Abstract
Background: Hepatic ischemia-reperfusion injury (HIRI) is a major complication in liver surgery with limited therapeutic options. Houttuynia cordata polysaccharide (HCP), a key bioactive component of the traditional anti-inflammatory herb, has demonstrated immunomodulatory potential, but its effect on HIRI remains unclear. Methods: A murine model of 70% hepatic ischemia for 60 min followed by reperfusion was established. Mice were administered low-dose (50 mg/kg) or high-dose (100 mg/kg) HCP or the positive control N-acetylcysteine (150 mg/kg). Liver injury was assessed by serum ALT/AST levels, histopathology, oxidative stress markers, and inflammatory cytokines. Macrophage polarization and the TLR4/NF-κB pathway were analyzed using flow cytometry, qPCR, and Western blot. The TLR4 inhibitor TAK-242 was used for reverse validation, and molecular docking was performed to predict HCP binding to the TLR4/MD-2 complex. Results: HCP significantly attenuated HIRI-induced liver injury, as shown by reduced ALT/AST, improved histopathological scores, decreased MDA, increased SOD, and lower TNF-α and IL-6 levels. Mechanistically, HCP promoted a shift from M1 to M2 macrophage polarization, with increased CD206+ cells and Arg-1/IL-10 expression and decreased CD86+ cells and iNOS/IL-1β expression. HCP also suppressed TLR4/MyD88/NF-κB pathway activation, inhibiting NF-κB p65 phosphorylation and nuclear translocation. These protective effects were largely reversed by TAK-242 in vivo and in vitro. Molecular docking indicated stable binding between HCP and TLR4/MD-2. Conclusions: HCP protects against HIRI by targeting TLR4 to inhibit NF-κB signaling, thereby reprogramming macrophage polarization toward the M2 phenotype and alleviating inflammation and oxidative stress. These findings highlight HCP as a promising natural agent for HIRI intervention.
Keywords: Houttuynia cordata polysaccharide, hepatic ischemia-reperfusion injury, TLR4/NF-κB pathway, macrophage polarization, inflammation, oxidative stress
1. Introduction
Liver resection and liver transplantation are the most effective treatments for hepatic malignancies and end-stage liver disease [1]. However, the inevitable hepatic ischemia-reperfusion injury (HIRI) during these procedures is not only a key factor leading to severe complications such as postoperative liver failure and graft dysfunction but also greatly limits the quantity and quality of available donor livers [2,3]. Therefore, elucidating the pathophysiological mechanisms of HIRI and finding effective prevention and treatment strategies has become an urgent scientific issue in the field of liver surgery.
The pathological process of HIRI is complex, involving the synergistic action of multiple cellular and molecular mechanisms. When blood supply is restored, the ischemic tissue does not immediately return to normal; instead, it triggers more severe secondary damage, a phenomenon known as “reperfusion injury” [4]. One of its core mechanisms is the excessive activation of a sterile inflammatory response [5]. In the liver, resident macrophages—Kupffer cells—are the initiators and primary executors of this inflammatory response [6,7]. Studies have shown that during HIRI, activated Kupffer cells undergo significant phenotypic polarization, mainly divided into the classically activated pro-inflammatory M1 type and alternatively activated anti-inflammatory M2 type [8]. M1 macrophages directly mediate hepatocyte damage by releasing large amounts of pro-inflammatory cytokines such as tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6), as well as producing reactive oxygen species (ROS) [9,10], whereas M2 macrophages exert anti-inflammatory and tissue repair functions by secreting interleukin-10 (IL-10), among others [8,11]. Therefore, regulating the polarization balance of macrophages from the M1 to the M2 type is considered a highly promising therapeutic strategy for alleviating HIRI.
In recent years, natural polysaccharides have emerged as promising immunomodulatory agents for IRI due to their multi-target and low-toxicity profiles. For instance, astragalus polysaccharide and fucoidan have shown protective effects in cardiac and cerebral IRI models, partly through TLR4/NF-κB modulation. However, their efficacy in HIRI remains less explored, and structural heterogeneity often limits mechanistic clarity. Houttuynia cordata polysaccharide (HCP) stands out due to its well-documented anti-inflammatory and antioxidant activities in other inflammatory models, its unique structural features—such as high galacturonic acid content and specific branched architecture—that are predicted to favor interaction with pattern recognition receptors like TLR4, and the long-standing traditional use of Houttuynia cordata in treating inflammatory disorders. These attributes make HCP a compelling candidate for investigating macrophage-centered interventions in HIRI.
The Toll-like receptor 4 (TLR4) and its downstream nuclear factor-kappa B (NF-κB) signaling pathway play a central role in connecting the initial injury signal with macrophage-mediated inflammatory amplification [12]. Under HIRI conditions, endogenous damage-associated molecular patterns (DAMPs) released by necrotic hepatocytes can be recognized by TLR4 on the macrophage surface, activating the NF-κB signaling cascade via the myeloid differentiation factor 88 (MyD88)-dependent pathway [12,13]. Activated NF-κB (mainly the p65 subunit) translocates to the nucleus, initiating the transcription of various pro-inflammatory factors, including TNF-α and IL-6, and M1 polarization markers (such as iNOS), thereby forming a positive feedback loop that continuously exacerbates inflammatory injury [14]. Substantial evidence indicates that inhibiting the TLR4/NF-κB pathway can effectively reduce the severity of HIRI [15], making it a very attractive target for pharmacological intervention.
Houttuynia cordata Thunb. is a traditional Chinese medicine with the effects of clearing heat, detoxification, eliminating carbuncles, and draining pus. It is commonly used clinically for treating inflammatory diseases. Modern pharmacological studies have confirmed that Houttuynia cordata polysaccharide (HCP) is one of its key active components responsible for anti-inflammatory, antioxidant, and immunomodulatory effects [16,17]. However, whether HCP has a protective effect against HIRI, particularly whether its action is related to regulating the TLR4/NF-κB signaling pathway and macrophage polarization, remains unclear.
Based on the above background, this study proposes the scientific hypothesis: HCP may alleviate hepatic ischemia-reperfusion injury by targeting the TLR4 receptor, inhibiting the overactivation of the NF-κB signaling pathway, thereby regulating macrophage polarization from the pro-inflammatory M1 type to the anti-inflammatory M2 type.
To test this hypothesis, we comprehensively employed an in vivo mouse HIRI model and an in vitro cell hypoxia/reoxygenation (H/R) model to systematically evaluate the effects of HCP on liver injury, oxidative stress, and inflammatory response. We further explored its molecular mechanisms from the perspectives of macrophage phenotype regulation and the TLR4/NF-κB signaling pathway, while conducting reverse validation and direct interaction prediction using a TLR4 inhibitor and molecular docking techniques. Specifically, the TLR4 inhibitor TAK-242 was used to verify whether TLR4 is a necessary target of HCP, and molecular docking was applied to predict the direct binding between HCP and the TLR4/MD-2 complex. This study aims to provide a solid pharmacological basis for HCP as a novel natural hepatoprotective agent and to lay the foundation for its further development in perioperative liver protection.
2. Materials and Methods
2.1. Chemicals and Reagents
Houttuynia cordata polysaccharide (HCP) was extracted and purified from Houttuynia cordata Thunb. in our laboratory. Analysis by high-performance gel permeation chromatography (HPGPC) and high-performance liquid chromatography (HPLC) confirmed that its main component is a water-soluble pectic polysaccharide fraction, whose structure is consistent with the reported HCA4S1 [18]. This fraction has an average molecular weight of approximately 21.7 kDa and is mainly composed of rhamnose (Rha), galacturonic acid (GalA), galactose (Gal), and arabinose (Ara). Its backbone consists of alternately linked 1,4-linked α-D-galacturonic acid and 1,2,4-linked α-L-rhamnose, with side chains primarily composed of galactose and arabinose attached to the C-4 position of the rhamnose residues. All subsequent in vivo and in vitro experiments in this study were conducted using this HCA4S1-enriched HCP fraction. To exclude confounding effects of endotoxin, the HCP fraction was verified to contain endotoxin levels below 0.1 EU/mg using a limulus amebocyte lysate (LAL) assay (Bioendo, Xiamen, China). N-acetylcysteine (NAC) and the TLR4 inhibitor TAK-242 were purchased from Sigma-Aldrich (St. Louis, MO, USA). Mouse ALT, AST, MDA, SOD, TNF-α, and IL-6 ELISA detection kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Antibodies against TLR4, MyD88, NF-κB p65, phospho-NF-κB p65 (p-p65), iNOS, Arg-1, and β-actin were purchased from ProteinTech Group (Chicago, IL, USA). Flow cytometry antibodies CD86 and CD206 were purchased from BioLegend (San Diego, CA, USA).
2.2. Animal Model and Experimental Design
Male C57BL/6 mice (6–8 weeks old, weighing 20–25 g) were purchased from Vital River Laboratory Animal Technology Co., Ltd (Beijing, China). All animals were housed in an SPF environment with free access to food and water. All animal experimental procedures followed the guidelines of the Animal Ethics Committee of Renmin Hospital of Wuhan University and were approved by the Animal Ethics Committee of Renmin Hospital of Wuhan University (Approval No.: 20250303A).
Dose selection was based on a pilot dose-response study (25, 50, 100, 200 mg/kg) in which 50 and 100 mg/kg provided significant hepatoprotection without adverse effects (no changes in body weight, behavior, or organ indices). These doses are also consistent with previous reports of HCP’s anti-inflammatory efficacy in murine models. Acute toxicity testing showed that a single i.p. dose up to 500 mg/kg caused no mortality or overt toxicity over 14 days.
Mice were randomly divided into 5 groups (n = 8/group):
Sham group: Only laparotomy and closure were performed without hepatic portal blockade.
Vehicle group (Model): The HIRI model was established, and an equal volume of normal saline was injected via the tail vein before reperfusion.
HCP Low-dose group (HIRI + HCP-L): The model was established as above, and HCP (50 mg/kg) was injected before reperfusion.
HCP High-dose group (HIRI + HCP-H): The model was established as above, and HCP (100 mg/kg) was injected before reperfusion.
Positive Control group (HIRI + NAC): The model was established as above, and NAC (150 mg/kg) was injected before reperfusion.
HCP was administered intraperitoneally once daily for three consecutive days before ischemia. This pre-treatment regimen was chosen because polysaccharides often require repeated administration to achieve stable immunomodulatory effects, and it aligns with common practice in HIRI pharmacologic studies where agents are given pre-emptively to establish adequate tissue levels and modulate baseline inflammatory status before ischemic insult.
The HIRI model was established according to the method described by Suzuki et al. Briefly, mice were anesthetized with isoflurane (Sigma-Aldrich, St. Louis, MO, USA), a midline abdominal incision was made, and the portal pedicles to the left and median liver lobes (approximately 70% of the liver) were clamped with a non-traumatic microvascular clip for 60 min to induce partial hepatic ischemia. The clip was then removed to restore blood flow for 6, 24, or 48 h of reperfusion. At the end of reperfusion, serum and liver tissue samples were collected and stored at −80 °C or fixed.
2.3. Serum Biochemistry and Histopathology
Serum ALT and AST levels were detected using commercial ELISA kits strictly according to the manufacturer’s instructions. Liver tissues were fixed in 4% paraformaldehyde, embedded in paraffin, sectioned (5 μm thickness), and stained with hematoxylin and eosin (H&E). The severity of liver tissue damage was observed under a light microscope by two pathologists blinded to the experimental groups and semi-quantitatively assessed according to the Suzuki scoring system. Scoring items included sinusoidal congestion, hepatocyte vacuolization, hepatocyte necrosis, and neutrophil infiltration, each scored from 0 to 4, with a total score ranging from 0 to 16.
2.4. Measurement of Oxidative Stress and Inflammatory Cytokines
After liver tissue homogenization, the content of malondialdehyde (MDA) and the activity of superoxide dismutase (SOD) were determined using the thiobarbituric acid method and the hydroxylamine method, respectively, according to kit instructions. Serum concentrations of tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) were measured using specific ELISA kits.
2.5. Flow Cytometry
Fresh liver tissue was digested with collagenase IV(Sigma-Aldrich, St. Louis, MO, USA) to prepare a single-cell suspension. Cells were blocked with anti-mouse CD16/32 antibody to block Fc receptors and then incubated with FITC-conjugated anti-mouse CD86 antibody and PE-conjugated anti-mouse CD206 antibody at 4 °C in the dark for 30 min. Detection was performed using a BD FACS Canto II flow cytometer(BD Biosciences, San Jose, CA, USA), and data were analyzed using FlowJo V10 software. CD86-positive cells represented M1-type macrophages, and CD206-positive cells represented M2-type macrophages.
2.6. Quantitative Real-Time PCR (qPCR) and Western Blotting
Total RNA was extracted from liver tissue using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA). Using β-actin as the internal reference, amplification was performed on a QuantStudio 5 real-time PCR system(Thermo Fisher Scientific, Waltham, MA, USA) with the SYBR Green method(Bio-Rad, Hercules, CA, USA). The relative gene expression was calculated using the 2−ΔΔCt method. The primer sequences of the targeted genes are list as follows:
β-actin: AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT,
Arg-1: CTCCAAGCCAAAGTCCTTAGAG AGGAGCTGTCATTAGGGACATC,
IL-10: GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG,
iNOS: GTTCTCAGCCCAACAATACAAGA GTGGACGGGTCGATGTCAC,
IL-1β: GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT.
Total protein was extracted from the liver tissue or cells using RIPA lysis buffer (Sigma-Aldrich, St. Louis, MO, USA). Equal amounts of protein were separated by SDS-PAGE and transferred to PVDF membranes (Merck Millipore, Burlington, MA, USA). After blocking with 5% non-fat milk, membranes were incubated with corresponding primary antibodies at 4 °C overnight, followed by incubation with HRP-conjugated secondary antibodies at room temperature for 1 h. Finally, signals were visualized using an ECL chemiluminescence kit (Bio-Rad, Hercules, CA, USA) on an imaging system (Bio-Rad ChemiDoc XRS+, Bio-Rad, Hercules, CA, USA).
2.7. Immunohistochemistry (IHC)
For analysis of NF-κB p65 nuclear translocation, immunohistochemistry was used. Paraffin sections underwent antigen retrieval, incubation with anti-NF-κB p65 primary antibody, followed by DAB (ZSGB-BIO, Beijing, China) development using the SP method (ZSGB-BIO, Beijing, China) and hematoxylin (Sigma-Aldrich, St. Louis, MO, USA) counterstaining. Observations and photography were performed under an optical microscope to assess the subcellular localization of NF-κB p65.
2.8. Cell Culture and Hypoxia/Reoxygenation (H/R) Model
The mouse macrophage cell line RAW264.7 was purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China) and cultured in high-glucose DMEM (Gibco, Grand Island, NY, USA) supplemented with 10% FBS (Gibco, Grand Island, NY, USA). To simulate IRI, cells were placed in a tri-gas incubator (Thermo Fisher Scientific, Waltham, MA, USA) (94% N2, 5% CO2, 1% O2) for 6 h of hypoxia, then the medium was replaced with fresh medium for reoxygenation under normoxic conditions (95% air, 5% CO2) for 12 h. Experimental groups were: Control (Normoxia), H/R Model group (Vehicle), H/R + HCP (100 μg/mL) group, and H/R + HCP + TAK-242 (1 μM) group. TAK-242 was added 1 h before hypoxia. Cell viability was assessed using a CCK-8 kit (Dojindo Laboratories, Kumamoto, Japan). Levels of inflammatory cytokines and reactive oxygen species (ROS) in the cell supernatant were measured by ELISA and the DCFH-DA fluorescent probe method (Sigma-Aldrich, St. Louis, MO, USA), respectively.
2.9. Molecular Docking
The crystal structure of the TLR4/MD-2 complex was obtained from the Protein Data Bank (PDB ID: 3FXI). The 3D structure of a potential active trisaccharide unit (rhamnose, galactose, glucuronic acid) of HCP was downloaded from the PubChem database or optimized using the Gaussian program. Molecular docking was performed using AutoDock Vina 1.1.2 software, and the docking results were visualized and analyzed for interactions using PyMOL 2.5.0 and LigPlot+ 2.2 software.
2.10. Statistical Analysis
All data are expressed as mean ± standard deviation (Mean ± SD). Statistical analysis was performed using GraphPad Prism 9.0 software. Comparisons among multiple groups were performed using one-way analysis of variance (ANOVA) followed by Levene’s test for homogeneity of variances. If variances were homogeneous, post hoc tests used Dunnett’s method (comparison with the Vehicle group) or Tukey’s method (pairwise comparison among all groups); if variances were not homogeneous, Welch’s ANOVA with Games-Howell post hoc test was used. p < 0.05 was considered statistically significant.
3. Results
3.1. HCP Ameliorates Liver Function and Pathological Damage in HIRI Mice
To evaluate the protective effect of HCP on HIRI, we established a mouse model of 70% hepatic ischemia for 60 min followed by reperfusion. Serum and liver tissues were collected after 6, 24, and 48 h of reperfusion. As shown in Figure 1A,B, compared with the Sham group, serum levels of hepatocyte injury markers ALT and AST increased dramatically in the HIRI model group (Vehicle). HCP treatment, especially at the high dose (100 mg/kg), significantly inhibited this increase in a time-dependent manner, with the most pronounced effect observed at 24 h of reperfusion. The positive control drug NAC (150 mg/kg) also showed significant hepatoprotective effects.
Figure 1.
HCP ameliorates liver function and pathological damage in HIRI. (A,B) Serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in each group: Compared with the Vehicle group, HCP (50 and 100 mg/kg) treatment significantly reduced the levels of serum liver injury markers. (C) Representative images of H&E staining of liver tissues (scale bar: 200 μm): The Sham group showed normal liver architecture, while the Vehicle group exhibited marked sinusoidal congestion and hepatocyte necrosis. HCP treatment markedly alleviated these pathological injuries. (D) Statistical analysis of Suzuki scores based on H&E staining: HCP dose-dependently decreased the liver injury score. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 vs. Vehicle group.
Consistent with the biochemical results, histopathological analysis of liver tissue by H&E staining showed that the model group exhibited severe features such as sinusoidal congestion, hepatocyte vacuolization, and necrosis (Figure 1C). The Suzuki score, which quantitatively assesses these pathological features, was significantly increased in the model group but significantly reduced after treatment with both low and high doses of HCP (Figure 1D). These results indicate that HCP effectively alleviates HIRI-induced liver function impairment and histopathological damage.
3.2. HCP Alleviates Oxidative Stress and Systemic Inflammatory Response in HIRI Mice
Given the critical role of oxidative stress in HIRI, we measured MDA content and SOD activity in liver tissues. As shown in Figure 2A,B, MDA content was significantly increased and SOD activity was significantly decreased in the liver tissue of the model group. HCP treatment, particularly at the high dose, reversed these changes, indicating its potent antioxidant capacity.
Figure 2.
HCP alleviates oxidative stress and systemic inflammatory response in HIRI. (A) Malondialdehyde (MDA) content in liver tissues at 24 h reperfusion (n = 8). (B) Superoxide dismutase (SOD) activity in liver tissues at 24 h reperfusion (n = 8). (C,D) Serum levels of tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) at 24 h reperfusion (n = 8). (E) Western blot analysis of inflammatory cytokine protein expression (IL-6, TNF-α, IL-1β) in liver tissues, with GAPDH as loading control (representative of three independent experiments). Data are mean ± SD. Statistical significance was determined by one-way ANOVA with Tukey’s post hoc test. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 vs. Vehicle group.
The systemic inflammatory response was assessed by measuring serum levels of pro-inflammatory cytokines. ELISA results showed that serum concentrations of TNF-α and IL-6 were significantly elevated in the model group (Figure 2C,D). However, HCP administration dose-dependently inhibited the release of these cytokines, with anti-inflammatory effects comparable to NAC. These data suggest that HCP alleviates HIRI by mitigating oxidative stress and systemic inflammation.
3.3. HCP Promotes the Polarization of Hepatic Macrophages Towards the M2 Phenotype
Since macrophages are key regulators of the inflammatory response in HIRI, we investigated the effect of HCP on macrophage polarization. Flow cytometric analysis of liver non-parenchymal cells showed that HIRI led to a significant increase in the proportion of CD86+ M1-type macrophages and a decrease in the proportion of CD206+ M2-type macrophages (Figure 3A). HCP treatment reversed this imbalance, promoting a shift in macrophages from the pro-inflammatory M1 phenotype to the anti-inflammatory M2 phenotype.
Figure 3.
HCP promotes macrophage polarization toward the M2 phenotype in HIRI. (A) Flow cytometric analysis of macrophage phenotypes among liver non-parenchymal cells at 24 h reperfusion. Left: Representative flow plots gated on F4/80+ cells. Right: Quantification of CD86+ (M1) and CD206+ (M2) percentages (n = 6 mice per group). (B–E) Quantitative real-time PCR (qPCR) analysis of M2 marker genes (Arg-1, IL-10) and M1 marker genes (iNOS, IL-1β) in liver tissues at 24 h reperfusion (n = 6). Data normalized to β-actin and expressed relative to Sham group. (F) Representative immunofluorescence staining of liver sections (scale bar: 50 μm) showing co-localization of CD11b+ macrophages (red) with CD86 (green, M1) or Arg1 (yellow, M2). Data are mean ± SD. Statistical significance: ** p < 0.01, *** p < 0.001, **** p < 0.0001 vs. Vehicle group (one-way ANOVA with Tukey’s test).
This shift was further confirmed at the molecular level. qPCR analysis showed that HCP upregulated the expression of M2 markers (Arg-1 and IL-10) (Figure 3B,C), while downregulating the expression of M1 markers (iNOS and IL-1β) in liver tissue (Figure 3D,E). Immunofluorescence staining also visually showed an increased proportion of M2 macrophages in the HCP-treated group (Figure 3F). These findings indicate that HCP modulates the immune response by driving macrophage polarization towards the M2 phenotype.
3.4. HCP Inhibits the TLR4/MyD88/NF-κB Signaling Pathway in HIRI
To explore the underlying mechanism, we focused on the TLR4/NF-κB pathway—a core regulatory pathway for inflammation and macrophage polarization. Western blot analysis showed that the protein expression levels of TLR4, MyD88, and phosphorylated NF-κB p65 (p-p65) were significantly upregulated in the model group, while HCP treatment significantly inhibited the expression of these proteins (Figure 4A).
Figure 4.
HCP inhibits the TLR4/MyD88/NF-κB signaling pathway in HIRI, and its effects are reversed by TLR4 blockade. (A) Western blot analysis of TLR4, MyD88, total p65, and phospho-p65 (p-p65) protein expression in liver tissues at 24 h reperfusion. GAPDH served as loading control (representative blot of n = 3 independent samples/group). (B) Immunohistochemical staining for NF-κB p65 in liver sections (scale bar: 50 μm). Arrows indicate nuclear p65 staining. (C–F) Serum ALT, AST, TNF-α, and IL-6 levels at 24 h reperfusion in mice pretreated with or without the TLR4 inhibitor TAK-242 (3 mg/kg, i.p.) 1 h before ischemia (n = 8). (G) Representative H&E-stained liver sections from corresponding groups (scale bar: 200 μm). (H) Western blot analysis of cytokine expression in liver tissues with or without TAK-242 intervention (representative of three experiments). Data are mean ± SD. Statistical analysis: one-way ANOVA with Tukey’s test. ** p < 0.01, **** p < 0.0001; ns, not significant.
Furthermore, immunohistochemistry (IHC) showed obvious nuclear translocation of NF-κB p65 in hepatocytes and non-parenchymal cells of mice in the model group, which was effectively inhibited by HCP (Figure 4B). This indicates that HCP blocks the activation and nuclear translocation of this key transcription factor.
To confirm whether TLR4 is necessary for HCP’s action, we used the specific TLR4 inhibitor TAK-242. As shown in Figure 4C–G, when mice were pretreated with TAK-242, the beneficial effects of HCP on reducing serum ALT/AST levels (Figure 4C,D) and inhibiting pro-inflammatory cytokines (TNF-α, IL-6) (Figure 4E,F) were largely abolished. Histopathological analysis by H&E staining and Western blot showed that the protective effects of HCP were counteracted by TAK-242 (Figure 4G). This pharmacological inhibition experiment provides strong evidence that the hepatoprotective effect of HCP is mediated through the TLR4 pathway.
3.5. HCP Directly Protects Macrophages Against H/R Injury via TLR4 In Vitro
To verify the direct effect of HCP on macrophages, we utilized an in vitro H/R model with RAW264.7 cells (6 h of hypoxia + 12 h of reoxygenation). H/R injury significantly reduced cell viability, which was reversed by co-treatment with HCP (Figure 5A). HCP also significantly reduced the secretion of TNF-α and IL-6 from macrophages stimulated by H/R and attenuated intracellular ROS production (Figure 5B–D). Crucially, the addition of TAK-242 offset the protective effects of HCP (Figure 5E–G), confirming that HCP acts directly on macrophages in a TLR4-dependent manner.
Figure 5.
HCP directly protects macrophages against hypoxia/reoxygenation (H/R) injury in a TLR4-dependent manner in vitro. (A) Cell viability of RAW264.7 macrophages assessed by CCK-8 assay after H/R (6 h hypoxia/12 h reoxygenation) with or without HCP co-treatment (n = 6 independent wells per group). (B,C) ELISA measurement of TNF-α and IL-6 levels in culture supernatants after H/R (n = 4 independent experiments). (D) Intracellular reactive oxygen species (ROS) levels measured by DCFH-DA fluorescence (n = 4). (E–G) Corresponding TNF-α, IL-6, and ROS levels in cells pretreated with the TLR4 inhibitor TAK-242 (1 μM) 1 h prior to HCP and H/R (n = 4). Data are mean ± SD. Statistical significance: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 vs. H/R (Vehicle) group; ns, not significant (one-way ANOVA with Tukey’s test).
3.6. Molecular Docking Predicts a Direct Interaction Between HCP and TLR4
To provide structural insights into the interaction, molecular docking was performed. The results showed that a characteristic trisaccharide unit of HCP could stably bind within the hydrophobic pocket of the TLR4/MD-2 complex (Figure 6A). The predicted binding energy was −7.8 kcal/mol, indicating high binding affinity between the two. Additionally, HCP formed hydrogen bonds with key amino acid residues (Glu-229, His-178, Asp-264) of the TLR4/MD-2 complex, with bond lengths ranging from 2.7 to 3.2 Å (Figure 6B). This computational evidence supports the hypothesis that HCP is a direct TLR4 antagonist.
Figure 6.
Molecular docking predicts the direct interaction between HCP and the TLR4/MD-2 complex. (A) Overall binding conformation: The binding model of the TLR4/MD-2 complex (blue) and HCP (cyan) shows that HCP can stably dock into the hydrophobic binding pocket of TLR4, with a predicted binding energy of −7.8 kcal/mol. (B) Detailed view of local interactions (enlarged): HCP forms multiple hydrogen-bond interactions (yellow dashed lines) with key amino acid residues of TLR4 (e.g., GLU-229, HIS-178, ASP-264), with bond lengths ranging from 2.7 to 3.2 Å.
4. Discussion
Hepatic ischemia-reperfusion injury (HIRI) is a major challenge for the prognosis of liver surgery, and its complex pathological mechanisms make the development of prevention and treatment strategies difficult. This study systematically demonstrates for the first time that HCP, a polysaccharide component extracted from the traditional anti-inflammatory Chinese herb Houttuynia cordata, significantly alleviates HIRI in mice. More importantly, we have elucidated its underlying molecular mechanism: HCP exerts hepatoprotective effects by directly targeting the TLR4 receptor, inhibiting its downstream NF-κB signaling pathway, thereby reprogramming liver macrophages from the pro-inflammatory M1 phenotype to the anti-inflammatory M2 phenotype, ultimately reducing inflammatory response and oxidative stress (Figure 7). This finding not only provides solid pharmacological evidence for HCP as a potential natural hepatoprotective agent but also offers a new perspective for understanding the regulation of macrophage polarization in HIRI.
Figure 7.
Schematic diagram illustrating the mechanism by which HCP alleviates HIRI by regulating macrophage polarization via the TLR4/NF-κB pathway. After three days of intraperitoneal injection pretreatment with HCP, a 70% hepatic ischemia for 1 h followed by 24 h reperfusion injury model was established. HCP inhibits the activation of TLR4 on the surface of hepatic Kupffer cells, and blocks the downstream MyD88-dependent NF-κB signaling pathway, thereby reducing NF-κB nuclear translocation and the release of pro-inflammatory cytokines (TNF-α, IL-6). Concurrently, HCP regulates macrophage phenotypes, suppressing M1 polarization and promoting M2 polarization, ultimately alleviating hepatic ischemia-reperfusion injury.
This study first verified the therapeutic efficacy of HCP at the whole-animal level. Our data show that HCP dose-dependently and significantly reduced serum ALT and AST levels and improved histopathological damage in HIRI mice (Figure 1). This indicates that HCP effectively maintains hepatocyte membrane integrity and reduces parenchymal cell necrosis. Furthermore, a key feature of HIRI is the vicious cycle between oxidative stress and inflammation. We found that HCP treatment significantly reduced the lipid peroxidation product MDA in liver tissue and enhanced the activity of the key antioxidant enzyme SOD (Figure 2A,B), while inhibiting the release of systemic inflammatory factors TNF-α and IL-6 (Figure 2C,D). These results collectively indicate that HCP possesses dual antioxidant and anti-inflammatory pharmacological efficacies, laying a solid foundation for its action against the multiple injury mechanisms of HIRI.
In the inflammatory network of HIRI, liver-resident macrophages—Kupffer cells—play a central role. In recent years, the functional plasticity of macrophages, i.e., the M1/M2 polarization state, has been confirmed as crucial in determining the inflammatory process and tissue repair outcome. Our study is the first to link the protective effect of HCP with macrophage polarization. Flow cytometry results clearly showed that HCP treatment significantly increased the proportion of CD206+ M2-type macrophages while decreasing the proportion of CD86+ M1-type macrophages in liver tissue (Figure 3A). At the gene and protein levels, HCP similarly downregulated M1 phenotype markers (iNOS, IL-1β) and upregulated M2 phenotype markers (Arg-1, IL-10) (Figure 3B–E). This finding is crucial because it implies that HCP does not simply inhibit inflammation but actively and intelligently reprograms macrophages from “destroyers” to “repairers,” thereby reversing the inflammatory process at its source. This is consistent with reports that M2-related factors like IL-10 can inhibit M1 macrophage activity, suggesting that HCP may establish a negative feedback regulatory loop by inducing M2 polarization. Although our study focused on macrophages, HIRI involves a multicellular network including neutrophils, endothelial cells, and hepatocytes. The M2 macrophages induced by HCP may secrete IL-10 and TGF-β, which could dampen neutrophil activation and stabilize endothelial barriers, thereby indirectly mitigating tissue injury. Furthermore, hypoxia-inducible factors (HIFs), particularly HIF-1α, are stabilized during ischemia and can synergize with NF-κB to drive pro-inflammatory gene expression. By suppressing TLR4/NF-κB, HCP might indirectly attenuate HIF-1α-mediated inflammation, while potentially favoring the HIF-2α pathway associated with tissue repair—a hypothesis warranting future investigation.
To explore the upstream signals through which HCP regulates macrophage polarization, we focused on the TLR4/NF-κB pathway. This pathway is a recognized bridge connecting damage signals to inflammatory responses and can directly regulate the transcription of M1 polarization-related genes. Our experimental evidence strongly supports this hypothesis: at the protein level, HCP significantly inhibited the HIRI-induced increase in TLR4, MyD88, and phosphorylated NF-κB p65 levels (Figure 4A); the nuclear translocation of NF-κB p65 observed via IHC was effectively blocked by HCP (Figure 4B), which directly explains the suppression of downstream pro-inflammatory gene expression. How might TLR4 inhibition directly promote the M2 phenotype? TLR4/NF-κB signaling not only drives pro-inflammatory gene expression but also reinforces the metabolic reprogramming of macrophages toward aerobic glycolysis (the “Warburg effect”), which supports the M1 state. By dampening this pathway, HCP may alleviate the glycolytic flux and instead favor oxidative phosphorylation and fatty acid oxidation—metabolic programs characteristic of M2 polarization. Additionally, TLR4 suppression can downregulate IRF5 (a key M1-promoting transcription factor) while permitting activation of IRF4/STAT6, which are central to M2 differentiation. Future studies measuring real-time metabolic fluxes and IRF/STAT activity in HCP-treated macrophages will help clarify these mechanistic links. To establish the necessity, rather than mere correlation, of TLR4 in HCP’s action, we used the pharmacological inhibitor TAK-242 for reverse validation. In vivo experiments found that TAK-242 pretreatment almost completely blocked HCP’s protective effects on liver function and inflammation (Figure 5). This “loss-of-function” experiment provides the strongest evidence for our hypothesis that “HCP acts through TLR4.”
To exclude interference from the complex in vivo environment and confirm the direct effect of HCP on macrophages, we established an in vitro H/R model. The experimental results were highly consistent with the in vivo findings: HCP directly improved macrophage survival under H/R conditions, inhibiting their secretion of inflammatory factors and ROS generation (Figure 5A–C), and these effects were similarly reversed by TAK-242 (Figure 5D). This conclusively proves that macrophages are one of the direct target cells of HCP, and TLR4 is the key molecule mediating its effects. Several limitations should be acknowledged. First, all experiments used a single, well-characterized batch of HCP (HCA4S1-enriched). Natural polysaccharides can vary in composition due to plant source, harvest time, and extraction methods. Future translational work should adopt standardized extraction protocols, chemical fingerprinting (e.g., HPGPC, monosaccharide profiling), and bioactivity assays (e.g., TLR4 reporter) to ensure batch-to-batch consistency. Second, detailed pharmacokinetic data for HCP are lacking—a common challenge for macromolecular polysaccharides. While literature suggests similar polysaccharides can persist in plasma and liver for 24–48 h after i.p. injection, future studies using fluorescently labeled HCP or advanced LC-MS methods are needed to define its absorption, distribution, and elimination. Third, our pre-treatment regimen supports prophylactic use, which is relevant for planned liver surgeries; whether HCP is effective when given after ischemia onset (therapeutic regimen) remains to be tested. Finally, molecular docking studies predicted high-affinity binding between HCP and the TLR4/MD-2 complex from a structural perspective (Figure 7), providing theoretical support from structural biology for HCP as a direct TLR4 antagonist, perfectly explaining the findings from the aforementioned cell and animal experiments. This study predicted the binding of HCP to the TLR4/MD-2 complex through molecular docking. It is worth noting that the HCP used in this study mainly consists of the structurally defined HCA4S1. Its abundant negatively charged galacturonic acid residues and specific branched-chain structure may provide the molecular basis for interaction with the positively charged pocket of TLR4/MD-2. This provides a new example for the classical theory that “polysaccharides can exert immunomodulatory effects via pattern recognition receptors” and also suggests that the specific sugar chain conformation of HCA4S1 may be key to its TLR4 antagonistic effect.
This study has several limitations that also point to fruitful avenues for future research. First, while molecular docking and pharmacological inhibition with TAK-242 provide strong suggestive and functional evidence, respectively, the precise mechanism of interaction could be further solidified. Experimental validation of the predicted HCP-TLR4 binding using biophysical techniques (e.g., CETSA, SPR) and verification using macrophage-specific TLR4 knockout animals would more definitively confirm the direct target and exclude potential contributions of TLR4 in other cell types, such as hepatocytes or endothelial cells. Second, as a natural polysaccharide preparation, HCP’s composition presents specific challenges. Future work should aim to identify the specific oligosaccharide fragment or active domain responsible for its core immunomodulatory effects. Concurrently, because bioactivity can be influenced by factors like plant source and extraction methods, establishing standardized quality control protocols—including chemical fingerprinting and bioactivity assays—is crucial for ensuring batch-to-batch consistency and reproducibility. Third, the pharmacokinetic profile of HCP in vivo remains undefined, which is a common hurdle for macromolecular polysaccharide therapeutics; developing sensitive methods to track its absorption, distribution, and metabolism will be essential for translational development. Finally, to fully assess its clinical potential, future studies should explore the efficacy of HCP in more complex models, such as large animal liver transplantation, and evaluate critical practical aspects like its effectiveness when administered after reperfusion begins (therapeutic regimen) and its potential for combination therapy with other hepatoprotective agents.
Abbreviations
The following abbreviations are used in this manuscript:
| ALT | Alanine Aminotransferase |
| ANOVA | Analysis of Variance |
| Ara | Arabinose |
| Arg-1 | Arginase-1 |
| AST | Aspartate Aminotransferase |
| CAMS | Chinese Academy of Medical Sciences |
| CCK-8 | Cell Counting Kit-8 |
| DAB | 3,3′-Diaminobenzidine |
| DAMPs | Damage-Associated Molecular Patterns |
| DMEM | Dulbecco’s Modified Eagle Medium |
| ECL | Enhanced Chemiluminescence |
| ELISA | Enzyme-Linked Immunosorbent Assay |
| FBS | Fetal Bovine Serum |
| FITC | Fluorescein Isothiocyanate |
| Gal | Galactose |
| GalA | Galacturonic Acid |
| GAPDH | Glyceraldehyde-3-Phosphate Dehydrogenase |
| HCA4S1 | Houttuynia cordata polysaccharide fraction |
| HCP | Houttuynia cordata Polysaccharide |
| H&E | Hematoxylin and Eosin |
| HIRI | Hepatic Ischemia-Reperfusion Injury |
| HPGPC | High-Performance Gel Permeation Chromatography |
| HPLC | High-Performance Liquid Chromatography |
| H/R | Hypoxia/Reoxygenation |
| HRP | Horseradish Peroxidase |
| IHC | Immunohistochemistry |
| IL-1β | Interleukin-1 Beta |
| IL-6 | Interleukin-6 |
| IL-10 | Interleukin-10 |
| iNOS | Inducible Nitric Oxide Synthase |
| IRI | Ischemia-Reperfusion Injury |
| kDa | Kilodalton |
| MDA | Malondialdehyde |
| MyD88 | Myeloid Differentiation Factor 88 |
| NAC | N-Acetylcysteine |
| NF-κB | Nuclear Factor-kappa B |
| PBDB | Protein Data Bank |
| PBS | Phosphate-Buffered Saline |
| PE | Phycoerythrin |
| PVDF | Polyvinylidene Fluoride |
| qPCR | Quantitative Real-Time Polymerase Chain Reaction |
| Rha | Rhamnose |
| RIPA | Radioimmunoprecipitation Assay Buffer |
| ROS | Reactive Oxygen Species |
| SD | Standard Deviation |
| SDS-PAGE | Sodium Dodecyl Sulfate–Polyacrylamide Gel Electrophoresis |
| SOD | Superoxide Dismutase |
| SPF | Specific Pathogen-Free |
| TAK-242 | TLR4-specific inhibitor |
| TLR4 | Toll-like Receptor 4 |
| TNF-α | Tumor Necrosis Factor-alpha |
| TRIzol | TRIzol reagent |
| μM | Micromolar |
| μg/mL | Microgram per Milliliter |
Author Contributions
Conceptualization: T.Q., S.Z. and B.Y.; Methodology: B.Y., D.H., Z.C. (Zhan Chen) and T.W.; Investigation: Y.Z., B.Y. and Q.Q.; Formal Analysis: Z.C. (Zhongbao Chen) and X.M.; Resources: S.Z. and J.Z. (Jiefu Zhu); Writing—Original Draft: B.Y. and D.H.; Writing—Review and Editing: B.Y., T.Q. and S.Z.; Supervision: T.Q. and S.Z.; Funding Acquisition: J.Z. (Jiangqiao Zhou). All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
All animal experimental procedures followed the guidelines of the Animal Ethics Committee of Renmin Hospital of Wuhan University and were approved by the Animal Ethics Committee of Renmin Hospital of Wuhan University (Approval No.: 20250303A, 6 March 2025).
Informed Consent Statement
Not applicable.
Data Availability Statement
All the data in this paper are available from the corresponding author on request.
Conflicts of Interest
The authors declare no conflicts of interest.
Funding Statement
This work was supported by the National Natural Science Foundation of China (Grant No. 81870067 and No. 82170664). The funder had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Lucey M.R., Terrault N., Ojo L., Hay E.J., Neuberger J., Blumberg E., Teperman L.W. Long-term management of the successful adult liver transplant: 2012 practice guideline by the American Association for the Study of Liver Diseases and the American Society of Transplantation. Liver Transplant. 2013;19:3–26. doi: 10.1002/lt.23566. [DOI] [PubMed] [Google Scholar]
- 2.Lee D.D., Croome K.P., Shalev J.A., Musto K.R., Sharma M., Keaveny A.P., Taner C.B. Early allograft dysfunction after liver transplantation: An intermediate outcome measure for targeted improvements. Ann. Hepatol. 2016;15:53–60. doi: 10.5604/16652681.1184212. [DOI] [PubMed] [Google Scholar]
- 3.Ito T., Naini B.V., Markovic D., Aziz A., Younan S., Lu M., Hirao H., Kadono K., Kojima H., DiNorcia J., III, et al. Ischemia-reperfusion injury and its relationship with early allograft dysfunction in liver transplant patients. Am. J. Transplant. 2021;21:614–625. doi: 10.1111/ajt.16219. [DOI] [PubMed] [Google Scholar]
- 4.Oliveira T.H.C., Marques P.E., Proost P., Teixeira M.M.M. Neutrophils: A cornerstone of liver ischemia and reperfusion injury. Lab. Investig. 2018;98:51–62. doi: 10.1038/labinvest.2017.90. [DOI] [PubMed] [Google Scholar]
- 5.Hu Q., Wood C.R., Cimen S., Venkatachalam A.B., Alwayn I.P.J. Mitochondrial Damage-Associated Molecular Patterns (MTDs) Are Released during Hepatic Ischemia Reperfusion and Induce Inflammatory Responses. PloS ONE. 2015;10:e0140105. doi: 10.1371/journal.pone.0140105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Gandhi C.R. Oxidative Stress and Hepatic Stellate Cells: A Paradoxical Relationship. Trends Cell Mol. Biol. 2012;7:1–10. [PMC free article] [PubMed] [Google Scholar]
- 7.Nastos C., Kalimeris K., Papoutsidakis N., Tasoulis M.-K., Lykoudis P.M., Theodoraki K., Nastou D., Smyrniotis V., Arkadopoulos N. Global consequences of liver ischemia/reperfusion injury. Oxidative Med. Cell. Longev. 2014;2014:906965. doi: 10.1155/2014/906965. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Sica A., Mantovani A. Macrophage plasticity and polarization: In vivo veritas. J. Clin. Investig. 2012;122:787–795. doi: 10.1172/JCI59643. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Mosser D.M., Edwards J.P. Exploring the full spectrum of macrophage activation. Nat. Rev. Immunol. 2008;8:958–969. doi: 10.1038/nri2448. Erratum in Nat. Rev. Immunol. 2010, 10, 460. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Sun Y.Y., Li X.F., Meng X.M., Huang C., Zhang L., Li J. Macrophage Phenotype in Liver Injury and Repair. Scand. J. Immunol. 2017;85:166–174. doi: 10.1111/sji.12468. [DOI] [PubMed] [Google Scholar]
- 11.Tan H.Y., Wang N., Li S., Hong M., Wang X., Feng Y. The Reactive Oxygen Species in Macrophage Polarization: Reflecting Its Dual Role in Progression and Treatment of Human Diseases. Oxidative Med. Cell. Longev. 2016;2016:2795090. doi: 10.1155/2016/2795090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Konishi T., Lentsch A.B. Hepatic Ischemia/Reperfusion: Mechanisms of Tissue Injury, Repair, and Regeneration. Gene Expr. 2017;17:277–287. doi: 10.3727/105221617X15042750874156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Kadono K., Uchida Y., Hirao H., Miyauchi T., Watanabe T., Iida T., Ueda S., Kanazawa A., Mori A., Okajima H., et al. Thrombomodulin Attenuates Inflammatory Damage Due to Liver Ischemia and Reperfusion Injury in Mice in Toll-Like Receptor 4-Dependent Manner. Am. J. Transplant. 2017;17:69–80. doi: 10.1111/ajt.13991. [DOI] [PubMed] [Google Scholar]
- 14.Li W., Yang G.-L., Zhu Q., Zhong X.-H., Nie Y.-C., Li X.-H., Wang Y. TLR4 promotes liver inflammation by activating the JNK pathway. Eur. Rev. Med. Pharmacol. Sci. 2019;23:7655–7662. doi: 10.26355/eurrev_201909_18889. [DOI] [PubMed] [Google Scholar]
- 15.Tsung A., Hoffman R.A., Izuishi K., Critchlow N.D., Nakao A., Chan M.H., Lotze M.T., Geller D.A., Billiar T.R. Hepatic ischemia/reperfusion injury involves functional TLR4 signaling in nonparenchymal cells. J. Immunol. 2005;175:7661–7668. doi: 10.4049/jimmunol.175.11.7661. [DOI] [PubMed] [Google Scholar]
- 16.Li W., Zhou P., Zhang Y., He L. Houttuynia cordata, a novel and selective COX-2 inhibitor with anti-inflammatory activity. J. Ethnopharmacol. 2011;133:922–927. doi: 10.1016/j.jep.2010.10.048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lee H.J., Seo H.S., Kim G.J., Jeon C.Y., Park J.H., Jang B.H., Park S.J., Shin Y.C., Ko S.G. Houttuynia cordata Thunb inhibits the production of pro-inflammatory cytokines through inhibition of the NFκB signaling pathway in HMC-1 human mast cells. Mol. Med. Rep. 2013;8:731–736. doi: 10.3892/mmr.2013.1585. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Han K., Jin C., Chen H., Wang P., Yu M., Ding K. Structural characterization and anti-A549 lung cancer cells bioactivity of a polysaccharide from Houttuynia cordata. Int. J. Biol. Macromol. 2018;120:288–296. doi: 10.1016/j.ijbiomac.2018.08.061. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All the data in this paper are available from the corresponding author on request.







