3.54 ng/L, higher than that of the control group (39.12 ± 3.23 ng/L). After the fourth injection, the IFN-γ content was 44.02 ± 3.71 ng/L, higher than that of the control group (38.23 ± 2.98 ng/L).

Figure 3.

Figure 3

Effects of LPS on the liver cytokine content of broilers.

3.4. mRNA Expression of Cytokines in Jejunum Mucosa and Liver

Figure 4 and Figure 5 show that the third LPS injection significantly increased the expression of IL-1β, IL-6, and IFN-γ in the jejunum mucosa and liver of broilers compared to the control group (p < 0.05).

Figure 4.

Figure 4

Effects of LPS on jejunal mucosa cytokines mRNA expression of broilers.

Figure 5.

Figure 5

Effects of LPS on liver cytokines mRNA expression of broilers.

Figure 6 and Figure 7 show that the expression of TLR4 and MyD88 in the jejunum mucosa and liver of broilers was significantly increased after the third LPS injection compared to the control group (p < 0.05).

Figure 6.

Figure 6

Effects of LPS on jejunal mucosa TLR4 and MyD88 mRNA expression of broilers.

Figure 7.

Figure 7

Effects of LPS on liver TLR4 and MyD88 mRNA expression of broilers.

However, the fourth injection of LPS did not produce a significant effect on the LPS group when compared to the control group. This may be attributed to the development of endotoxin tolerance in the body following multiple LPS injections within a short time frame.

4. Discussion

Several investigations have revealed that immune stress can negatively impact the growth performance of broilers [15]. Ref. [21] Consistent with the aforementioned results, this experiment demonstrated that, in contrast to the control group, the ADFI, ADG, and BWG of broilers in the LPS group were significantly decreased starting from the second LPS injection, and the reduction reached its maximum after the third injection. Furthermore, the third injection of LPS significantly increased the FCR of broilers compared with the control group. The third LPS injection had the most significant impact on the growth performance of broilers. The results of the present study are highly consistent with those of previous studies, which all showed that LPS injection significantly inhibited the growth performance of broilers [19,22]. Pro-inflammatory cytokines might be responsible for the decrease in nutrient use and growth performance. Stimulation of the hypothalamic–pituitary–adrenal axis can alter appetite-regulating receptors, leading to decreased appetite in broiler chickens [23]. Compared with previous studies on yellow-feathered broilers (0.5 mg/kg BW, 2 injections) [19], this study used a higher dose and more frequent injections, and found that the third injection is the critical point for significant growth inhibition. This difference may be due to the higher LPS dose used in this study, which enhances the cumulative stress effect.

LPS comprises approximately 75% of the outer envelope of Gram-negative bacteria. It significantly activates the immune system and is crucial for the early identification of bacterial infections and the activation of antibacterial defenses [24]. Immune organs play a crucial role in identifying antigens and stimulating immune cells [25]. Vital immune organs in birds include the thymus, spleen, and bursa of Fabricius [26]. The thymus is the central immune organ, primarily responsible for producing T lymphocytes. The spleen is the biggest peripheral organ in the immune system and serves as the main location for both humoral and cellular immune reactions. The bursa of Fabricius is an immune organ found in poultry that primarily facilitates the differentiation and maturation of B lymphocytes [27]. At the same time, changes in immune organ indices may also affect the immune function and disease resistance of poultry [28]. The results of this experiment demonstrated that the third LPS injection led to a significant reduction in the thymus and bursa indices, while the fourth LPS injection resulted in a significant decline in the spleen index of the broilers in comparison to the control group. Several studies have shown that when broilers are challenged with LPS, the relative weight of the spleen is increased [29,30]. This is inconsistent with the spleen index results in our experiment. The reduction in spleen weight noted in this research could be linked to the immune response triggered by LPS antigen or stressors, which may result in apparent stress or integrity damage. These alterations may cause a reduction in cell proliferation and thus a reduction in spleen weight.

The dynamic balance between pro- and anti-inflammatory factors in the host immune system is critical [31]. Pro-inflammatory cytokines help initiate and spread autoimmune inflammation, while anti-inflammatory cytokines help resolve inflammation and recover from the acute phase of autoimmune disorders [32]. The induction and secretion of pro-inflammatory cytokines are essential for the activation of the innate host defense system and the subsequent regulation of the adaptive immune response [33]. The results of this experiment showed that the third LPS injection had the most significant effect on the levels of pro-inflammatory cytokines in the liver and jejunal mucosa of broilers. The first LPS injection significantly increased the level of IL-6 in the jejunum mucosa. The second LPS injection significantly increased the levels of IL-1β in the jejunal mucosa and liver. The third LPS injection significantly increased the levels of IL-1β, IL-6, and IFN-γ in the jejunum mucosa, and also increased the levels of IL-1β and IL-6 in the liver. The fourth LPS injection significantly increased IFN-γ in the liver. The results of this experiment are consistent with many reported findings regarding the effects of LPS on proinflammatory cytokines. Zheng et al. discovered that the levels of IL-1β, IL-6, and IL-10 in the serum of broilers were increased significantly after the injection of LPS [34]. Jiang et al. showed that LPS stress significantly increased IL-1β and IL-6 mRNA expression in jejunal mucosa [35]. Yang et al. found that serum levels of IL-6 and IL-1β were significantly increased after LPS injection in broilers [36]. In the present study, it was found that, except for an increase in IFN-γ content in the liver, IL-1β, IL-6, and IFN-γ in the jejunal mucosa and IL-1β, IL-6 in the liver showed no significant change after the fourth LPS injection in comparison with the control group. This phenomenon may be associated with endotoxin tolerance (ET). ET, which is characterized by a reduced inflammatory response upon repeated LPS exposure, protects the body against excessive inflammation [37]. It has been demonstrated that repeated LPS exposure, particularly at short intervals, induces endotoxin tolerance in Peking ducks, characterized by a diminished febrile response [38]. The simultaneous significant increase of three pro-inflammatory cytokines after the third injection indicates that the inflammatory response has reached a peak and spread systemically [33], which is a key marker of stable immune stress [25]. The subsequent emergence of endotoxin tolerance after the fourth injection further confirms that the third injection is the critical frequency for inducing significant immune stress in yellow-feathered broilers, as the body begins to initiate negative feedback regulation to avoid excessive damage [38].

Toll-like receptor 4 (TLR4) is essential for the signaling pathways of LPS [39]. Myeloid differentiation primary response protein 88 (MyD88) is the downstream protein of TLR4. It is evident that the branches of the TLR4 signaling pathway encompass both MyD88-dependent and MyD88-independent signaling pathways [40]. LPS can activate macrophages by binding to its receptor TLR4. TLR4 then activates intracellular signaling cascades by recruiting MyD88 to the membrane, ultimately inducing the translocation of nuclear factor-κB (NF-κB) and the production of pro-inflammatory responses [41]. The results of this experiment demonstrate that three consecutive injections of LPS significantly upregulated the expression of TLR4 and MyD88 in the liver and jejunal mucosa of broiler chickens, as compared to the control group. This is consistent with previous research, which showed that the expression of MyD88 mRNA in the liver following LPS injection was significantly higher than that in the control group [42]. NF-κB is also an important inflammatory transcription factor that can trigger the expression of pro-inflammatory factors such as IL-1, IL-6, and TNF-α [43]. In the event of LPS invading the intestinal cells of the body, a combination with TLR4 in the outer membranes can occur, thereby activating the NF-κB pathway through the mechanism of pathogen-associated molecular pattern (PAMP) [44]. LPS, acting as a key ligand of TLR4, has been demonstrated to play a central role in initiating the NF-κB-related inflammatory cascade reaction [45]. It has been established that the binding of LPS to the extracellular domain of TLR4 instigates a sequence of complex signaling cascades within the cell [46]. When TLR4 identifies an external stimulus, it triggers the phosphorylation and subsequent degradation of IκB by IκB kinase (IKK), thereby isolating IκB from NF-κB. Next, the activated NF-κB is translocated into the nucleus, where it activates the expression of pro-inflammatory mediators [47]. Studies have found that LPS, through the TLR4/NF-κB pathway, increased IL-1β, IL-6 in broiler liver [48]. The results of this experiment showed that LPS challenge significantly increased IL-1β, IL-6, and IFN-γ expression in broiler jejunal mucosa and liver. This is in line with the changes in IL-1β, IL-6, and IFN-γ levels in this experiment. Hence, we can conclude that LPS activates the MyD88 signaling molecules by recognizing the TLR4 receptors, thereby activating the downstream NF-κB transcription factors and inducing the expression of pro-inflammatory genes. This study confirms that the TLR4/MyD88 pathway is significantly activated after three LPS injections in yellow-feathered broilers [42], providing a clear molecular mechanism for the formation of immune stress.

Overall, the third LPS injection significantly induced enhanced immune responses in broilers. LPS has been demonstrated to upregulate the expression of pro-inflammatory genes through the TLR4/MyD88 signaling pathway, thereby inducing the release of pro-inflammatory cytokines that contribute to the body’s immune response. The appropriate weight gain of the immune organs is a manifestation of faster growth and development, and a higher index indicates faster immune system maturation [49]. Within a certain range, the greater the relative and absolute weight of immune organs, the stronger the immune function [50]. However, excessive production of pro-inflammatory cytokines may cause immune cells to consume large amounts of substances and energy to maintain the immune response, impair the growth and development of immune organs, and thus weaken the immune function of animals [51]. Concurrently, an elevated level of pro-inflammatory cytokines has been demonstrated to diminish the appetite of animals, engender bodily alienation, and consequently compromise their growth performance [52].

5. Conclusions

The study demonstrates that LPS stimulation impairs broiler growth performance and elicits an immune response in a frequency-dependent manner. Three LPS injections (1 mg/kg BW, intraperitoneally administered at 21, 23, and 25 days of age) exert the most significant effect on LPS-induced immune damage in yellow-feathered broilers, as evidenced by: (1) a significant reduction in growth performance indicators (ADFI, ADG, BWG) and an increase in FCR; (2) atrophy of key immune organs (thymus and bursa of Fabricius); (3) significant upregulation of pro-inflammatory cytokines (IL-1β, IL-6, IFN-γ) in the liver and jejunal mucosa; and (4) activation of the TLR4/MyD88 signaling pathway. Therefore, the three-time LPS challenge effectively established a stable immune stress model in yellow-feathered broilers. This study provides a reliable experimental model and theoretical basis for future studies on the regulation of immune stress in yellow-feathered broilers.

Author Contributions

Conceptualization, C.W. and L.J.; Methodology, J.C. and C.W.; Software, X.G., Z.C., H.L. and Y.Y.; Validation, J.C. and X.G.; Investigation, X.G., Z.C., H.L. and Y.Y.; Resources, C.W.; Data curation, J.C., X.G., Z.C. and Y.Y.; Writing—original draft, J.C.; Writing—review and editing, J.C., X.G. and Y.G.; Supervision, C.W. and Y.G.; Project administration, Y.G.; Funding acquisition, L.J. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

The study was conducted in accordance with the animal care protocols approved by the Animal Care and Use Ethics Committee of Fujian Agriculture and Forestry University, Fuzhou, China (Approval ID: PZCASFAFU22009).

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding Statement

This study was supported by the National Natural Science Foundation of China (31802079), Modern Poultry Industry Technology System of Fujian Province (KLY24403XA), National Key Research and Development Program of China (2023YFD1600500), Agricultural Guiding (Key) Project of Fujian Provincial Science and Technology Department (2023N0008), Science and Technology Development Projects Funded by Chinese Central and Local Governments (2022L3085), Science and Technology Innovation Special Fund Project of Fujian Agriculture and Forestry University (KFB23099A).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Wang Y., Wang Q., Yao X., Gou Z., Lin X., Luo Q., Jiang S. Effects and Interactions of Dietary Lysine and Apparent Nitrogen Corrected Metabolizable Energy on Yellow-Feathered Broiler Breeder Hens. J. Anim. Sci. Biotechnol. 2024;15:143. doi: 10.1186/s40104-024-01095-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Zhao R.H., Yang F.X., Bai Y.C., Zhao J.Y., Hu M., Zhang X.Y., Dou T.F., Jia J.J. Research Progress on the Mechanisms Underlying Poultry Immune Regulation by Plant Polysaccharides. Front. Vet. Sci. 2023;10:1175848. doi: 10.3389/fvets.2023.1175848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Brown G.C., Heneka M.T. The Endotoxin Hypothesis of Alzheimer’s Disease. Mol. Neurodegener. 2024;19:30. doi: 10.1186/s13024-024-00722-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bertani B., Ruiz N. Function and Biogenesis of Lipopolysaccharides. EcoSal Plus. 2018;8:10–1128. doi: 10.1128/ecosalplus.esp-0001-2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Di Lorenzo F., Duda K.A., Lanzetta R., Silipo A., De Castro C., Molinaro A. A Journey from Structure to Function of Bacterial Lipopolysaccharides. Chem. Rev. 2022;122:15767–15821. doi: 10.1021/acs.chemrev.0c01321. [DOI] [PubMed] [Google Scholar]
  • 6.Maniyeri A., Wieczorek A., Ayyolath A., Sugalska W., Klein G., Raina S. Suppressors of Lapc Mutation Identify New Regulators of Lpxc, Which Mediates the First Committed Step in Lipopolysaccharide Biosynthesis. Int. J. Mol. Sci. 2023;24:15174. doi: 10.3390/ijms242015174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Kalynych S., Morona R., Cygler M. Progress in Understanding the Assembly Process of Bacterial O-Antigen. FEMS Microbiol. Rev. 2014;38:1048–1065. doi: 10.1111/1574-6976.12070. [DOI] [PubMed] [Google Scholar]
  • 8.Mohammad S., Thiemermann C. Role of Metabolic Endotoxemia in Systemic Inflammation and Potential Interventions. Front. Immunol. 2021;11:594150. doi: 10.3389/fimmu.2020.594150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kureshi C.T., Dougan S.K. Cytokines in Cancer. Cancer Cell. 2025;43:15–35. doi: 10.1016/j.ccell.2024.11.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Liu C., Chu D., Kalantar-Zadeh K., George J., Young H.A., Liu G. Cytokines: From Clinical Significance to Quantification. Adv. Sci. 2021;8:e2004433. doi: 10.1002/advs.202004433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Wautier J.L., Wautier M.P. Pro- and Anti-Inflammatory Prostaglandins and Cytokines in Humans: A Mini Review. Int. J. Mol. Sci. 2023;24:9647. doi: 10.3390/ijms24119647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Boshtam M., Asgary S., Kouhpayeh S., Shariati L., Khanahmad H. Aptamers Against Pro- and Anti-Inflammatory Cytokines: A Review. Inflammation. 2017;40:340–349. doi: 10.1007/s10753-016-0477-1. [DOI] [PubMed] [Google Scholar]
  • 13.Dias K.M.M., Oliveira C.H., Calderano A.A., Rostagno H.S., Gomes K.M., O’Connor K.E., Davis R., Walsh M., Britton J., Altieri E.A., et al. Dietary Hydroxytyrosol Supplementation on Growth Performance, Gut Morphometry, and Oxidative and Inflammatory Status in Lps-Challenged Broilers. Animals. 2024;14:871. doi: 10.3390/ani14060871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Yu F., Shi X., Li K., Yin Y., Xu S. Naringenin Counteracts Lps-Induced Inflammation and Immune Deficits in Chicken Thymus by Alleviating Mtros/Ferroptosis Levels. Poult. Sci. 2024;103:104179. doi: 10.1016/j.psj.2024.104179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Li X., Liu S., Wang J., Yi J., Yuan Z., Wu J., Wen L., Li R. Effects of Nd Vaccination Combined Lps on Growth Performance, Antioxidant Performance and Lipid Metabolism of Broiler. Res. Vet. Sci. 2021;135:317–323. doi: 10.1016/j.rvsc.2020.10.007. [DOI] [PubMed] [Google Scholar]
  • 16.Ruan D., Wu S., Fouad A.M., Zhu Y., Huang W., Chen Z., Gou Z., Wang Y., Han Y., Yan S., et al. Curcumin Alleviates Lps-Induced Intestinal Homeostatic Imbalance Through Reshaping Gut Microbiota Structure and Regulating Group 3 Innate Lymphoid Cells in Chickens. Food Funct. 2022;13:11811–11824. doi: 10.1039/D2FO02598A. [DOI] [PubMed] [Google Scholar]
  • 17.Wang J., Ding X., Zeng Q., Bai S., Zhang K., Mao X., Xu S., Zhuo Y., Xuan Y., Peng H., et al. Dietary 25-Hydroxyvitamin D Improves Productive Performance and Intestinal Health of Laying Hens Under Escherichia coli Lipopolysaccharide Challenge. Poult. Sci. 2023;102:102371. doi: 10.1016/j.psj.2022.102371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Feng J., Li Z., Ma H., Yue Y., Hao K., Li J., Xiang Y., Min Y. Quercetin Alleviates Intestinal Inflammation and Improves Intestinal Functions Via Modulating Gut Microbiota Composition in Lps-Challenged Laying Hens. Poult. Sci. 2023;102:102433. doi: 10.1016/j.psj.2022.102433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Wang Y., Ye J., Zhang S., Chen Z., Fan Q., Jiang S. Dietary Supplementation with Anthocyanin Attenuates Lipopolysaccharide-Induced Intestinal Damage Through Antioxidant Effects in Yellow-Feathered Broiler Chicks. Poult. Sci. 2023;102:102325. doi: 10.1016/j.psj.2022.102325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Jiang S.Q., Chen Z.L., Zhang S., Ye J.L., Wang Y.B. Protective Effects of Protocatechuic Acid on Growth Performance, Intestinal Barrier and Antioxidant Capacity in Broilers Challenged with Lipopolysaccharide. Animal. 2023;17:100693. doi: 10.1016/j.animal.2022.100693. [DOI] [PubMed] [Google Scholar]
  • 21.Wang X., Zhou Q., Shen J., Yao J., Yang X. Effect of Difference Doses of Newcastle Disease Vaccine Immunization on Growth Performance, Plasma Variables and Immune Response of Broilers. J. Anim. Sci. Biotechnol. 2015;6:20. doi: 10.1186/s40104-015-0019-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Ahiwe E.U., Abdallh M.E., Chang’a E.P., Al-Qahtani M., Omede A.A., Graham H., Iji P.A. Influence of Autolyzed Whole Yeast and Yeast Components on Broiler Chickens Challenged with Salmonella Lipopolysaccharide. Poult. Sci. 2019;98:7129–7138. doi: 10.3382/ps/pez452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bai D., Liu K., He X., Tan H., Liu Y., Li Y., Zhang Y., Zhen W., Zhang C., Ma Y. Effect of Dietary Chlorogenic Acid on Growth Performance, Antioxidant Function, and Immune Response of Broiler Breeders under Immune Stress and Stocking Density Stress. Vet. Sci. 2022;9:582. doi: 10.3390/vetsci9100582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Jarczak D., Nierhaus A. Cytokine Storm-Definition, Causes, and Implications. Int. J. Mol. Sci. 2022;23:11740. doi: 10.3390/ijms231911740. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Sosnowka-Czajka E., Skomorucha I. Effect of Supplementation with Dried Fruit Pomace on the Performance, Egg Quality, White Blood Cells, and Lymphatic Organs in Laying Hens. Poult. Sci. 2021;100:101278. doi: 10.1016/j.psj.2021.101278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chen K., Peng X., Fang J., Cui H., Zuo Z., Deng J., Chen Z., Geng Y., Lai W., Tang L., et al. Effects of Dietary Selenium on Histopathological Changes and T Cells of Spleen in Broilers Exposed to Aflatoxin B1. Int. J. Environ. Res. Public Health. 2014;11:1904–1913. doi: 10.3390/ijerph110201904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Zhu X., Tao L., Liu H., Yang G. Effects of Fermented Feed on Growth Performance, Immune Organ Indices, Serum Biochemical Parameters, Cecal Odorous Compound Production, and the Microbiota Community in Broilers. Poult. Sci. 2023;102:102629. doi: 10.1016/j.psj.2023.102629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Miao Z., Zhao W., Guo L., Wang S., Zhang J. Effects of Dietary Supplementation of Chitosan on Immune Function in Growing Huoyan Geese. Poult. Sci. 2020;99:95–100. doi: 10.3382/ps/pez565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wang W., Li Z., Ren W., Yue Y., Guo Y. Effects of Live Yeast Supplementation on Lipopolysaccharide-Induced Inflammatory Responses in Broilers. Poult. Sci. 2016;95:2557–2564. doi: 10.3382/ps/pew191. [DOI] [PubMed] [Google Scholar]
  • 30.Zheng X.C., Wu Q.J., Song Z.H., Zhang H., Zhang J.F., Zhang L.L., Zhang T.Y., Wang C., Wang T. Effects of Oridonin on Growth Performance and Oxidative Stress in Broilers Challenged with Lipopolysaccharide. Poult. Sci. 2016;95:2281–2289. doi: 10.3382/ps/pew161. [DOI] [PubMed] [Google Scholar]
  • 31.Monastero R.N., Pentyala S. Cytokines as Biomarkers and Their Respective Clinical Cutoff Levels. Int. J. Inflam. 2017;2017:4309485. doi: 10.1155/2017/4309485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Moudgil K.D., Choubey D. Cytokines in Autoimmunity: Role in Induction, Regulation, and Treatment. J. Interferon Cytokine Res. 2011;31:695–703. doi: 10.1089/jir.2011.0065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zhang H., Dhalla N.S. The Role of Pro-Inflammatory Cytokines in the Pathogenesis of Cardiovascular Disease. Int. J. Mol. Sci. 2024;25:1082. doi: 10.3390/ijms25021082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Zheng Y.W., Zhang J.Y., Zhou H.B., Guo Y.P., Ma Q.G., Ji C., Zhao L.H. Effects of Dietary Pyrroloquinoline Quinone Disodium Supplementation on Inflammatory Responses, Oxidative Stress, and Intestinal Morphology in Broiler Chickens Challenged with Lipopolysaccharide. Poult. Sci. 2020;99:5389–5398. doi: 10.1016/j.psj.2020.08.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Jiang J., Qi L., Lv Z., Jin S., Wei X., Shi F. Dietary Stevioside Supplementation Alleviates Lipopolysaccharide-Induced Intestinal Mucosal Damage through Anti-Inflammatory and Antioxidant Effects in Broiler Chickens. Antioxidants. 2019;8:575. doi: 10.3390/antiox8120575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yang L., Liu G., Zhu X., Luo Y., Shang Y., Gu X.L. The Anti-Inflammatory and Antioxidant Effects of Leonurine Hydrochloride After Lipopolysaccharide Challenge in Broiler Chicks. Poult. Sci. 2019;98:1648–1657. doi: 10.3382/ps/pey532. [DOI] [PubMed] [Google Scholar]
  • 37.Lajqi T., Kostlin-Gille N., Bauer R., Zarogiannis S.G., Lajqi E., Ajeti V., Dietz S., Kranig S.A., Ruhle J., Demaj A., et al. Training vs. Tolerance: The Yin/Yang of the Innate Immune System. Biomedicines. 2023;11:766. doi: 10.3390/biomedicines11030766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Marais M., Maloney S.K., Gray D.A. The Development of Endotoxin Tolerance, and the Role of Hypothalamo-Pituitary-Adrenal Function and Glucocorticoids in Pekin Ducks. J. Exp. Biol. 2011;214:3378–3385. doi: 10.1242/jeb.056499. [DOI] [PubMed] [Google Scholar]
  • 39.Akira S., Sato S. Toll-Like Receptors and Their Signaling Mechanisms. Scand. J. Infect. Dis. 2003;35:555–562. doi: 10.1080/00365540310015683. [DOI] [PubMed] [Google Scholar]
  • 40.Zhou L., Liu Z., Wang Z., Yu S., Long T., Zhou X., Bao Y. Astragalus Polysaccharides Exerts Immunomodulatory Effects Via Tlr4-Mediated Myd88-Dependent Signaling Pathway In Vitro and In Vivo. Sci. Rep. 2017;7:44822. doi: 10.1038/srep44822. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Li X.X., Zheng X., Liu Z., Xu Q., Tang H., Feng J., Yang S., Vong C.T., Gao H., Wang Y. Cryptotanshinone from Salvia Miltiorrhiza Bunge (Danshen) Inhibited Inflammatory Responses Via Tlr4/Myd88 Signaling Pathway. Chin. Med. 2020;15:20. doi: 10.1186/s13020-020-00303-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Huang X.Y., Ansari A.R., Huang H.B., Zhao X., Li N.Y., Sun Z.J., Peng K.M., Zhong J., Liu H.Z. Lipopolysaccharide Mediates Immuno-Pathological Alterations in Young Chicken Liver Through Tlr4 Signaling. BMC Immunol. 2017;18:12. doi: 10.1186/s12865-017-0199-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Ansari A.R., Li N.Y., Sun Z.J., Huang H.B., Zhao X., Cui L., Hu Y.F., Zhong J.M., Karrow N.A., Liu H.Z. Lipopolysaccharide Induces Acute Bursal Atrophy in Broiler Chicks by Activating Tlr4-Mapk-Nf-Κb/Ap-1 Signaling. Oncotarget. 2017;8:108375–108391. doi: 10.18632/oncotarget.19964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Liu S.D., Song M.H., Yun W., Lee J.H., Kim H.B., Cho J.H. Effect of Carvacrol Essential Oils on Immune Response and Inflammation-Related Genes Expression in Broilers Challenged by Lipopolysaccharide. Poult. Sci. 2019;98:2026–2033. doi: 10.3382/ps/pey575. [DOI] [PubMed] [Google Scholar]
  • 45.Tong W., Chen X., Song X., Chen Y., Jia R., Zou Y., Li L., Yin L., He C., Liang X., et al. Resveratrol Inhibits Lps-Induced Inflammation Through Suppressing the Signaling Cascades of Tlr4-Nf-Kappab/Mapks/Irf3. Exp. Ther. Med. 2020;19:1824–1834. doi: 10.3892/etm.2019.8396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Jin S., Wang H., Gong H., Guo L., Zhang H., Zhang J., Chang Q., Li J., Zhang R., Bao J. Music Intervention Mitigates Lps-Induced Gut Barrier Disruption and Immune Stress in Broilers Via Tlr4/Nf-Kappab Regulation. Poult. Sci. 2025;104:105189. doi: 10.1016/j.psj.2025.105189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Xing Y., Zheng Y., Yang S., Zhang L., Guo S., Shi L., Xu Y., Jin X., Yan S., Shi B. Artemisia Ordosica Polysaccharide Ameliorated Lps-Induced Growth Inhibition and Intestinal Injury in Broilers Through Enhancing Immune-Regulation and Antioxidant Capacity. J. Nutr. Biochem. 2023;115:109284. doi: 10.1016/j.jnutbio.2023.109284. [DOI] [PubMed] [Google Scholar]
  • 48.Xing Y.Y., Zheng Y.K., Yang S., Zhang L.H., Guo S.W., Shi L.L., Xu Y.Q., Jin X., Yan S.M., Shi B.L. Artemisia Ordosica Polysaccharide Alleviated Lipopolysaccharide-Induced Oxidative Stress of Broilers Via Nrf2/Keap1 and Tlr4/Nf-Κb Pathway. Ecotoxicol. Environ. Saf. 2021;223:112566. doi: 10.1016/j.ecoenv.2021.112566. [DOI] [PubMed] [Google Scholar]
  • 49.Chang L.Y., Di K.Q., Xu J., Chen Y.F., Xi J.Z., Wang D.H., Hao E.Y., Xu L.J., Chen H., Zhou R.Y. Effect of Natural Garlic Essential Oil on Chickens with Artificially Infected Eimeria tenella. Vet. Parasitol. 2021;300:109614. doi: 10.1016/j.vetpar.2021.109614. [DOI] [PubMed] [Google Scholar]
  • 50.Fu G., Zhang M., Huang Y., Han R., Qi K., Yin L., Zhao D., Huang Y., Ma T., Wang L. Effects of Different Addition Levels of Chm-Jm113 on Growth Performance, Antioxidant Capacity, Organ Index, and Intestinal Health of Aa Broilers. Front. Vet. Sci. 2024;11:1388173. doi: 10.3389/fvets.2024.1388173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.An J., Shi J., Liu K., Li A., He B., Wang Y., Duan T., Wang Y., He J. Effects of Solid-State Fermented Wheat Bran on Growth Performance, Immune Function, Intestinal Morphology and Microflora in Lipopolysaccharide-Challenged Broiler Chickens. Animals. 2022;12:1100. doi: 10.3390/ani12091100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Wu Z., Yang K., Zhang A., Chang W., Zheng A., Chen Z., Cai H., Liu G. Effects of Lactobacillus acidophilus on the Growth Performance, Immune Response, and Intestinal Barrier Function of Broiler Chickens Challenged with Escherichia coli O157. Poult. Sci. 2021;100:101323. doi: 10.1016/j.psj.2021.101323. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.


Articles from Animals : an Open Access Journal from MDPI are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES