Skip to main content
Biology logoLink to Biology
. 2026 Feb 15;15(4):339. doi: 10.3390/biology15040339

Effects of Harvesting Disturbance on Soil Nematode Diversity and Soil Properties in Ophiocordyceps sinensis Excavation Areas of the Qinghai–Tibet Plateau

Haoxu Tang 1, Bing Jia 1, Chuyu Tang 1, Yan Tong 1, Jinxuan Yan 1, Shengyun Wang 2, Jianzhao Qi 3, Yuling Li 1,*, Xiuzhang Li 1,*
Editor: Maria Amélia Martins-Loução
PMCID: PMC12937672  PMID: 41744648

Simple Summary

Ophiocordyceps sinensis is a valuable medicinal resource distributed in the Qinghai–Tibet Plateau and the adjacent alpine regions, and seasonal excavation poses potential risks to fragile alpine soil ecosystems. As sensitive indicators of soil ecological change, soil nematodes can effectively evaluate such disturbances. This study compared the soil physicochemical properties and nematode diversity in excavated and non-excavated sites across multiple regions. Excavation significantly reduced soil available potassium (p < 0.01), while changes in other nutrients showed strong spatial heterogeneity. Nematode community diversity was generally stable, with only regional declines in evenness (Shannon index decreased from 2.91 to 2.46 in HeN), and more than 70% of nematode genera and species were shared between sites with consistent dominant taxa. Correlation analysis revealed that excavation altered soil–nematode relationships. The positive association between available potassium and nematode diversity was significantly strengthened (p < 0.05), while correlations of soil pH and organic matter with nematode diversity were weakened or shifted. These findings indicate that impacts under current excavation intensity are relatively limited. However, widespread available potassium reduction and localized shifts in soil–nematode relationships imply potential long-term risks, which require attention for the sustainable management of alpine soils.

Keywords: alpine soils, available potassium, community diversity, nutrient dynamics, soil–biota interactions

Abstract

Ophiocordyceps sinensis (O. sinensis) is a valuable medicinal fungus distributed in the Qinghai–Tibet Plateau and adjacent high-altitude regions. Wild excavation has raised increasing concerns about its impact on fragile alpine soil ecosystems. Soil nematodes are sensitive indicators of soil environmental change and can effectively reflect disturbance-induced shifts in soil biotic communities. Understanding the effects of O. sinensis excavation on soil nematode diversity is essential for assessing soil biological health and supporting sustainable management of alpine ecosystems. However, most existing studies are limited to single regions, and few have simultaneously analyzed changes in soil properties, nematode diversity, and soil–nematode relationships across heterogeneous landscapes. The goal of this study was to reveal the impacts of O. sinensis excavation on soil physicochemical properties, nematode diversity and community composition, as well as soil–nematode relationships in typical producing areas, and to assess the ecological risks of current harvesting practices. We investigated five typical O. sinensis-producing regions in Qinghai Province (Henan, Hualong, Maqin, Yushu, Zaduo) and compared excavated and non-excavated sites to evaluate disturbance effects. The results showed strong regional heterogeneity in soil responses to excavation. Soil available potassium (AK) was significantly and consistently lower in all excavated sites (p < 0.01), whereas changes in other soil nutrients varied by region. Nematode α-diversity was generally stable, with a significant decrease in the Shannon index only in Henan (from 2.91 to 2.46). Soil nematode community composition was highly similar between treatments, with more than 70% of shared genera and species remaining largely unchanged and dominant taxa unchanged. Correlation analysis indicated that excavation reshaped soil–nematode relationships, and AK may act as a potential influencing factor associated with nematode diversity in disturbed sites. Overall, under current excavation intensity, the impacts of O. sinensis harvesting on total soil nematode diversity are relatively limited. However, the widespread reduction in AK and localized diversity decline suggest potential long-term ecological risks under intensive or prolonged disturbance.

1. Introduction

Ophiocordyceps sinensis (O. sinensis) is a rare medicinal fungal resource characteristically distributed across the Qinghai–Tibet Plateau and its adjacent alpine meadow and alpine shrubland ecosystems [1]. Its formation depends on a highly specialized parasitic relationship between Ophiocordyceps fungi and lepidopteran larvae, making it particularly sensitive to soil environmental conditions, vegetation types, and the structure of microbial and soil biotic networks [2,3]. As one of the most valued traditional Chinese medicinal materials, O. sinensis is recognized for its pharmacological functions, including nourishing the lung and kidney, enhancing immune function, and alleviating fatigue [4,5,6]. Accordingly, it has long commanded exceptionally high economic value and social demand within both traditional Chinese medicine systems and modern healthcare markets [7,8]. The short supply of wild O. sinensis, coupled with the fact that artificially cultivated products cannot yet replace wild resources on a large scale, has driven intensive excavation activities of this species in alpine regions including Qinghai and Tibet, with such activities characterized by distinct seasonal concentration and spatial expansion [1,9].

Anthropogenic disturbance is a dominant driver of structural reorganization and functional variation in soil ecosystems [10]. Excavation-related activities, including wild harvesting of medicinal organisms and mining, can disrupt soil structure, alter nutrient distribution, and modify microenvironmental conditions, thereby affecting soil biological communities both directly and indirectly through changes in resource availability [11,12,13,14,15]. Distinguishing excavated and non-excavated areas therefore provides an effective framework for assessing soil ecological responses to human disturbance. While non-excavated areas serve as relatively stable ecological references, excavated areas reflect soil environmental and biological responses to anthropogenic impacts [16,17].

As one of the most abundant and functionally critical metazoan groups in soils, nematodes play central roles in soil organic matter decomposition, nutrient cycling and transformation, and the regulation of microbial community structure [18,19]. Because of their high sensitivity and rapid responsiveness to environmental variation, nematode community diversity, composition, and functional attributes have been widely adopted as robust biological indicators of soil ecosystem health and functional stability [20,21,22]. The stability of nematode communities is closely linked to soil physicochemical conditions, particularly nutrient availability, which can drive community reassembly and shifts in dominant taxa [14,23,24,25,26,27].

Some evidence suggests that high-intensity and poorly regulated extraction accelerates the leaching of labile nutrients and the fragmentation of soil aggregates, leading to significant declines in nematode richness and evenness as well as imbalances among functional groups [14,28]. In contrast, other studies report that under low disturbance intensities or region-specific environmental conditions, nematode communities can maintain overall diversity through the stability of core functional taxa, with changes mainly occurring in the relative abundance of dominant groups rather than pronounced diversity loss [13,15]. Despite these advances, current understanding remains fragmented because most studies have focused on single regions or specific disturbance contexts, limiting robust synthesis across heterogeneous environments. Moreover, although the distribution of dominant nematode taxa is known to be closely associated with soil nutrient availability, particularly nitrogen, phosphorus, and potassium [21,24,29], it remains unclear whether extraction disturbance modifies these soil–nematode relationships and how such changes may affect nematode α-diversity.

To this end, soils were collected from excavated and non-excavated sites across five regions, namely Henan (HeN), Hualong (HuaL), Maqin (MaQ), Yushu (YuS), and Zaduo (ZaD). These regions are key harvesting areas of O. sinensis in Qinghai Province and cover the main distribution zones of the species on the Qinghai–Tibet Plateau, with notable variations in elevation among them. Comparative analyses were conducted on soil physicochemical properties, including available nitrogen (AN), phosphorus (AP), and potassium (AK); total nitrogen (TN), phosphorus (TP), and potassium (TK); total organic matter (TOM); and Potential of Hydrogen (pH). In parallel, nematode community α-diversity (Shannon, ACE, and Chao1 indices), community composition at the genus and species levels, and the correlations between soil properties and nematode α-diversity were assessed. This integrated approach sets out to clarify the patterns of soil physicochemical changes caused by excavation activities, how nematode community diversity and composition respond to these changes, and the strength and direction of the relationships between them. In turn, the results offer important theoretical insights into how soil ecosystems are regulated under excavation disturbance, while also providing a scientific basis for developing effective excavation management strategies and protecting soil ecosystem health.

2. Materials and Methods

2.1. Overview of the Study Area

Representative distribution areas of O. sinensis in Qinghai Province, China, were selected for this study, encompassing five regions (HeN, HuaL, MaQ, YuS, and ZaD). These regions are located in the eastern and southern parts of Qinghai Province and are characterized by a typical plateau continental climate, with a mean elevation exceeding 3700 m. The study areas experience cold and arid conditions at elevations above 3700 [1], with annual mean temperatures ranging from −5.6 to 8.6 °C and annual precipitation of 15–750 mm [30,31]. These regions constitute the principal traditional excavation areas of the medicinal fungus O. sinensis in Qinghai Province, with elevations ranging from 3700 m to 4630 m and showing notable variability across sites (Table 1).

Table 1.

Basic overview of the sampling areas.

Sampling Areas Serial Number Longitude and Latitude Elevation/m
Hualong County, Haidong City, Qinghai Province HuaL 36°13′03″ N, 102°19′56″ E 3725
Henan Mongolian Autonomous County, Huangnan Tibetan Autonomous Prefecture, Qinghai Province HeN 34°26′55″ N, 101°30′04″ E 3700
Maqin County, Golog Tibetan Autonomous Prefecture, Qinghai Province MaQ 34°31′49″ N, 100°3′14″ E 4050
Yushu City, Yushu Tibetan Autonomous Prefecture, Qinghai Province YuS 33°1′15″ N, 96°48′22″ E 4350
Zadoi County, Yushu Tibetan Autonomous Prefecture, Qinghai Province ZaD 32°47′47″ N, 95°8′21″ E 4630

Within each region, plots subjected to frequent human excavation disturbance (disturbed plots) and adjacent plots without excavation activities (undisturbed plots) were selected for comparative analysis. The distance between paired plots did not exceed 500 m to minimize variation in environmental factors, including soil type, slope, elevation, and vegetation cover. In each disturbed and undisturbed plot, three fixed quadrats (50 cm × 50 cm) were randomly established, resulting in a total of 30 quadrats (5 regions × 2 treatments × 3 replicates) [32].

2.2. Soil Sampling

Soil sampling took place from 5 June to 25 June 2025. This timing aligned with both the peak growing season of alpine vegetation and the intensive excavation period of O. sinensis, which helps ensure the samples are highly representative. For each quadrat, surface soil samples (5–20 cm depth) were collected using a soil auger, following a five-point sampling method (sampling at the four corners and the center of the quadrat). This depth is where soil nematodes are active and where plant roots are densely distributed, making it relevant for the study’s focus. After collection, the five subsamples from each quadrat were thoroughly mixed to homogenize them, then split into two parts. One part was air-dried and finely ground to analyze soil physicochemical properties, including pH, TN, TP, TK, AN, AP, AK, and TOM. As for the other part, stones and roots were first removed before it was sieved through a 1 mm mesh. The processed sample was then placed into sterile 50 mL centrifuge tubes, immediately frozen in liquid nitrogen, and later stored at −80 °C for subsequent soil nematode community diversity analysis.

2.3. Determination of Soil Physicochemical Properties

AN was determined by the alkaline hydrolysis diffusion method [33]. AP was determined by sodium bicarbonate extraction followed by colorimetric analysis [33] and AK was extracted with 1 mol·L−1 ammonium acetate and measured using flame photometry [33]. TN was determined using the Kjeldahl method [33]. TP was measured by the alkali fusion method [33]. TK was determined by the acid digestion method [33]. Soil pH was measured potentiometrically using a glass electrode in soil suspension following established protocols [34]. TOM was determined by the wet oxidation method (Walkley–Black), as described in prior studies [35].

All analyses were performed in triplicate with appropriate blanks and quality controls to ensure accuracy and reproducibility.

2.4. Soil Nematode Community Diversity Analysis

Genomic DNA was extracted from soil samples using a commercial soil DNA extraction kit (Omega Bio-tek, Norcross, GA, USA), following the manufacturer’s instructions. Before proceeding with downstream analyses, the quality and integrity of the extracted DNA were checked via 1% agarose gel electrophoresis. Subsequently, the target gene regions with the sequencing region NF1F_18Sr2bR were amplified through polymerase chain reaction (PCR), using specific primers with unique barcode sequences for each sample. The primer sequences used were the forward primer NF1F (GGTGGTGCATGGCCGTTCTTAGTT) and the reverse primer 18Sr2bR (TACAAAGGGCAGGGACGTAAT). To ensure data reliability and reduce amplification bias, a low, consistent number of cycles was used for all PCR reactions. Representative samples were initially tested to determine optimal amplification conditions, which were confirmed to be an annealing temperature of 55 °C and a total of 32 cycles.

All PCR reactions were performed in a 20 μL system containing 10 μL of 2× Pro Taq, 0.8 μL of each primer (5 μM), 10 ng/μL of template DNA, and ddH2O to make up the volume. Reactions were run in triplicate for each sample on an ABI GeneAmp® 9700 Thermal Cycler (Applied Biosystems, Foster City, CA, USA) with the thermal cycle program detailed as follows. The procedure included 1 cycle of pre-denaturation at 95 °C for 3 min, 32 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 45 s, a final extension at 72 °C for 10 min, and a holding step at 10 °C until terminated by the user. The resulting products were pooled, and PCR amplicons were verified by 2% agarose gel electrophoresis and subsequently purified using the AxyPrep DNA Gel Extraction Kit (AXYGEN, Union City, CA, USA). The purified PCR products were quantified using the QuantiFluor™-ST Blue Fluorometric Quantitation System from Promega (Madison, WI, USA), and equimolar amounts of amplicons from different samples were mixed to construct the sequencing library.

Sequencing libraries were prepared by adding sequencing adapters to the target fragments through PCR amplification, followed by purification and quality assessment using the TruSeq™ DNA Sample Prep Kit (Illumina, San Diego, CA, USA). The libraries were denatured to generate single-stranded DNA fragments. High-throughput paired-end sequencing was then carried out on an Illumina NextSeq 2000 platform (Illumina, San Diego, CA, USA), according to the manufacturer’s standard protocols.

2.5. Data Processing and Statistical Analysis

One-way analysis of variance was employed to assess the significance of differences in soil physiological and biochemical characteristics, and soil nematode α-diversity indices between excavated and non-excavated sites across different regions. Based on Bray–Curtis dissimilarity, non-metric multidimensional scaling (NMDS) was performed to ordinate and visualize variations in nematode community structure among samples under different treatments. The ACE, Chao1, and Shannon diversity indices of soil nematode communities from excavated and non-excavated sites in different regions were calculated and compared using the Majorbio cloud platform (https://www.majorbio.com/tools, accessed on 15 October 2025), and bar plots showing the relative abundances of nematode communities at the genus and species levels were generated. Furthermore, Origin 2022 software was used to construct Venn diagrams at the genus and species levels and to generate correlation heatmaps between soil nematode α-diversity indices and soil physicochemical properties in excavated and non-excavated sites, thereby revealing differences in the relationships between nematode α-diversity and soil physiological and biochemical characteristics under different treatments.

3. Results

3.1. Effects of Excavation Activities on Soil Physical and Chemical Properties

In this study, soil physicochemical properties were comparatively analyzed between excavation and non-excavation areas across five sampling sites (HuaL, HeN, MaQ, YuS, and ZaD) (Figure 1 and Figure 2). AN content was significantly higher in the excavation area than in the non-excavation area at the HuaL site (p < 0.05), whereas no significant differences were detected between excavation and non-excavation areas at HeN, MaQ, YuS, or ZaD (p > 0.05). In contrast, AK content was consistently and significantly lower in excavation areas than in non-excavation areas across all sites (p < 0.01). AP content was significantly higher in the excavation area at the MaQ site (p < 0.05), while no significant differences were observed at HuaL, HeN, YuS, or ZaD (p > 0.05). Soil pH and TN content showed no significant differences between excavation and non-excavation areas across any of the five sites (p > 0.05). TP content was extremely significantly higher in excavation areas than in non-excavation areas at the HuaL and ZaD sites (p < 0.01), whereas no significant differences were detected at HeN, MaQ, or YuS (p > 0.05). TK content was significantly elevated in the excavation area only at the MaQ site (p < 0.05), with no significant differences at the remaining sites (p > 0.05). TOM content was significantly higher in the excavation area compared with the non-excavation area at the ZaD site (p < 0.05), while no significant differences were detected at HuaL, HeN, MaQ, or YuS (p > 0.05).

Figure 1.

Figure 1

Soil contents of AN, AK, AP and pH in excavation and non-excavation areas across different regions. “*” indicates significant difference (p < 0.05), “**” indicates extremely significant difference (p < 0.01), and “ns” indicates no significant difference (p > 0.05).

Figure 2.

Figure 2

Soil contents of TP, TN, TK and TOM in excavation and non-excavation areas across different regions. “*” indicates significant difference (p < 0.05), “**” indicates extremely significant difference (p < 0.01), and “ns” indicates no significant difference (p > 0.05).

3.2. Nematode Community α-Diversity and β-Diversity

The α-diversity indices of nematode communities are shown in Figure 3. No significant differences in the Shannon index were observed between excavation and non-excavation areas at the HuaL, MaQ, YuS, or ZaD sites (p > 0.05). In contrast, at the HeN site, the Shannon index in the excavation area was significantly lower than that in the non-excavation area (p < 0.05), indicating that the non-excavation area at this site may harbor greater species richness and a more even distribution of individuals. Neither the ACE index nor the complementary Chao1 index showed significant differences between excavation and non-excavation areas at any site (p > 0.05), suggesting that excavation disturbance did not substantially affect overall nematode richness across regions.

Figure 3.

Figure 3

Difference analysis of α-diversity indices of soil nematode communities between extraction and non-extraction areas across different regions. (a) Shannon index; (b) ACE index; (c) Chao1 index. “*” indicates significant difference (p < 0.05), and “ns” indicates no significant difference (p > 0.05).

OTU-based NMDS ordination (stress = 0.226) revealed clear regional clustering of samples in two-dimensional space, accompanied by treatment-related shifts, with the overall pattern being statistically significant (R2 = 0.547, p = 0.001; Figure 4). Notably, excavation and non-excavation areas at certain sites showed a certain degree of separation in ordination space (e.g., there was minimal overlap between the two groups at HeN, though the distance between them was not large; at MaQ, the two groups were relatively distinguishable but not overly distant from each other). In contrast, the two treatment groups at HuaL, ZaD, and YuS displayed varying degrees of overlap, suggesting relatively limited differences in community composition and that diversity showed no significant changes between excavation and non-excavation areas. The HeN and YuS groups showed near-complete overlap, whereas the ZaD groups exhibited a directional shift but still maintained strong aggregation and overlap overall, indicating relatively small compositional differences.

Figure 4.

Figure 4

NMDS Ordination Plot of Nematode Community at OTU Level in Extraction Areas and Non-extraction Areas.

3.3. Nematode Community Composition and Structure

Venn diagram analysis demonstrated that, at the genus level (Figure 5a), 54 genera were detected in excavation areas and 58 genera in non-excavation areas, with 49 genera shared between the two habitats. At the species level (Figure 5b), 72 species were identified in excavation areas and 79 species in non-excavation areas, of which 58 species were shared.

Figure 5.

Figure 5

Venn Diagrams of Soil Nematode Communities between Extraction and Non-extraction Areas at the Genus (a) and Species (b) Levels.

At the genus level, nematode communities in excavation and non-excavation areas exhibited a high degree of compositional similarity. This was strongly supported by the Venn diagram results, which showed that only 5 genera were unique to excavation areas and 9 to non-excavation areas, whereas 49 genera were shared. These shared genera accounted for 90.7% of the total genera in excavation areas and 84.5% in non-excavation areas, indicating that the two habitats share a common core set of genus-level taxa.

This pronounced overlap persisted at the species level. Shared species accounted for 80.6% of the total species in excavation areas and 73.4% in non-excavation areas. Despite a higher total number of species, the proportion of shared species remained high, suggesting that nematode communities in excavation and non-excavation areas maintain a highly similar compositional framework from genus to species level.

Consistent with these findings, the dominant genus composition of nematode communities was largely similar between excavation and non-excavation areas (Figure 6a). Four of the top five dominant genera were shared between the two habitats, namely unclassified_f__Enoplea_X, unclassified_f__Chromadorea_X, Merlinius, and Teratocephalus. This indicates a shared core of dominant taxa. The cumulative relative abundance of the top five genera reached 63.08% in excavation areas and 60.89% in non-excavation areas.

Figure 6.

Figure 6

Distribution of soil nematodes in extraction and non-extraction areas at genus (a) and species (b) levels.

Although minor differences were observed in rank order and relative abundance, for example, unclassified_f__Enoplea_X was more abundant in excavation areas, and Steinernema and Eumonhystera differed between habitats, the overall overlap in dominant genus composition was high and abundance differences were limited.

At the species level, dominant species composition showed even greater similarity between habitats (Figure 6b). All five dominant species were shared, including unclassified_f__Enoplea_X, unclassified_f__Chromadorea_X, Merlinius_joctus, Teratocephalus_lirellus, and Tylencholaimus_sp. The cumulative relative abundance of the top five species exceeded 59% in both habitats. Differences among dominant species were primarily reflected in relative abundance rather than presence or absence, indicating that excavation disturbance exerted only limited effects on the overall structure of dominant species assemblages.

3.4. Shifts in Relationships Between Soil Physicochemical Properties and Nematode α-Diversity Induced by Excavation Disturbance

Correlation analysis (Figure 7) demonstrated pronounced habitat-specific differences in the relationships between soil physicochemical properties and nematode α-diversity indices (ACE, Chao1, Shannon), highlighting the reorganization of soil–nematode interaction networks induced by excavation disturbance. In the excavated area, AK was strongly and highly significantly positively correlated with ACE and Chao1 (p < 0.01) and significantly positively correlated with Shannon (p < 0.05). In contrast, in the non-excavated area, AK was significantly positively associated only with ACE (p < 0.05), while its relationships with Chao1 and Shannon were not significant (p > 0.05). TK showed positive correlations with ACE, Chao1, and Shannon in the excavated area, whereas these relationships shifted to negative correlations in the non-excavated area. In the excavated area, soil pH was negatively associated with ACE, Chao1, and Shannon, with a significant negative correlation observed for Chao1 (p < 0.05). In the non-excavated area, the negative associations between pH and Chao1, and Shannon were markedly weakened. TN and AN were negatively correlated with Chao1 in the excavated area, but these relationships reversed to positive correlations in the non-excavated area. AP was positively correlated with Chao1 in the excavated area, whereas this association became negative in the non-excavated area. TOM was negatively associated with ACE, Chao1, and Shannon in the excavated area. In contrast, TOM was positively correlated with ACE, Chao1, and Shannon in the non-excavated area.

Figure 7.

Figure 7

Heatmap of correlations between α-diversity indices of soil nematode communities and soil physicochemical properties. (a) Excavation area; (b) Non-excavation area. “*” indicates significant difference (p < 0.05), “**” indicates extremely significant difference (p < 0.01).

4. Discussion

4.1. Overall Impact of Excavation on Soil Nematode Community Diversity

The main finding of this study is that excavation activities exert only a limited overall influence on soil nematode community diversity, with significant differences detected solely at a small number of sampling sites and for specific diversity indices. This finding partially supports the hypothesis proposed in the Introduction, which suggested that soil nematode community diversity can be maintained under anthropogenic disturbance owing to their inherent ecological resilience [13,15]. Notably, this relatively weak disturbance signal should also be interpreted in the context of the increasingly stringent conservation and management measures implemented for O. sinensis excavation in Qinghai Province. In recent years, adherence to an ecology-first strategy, together with standardized excavation practices such as mandatory backfilling immediately after excavation, clear delineation of excavation zones and periods, and strict enforcement of excavation permit systems, has effectively curbed disorderly exploitation. These measures may have helped reduce the intensity and spatial extent of soil disturbance, thereby providing a potential management context under which soil biotic community diversity has maintained relative stability within the scope of this study’s observations.

It is important to acknowledge that the sampling design of this study has inherent limitations. Each region and treatment group was only replicated three times, which may be insufficient to account for the high spatial heterogeneity of alpine soils. This limited replication increases the risk of Type II errors, potentially leading to the failure to detect subtle but ecologically meaningful changes in soil properties or nematode communities induced by excavation. Consequently, some non-significant results observed across most regions should be interpreted with caution, as they may reflect inadequate sampling power rather than a true absence of disturbance effects. Future studies should increase the number of replicates to improve statistical robustness and better capture the fine-scale variability of alpine soil ecosystems.

4.2. Responses of α-Diversity and Community Composition to Excavation

α-Diversity analysis revealed a significantly lower Shannon index in excavated plots only at the HeN site (p < 0.05), with no significant differences in ACE or Chao1 indices across all sites (p > 0.05). These results indicate that excavation may not reduce the species richness or evenness of nematode communities, but instead may potentially induce fine-scale community adjustments, primarily by possibly regulating the relative abundance of dominant taxa [13,36]. NMDS ordination further supported that nematode community composition was primarily structured by regional clustering rather than O. sinensis excavation, with substantial overlap between excavated and non-excavated plots at HuaL, YuS, and ZaD, and separation only at HeN and MaQ. This spatially heterogeneous response suggests that the effects of excavation disturbance may not be globally consistent, but rather are likely strongly modulated by local environmental conditions [37]. High taxonomic overlap and consistent dominant taxa reflect core nematode tolerance to O. sinensis excavation. Such tolerance likely stems from core taxa’s adaptive traits, including rapid reproduction, broad ecological niches, and capacity to buffer microhabitat fluctuations [38], which may be further facilitated by regulated O. sinensis excavation practices (e.g., mandatory backfilling), as such measures can help mitigate excessive physical soil disruption under certain conditions [39].

4.3. Shifts in Soil Physicochemical Properties and Their Linkages to Nematode Communities

Soil physicochemical properties represent key abiotic regulators governing soil nematode community diversity, community composition, and functional structure, and their heterogeneity directly shapes the ecological patterns of nematode assemblages [29,36]. Analyses of soil physicochemical properties provide a key abiotic basis for interpreting the biological responses of nematode communities [40,41]. Soil available potassium (AK) was consistently and significantly lower in excavated plots across all sites (p < 0.01), while other nutrients (AN at HuaL, AP and TK at MaQ, TP at HuaL and ZaD, TOM at ZaD) showed region-specific higher concentrations in excavated plots. Soil AK represents the primary potassium pool readily available for plant uptake [42,43,44]. The spatiotemporal variation of soil AK is shaped by agricultural practices and a variety of environmental factors [43,45]. Existing studies indicate that tillage, soil erosion, and water leaching are the main factors leading to declines in soil potassium and AK contents [46]. While mandatory backfilling after O. sinensis excavation can help restore the soil’s surface structure and reduce erosion to some degree [39,47], the localized soil disturbance caused during excavation is still likely enough to speed up potassium loss. Notably, plant uptake may further contribute to AK depletion in excavated areas. Although excavation disturbs surface vegetation and temporarily reduces root density in the surface soil layer, surviving alpine plants (e.g., dominant grasses and sedges in alpine meadows) tend to enhance competitive uptake of available nutrients to cope with post-disturbance stress [48]. As AK is a key macronutrient supporting photosynthetic efficiency and stress resistance [49], these residual plants may prioritize AK acquisition from the already limited soil pool, potentially leading to a further reduction in AK concentration.

More importantly, correlation analyses revealed marked shifts in the relationships between soil physicochemical properties and nematode diversity indices following excavation. In excavated plots, the positive associations between AK and the ACE, Chao1, and Shannon indices were substantially strengthened, suggesting that AK may act as a potentially important factor linked to nematode richness and evenness under disturbed conditions [29]. In non-excavated areas, soil pH showed no significant correlations with the nematode Chao1 or ACE indices, whereas a significant negative correlation between soil pH and the Chao1 index was observed in excavated areas. This indicates that O. sinensis excavation disturbance may alter soil acid base conditions, thereby reshaping the background of nematodes’ response to pH [50].

4.4. Management Implications for Sustainable O. sinensis Exploitation

From a management perspective, these results offer insights into the impacts of O. sinensis excavation. Based on the cross-sectional data collected, excavation at the current intensity may exert a limited overall influence on soil physicochemical properties and nematode diversity. This is observed when excavation is conducted under an ecology-first framework and standardized regulatory system. Based on the cross-sectional observations of this study, the implementation of targeted measures including controlled excavation zones, seasonal restrictions, permit-based access, and immediate backfilling may potentially help mitigate disturbances to soil physicochemical properties [39,47]. In the short term, these practices may also support the maintenance of nematode diversity [39,47]. That said, localized drops in diversity (such as at the HeN site) and the widespread decline in AK still emphasize how important it is to conduct region-specific vulnerability assessments. Long-term or intensified excavation could potentially degrade soil fertility, erode ecosystem resilience, and induce subtle shifts in nematode functional roles [13,17]. However, these cumulative ecological impacts remain unconfirmed due to insufficient temporal monitoring. This further underscores the necessity of integrating long-term tracking into management practices [13,17]. For managing O. sinensis extraction, targeted strategies could include further limiting excavation intensity in ecologically sensitive areas, enhancing post-excavation soil restoration efforts, and prioritizing nutrient management with a particular focus on potassium conservation to boost soil resilience [7,32]. These approaches would not only support the sustainable use of O. sinensis resources, but also help maintain long-term soil physicochemical stability, protect biodiversity, and preserve key ecosystem functions in alpine grassland systems.

5. Conclusions

This study aimed to assess how excavation disturbance impacts alpine soil ecosystems. We compared soil physicochemical properties and nematode diversity across five representative O. sinensis distribution regions in Qinghai Province. The comparison focused on paired excavated and non-excavated plots in each region. Under current excavation intensity and standardized management, excavation exerts generally mild effects on soil nematode diversity.α-diversity remains largely unaltered across most regions, with over 70% taxonomic overlap at genus and species levels, and minimal differences in dominant taxa. In contrast, most soil physicochemical properties exhibit significant differences only in individual regions. Most notably, AK is consistently and significantly reduced in all excavated plots, which may serve as a potential associated factor related to nematode diversity in disturbed areas. While existing ecologically prioritized excavation practices may have helped maintain relative nematode diversity within this study’s scope, pervasive AK loss and localized diversity declines (e.g., HeN site) warrant attention as potential early warning signals. Long-term or intensified excavation could potentially degrade soil fertility and erode ecosystem resilience, but these outcomes remain unconfirmed due to insufficient temporal monitoring. These findings highlight the need for targeted management adjustments, including post-excavation potassium supplementation, restricted excavation in sensitive zones, and long-term monitoring of soil nutrients and nematode communities, to better assess unquantified cumulative degradation risks.

Abbreviations

The following abbreviations are used in this manuscript:

O. sinensis Ophiocordyps sinensis
HuaL Hualong
HeN Henan
MaQ Maqin
YuS Yushu
ZaD Zaduo
AK available potassium
AP available phosphorus
TP total phosphorus
TK total potassium
TOM total organic matter
AN available nitrogen
TN total nitrogen
pH Potential of Hydrogen
NMDS non-metric multidimensional scaling

Author Contributions

Conceptualization, H.T. and X.L.; methodology, X.L. and Y.L.; software, B.J., J.Y. and C.T.; validation, H.T., B.J. and J.Y.; formal analysis, H.T., Y.T., Y.L. and X.L.; investigation, H.T., C.T., S.W., X.L. and Y.L.; resources, X.L., C.T., H.T., B.J. and S.W.; data curation, H.T.; writing—original draft preparation, H.T.; writing—review and editing, C.T., X.L., Y.T. and J.Q.; project administration, X.L. and Y.L.; funding acquisition, X.L., Y.L. and J.Q. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This research was funded by the Chinese Academy of Sciences-People’s Government of Qinghai Province on Sanjiangyuan National Park (LHZX-2022-01); Wild Ophiocordyceps sinensis Identification and Application Project (QHRD-2025-004); Process Optimization and Application of Antioxidant Performance of Yushu Cordyceps sinensis Extract (2025-NK-P45), the Shaanxi Key Laboratory of Natural Product & Chemical Biology Open Foundation (SXNPCB 2024003).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Wei Y., Zhang L., Wang J., Wang W., Niyati N., Guo Y., Wang X. Chinese caterpillar fungus (Ophiocordyceps sinensis) in China: Current distribution, trading, and futures under climate change and overexploitation. Sci. Total Environ. 2021;755:142548. doi: 10.1016/j.scitotenv.2020.142548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wang Q., Wang Y., Li T., Bao X., He L., Liu L., Liu S., Bai J., Zhang H., Niu S., et al. The interplay between the formation of Chinese cordyceps and the characteristics of soil properties and microbial network. Microbiol. Spectr. 2025;13:e0327724. doi: 10.1128/spectrum.03277-24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Li N., Li J., Feng Z., Wu Z., Gao Q., Wang J., Zhang Y., Chen S.L., Xing R. Culture-dependent and -independent analyses reveal unique community structure and function in the external mycelial cortices of Ophiocordyceps sinensis. BMC Microbiol. 2025;25:78. doi: 10.1186/s12866-025-03793-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Suo K.-K., Li X., Liu X., Zhu J.-Q., Shi Y.-L., Yi J.-J., Lu J.-K. From environment to environmental adaptation: Environmental perspectives on the study of food and medicine homology. Food Med. Homol. 2026;3:9420082. doi: 10.26599/FMH.2026.9420082. [DOI] [Google Scholar]
  • 5.Das G., Shin H.S., Leyva-Gómez G., Prado-Audelo M.L.D., Cortes H., Singh Y.D., Panda M.K., Mishra A.P., Nigam M., Saklani S., et al. Cordyceps spp.: A Review on Its Immune-Stimulatory and Other Biological Potentials. Front. Pharmacol. 2020;11:602364. doi: 10.3389/fphar.2020.602364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Shashidhar M.G., Giridhar P., Udaya Sankar K., Manohar B. Bioactive principles from Cordyceps sinensis: A potent food supplement—A review. J. Funct. Foods. 2013;5:1013–1030. doi: 10.1016/j.jff.2013.04.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.He Z., Ye M., Wu H., Liang D., Huan J., Yao Y., Wu X., Luo X. The Conservation Crisis of Ophiocordyceps sinensis: Strategies, Challenges, and Sustainable Future of Artificial Cultivation. J. Fungi. 2025;11:892. doi: 10.3390/jof11120892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chen L., Teng H., Chen S., Zhou Y., Wan D., Shi Z. Future Habitat Shifts and Economic Implications for Ophiocordyceps sinensis Under Climate Change. Ecol. Evol. 2025;15:e71327. doi: 10.1002/ece3.71327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Tang H., Jia B., Tang C., Feng C., Li Y., Li X. Analysis of Amino Acid and Derivative Diversity and Antioxidant Capacity in Ophiocordyceps sinensis and Its Substitutes. J. Fungi. 2025;11:711. doi: 10.3390/jof11100711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Li H., Qiu Y., Yao T., Han D., Gao Y., Zhang J., Ma Y., Zhang H., Yang X. Nutrients available in the soil regulate the changes of soil microbial community alongside degradation of alpine meadows in the northeast of the Qinghai-Tibet Plateau. Sci. Total Environ. 2021;792:148363. doi: 10.1016/j.scitotenv.2021.148363. [DOI] [PubMed] [Google Scholar]
  • 11.Ramos M.B., Maciel M.G.R., Cunha S.S.d., de Souza S.M., Pedrosa K.M., de Souza J.J.L.L., González E.J., Meave J.A., Lopes S.d.F. The role of chronic anthropogenic disturbances in plant community assembly along a water availability gradient in Brazil’s semiarid Caatinga region. For. Ecol. Manag. 2023;538:120980. doi: 10.1016/j.foreco.2023.120980. [DOI] [Google Scholar]
  • 12.Luo C., Guo X., Feng C., Xiao C. Soil seed bank responses to anthropogenic disturbances and its vegetation restoration potential in the arid mining area. Ecol. Indic. 2023;154:110549. doi: 10.1016/j.ecolind.2023.110549. [DOI] [Google Scholar]
  • 13.Pothula S.K., Phillips G., Bernard E.C. Increasing Levels of Physical Disturbance Affect Soil Nematode Community Composition in a Previously Undisturbed Ecosystem. J. Nematol. 2022;54:20220022. doi: 10.2478/jofnem-2022-0022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Li L., Luo Z., Nian L., Li L., Niu Y., Prasath B.B., Haider F.U., Zhang Y., He R., Liu J. Response of soil nematode community structure and metabolic footprint to nitrogen addition in alfalfa fields on the Loess Plateau. Sci. Rep. 2024;14:17640. doi: 10.1038/s41598-024-68393-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Lazarova S., Coyne D., Rodríguez M.G., Peteira B., Ciancio A. Functional Diversity of Soil Nematodes in Relation to the Impact of Agriculture—A Review. Diversity. 2021;13:64. doi: 10.3390/d13020064. [DOI] [Google Scholar]
  • 16.Gamage L.K.H., Das S., Stephenson M., Acharya U., Daigh A.L.M., Maharjan B. Soil health assessment across paired cropland and reference sites under diverse edaphic and climatic conditions. Agrosyst. Geosci. Environ. 2025;8:e70233. doi: 10.1002/agg2.70233. [DOI] [Google Scholar]
  • 17.Feng Y., Wang J., Bai Z., Reading L. Effects of surface coal mining and land reclamation on soil properties: A review. Earth-Sci. Rev. 2019;191:12–25. doi: 10.1016/j.earscirev.2019.02.015. [DOI] [Google Scholar]
  • 18.Gebremikael M.T., Steel H., Buchan D., Bert W., De Neve S. Nematodes enhance plant growth and nutrient uptake under C and N-rich conditions. Sci. Rep. 2016;6:32862. doi: 10.1038/srep32862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ferris H. Contribution of nematodes to the structure and function of the soil food web. J. Nematol. 2010;42:63–67. [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhang C., Wright I.J., Nielsen U.N., Geisen S., Liu M. Linking nematodes and ecosystem function: A trait-based framework. Trends Ecol. Evol. 2024;39:644–653. doi: 10.1016/j.tree.2024.02.002. [DOI] [PubMed] [Google Scholar]
  • 21.Du Preez G., Daneel M., De Goede R., Du Toit M.J., Ferris H., Fourie H., Geisen S., Kakouli-Duarte T., Korthals G., Sánchez-Moreno S., et al. Nematode-based indices in soil ecology: Application, utility, and future directions. Soil Biol. Biochem. 2022;169:108640. doi: 10.1016/j.soilbio.2022.108640. [DOI] [Google Scholar]
  • 22.Martin T., Wade J., Singh P., Sprunger C.D. The integration of nematode communities into the soil biological health framework by factor analysis. Ecol. Indic. 2022;136:108676. doi: 10.1016/j.ecolind.2022.108676. [DOI] [Google Scholar]
  • 23.Bongers T., Ferris H. Nematode community structure as a bioindicator in environmental monitoring. Trends Ecol. Evol. 1999;14:224–228. doi: 10.1016/S0169-5347(98)01583-3. [DOI] [PubMed] [Google Scholar]
  • 24.Zhang Z.-W., Li Q., Hu Y.-Y., Wei H.-W., Hou S.-L., Yin J.-X., Lü X.-T. Nitrogen and phosphorus additions interactively affected composition and carbon budget of soil nematode community in a temperate steppe. Plant Soil. 2022;473:109–121. doi: 10.1007/s11104-021-05145-y. [DOI] [Google Scholar]
  • 25.Wang X., Xiao S., Yang X., Liu Z., Zhou X., Du G., Zhang L., Guo A., Chen S., Nielsen U.N. Dominant plant species influence nematode richness by moderating understory diversity and microbial assemblages. Soil Biol. Biochem. 2019;137:107566. doi: 10.1016/j.soilbio.2019.107566. [DOI] [Google Scholar]
  • 26.Graham E.B., Averill C., Bond-Lamberty B., Knelman J.E., Krause S., Peralta A.L., Shade A., Smith A.P., Cheng S.J., Fanin N., et al. Toward a Generalizable Framework of Disturbance Ecology Through Crowdsourced Science. Front. Ecol. Evol. 2021;9:588940. doi: 10.3389/fevo.2021.588940. [DOI] [Google Scholar]
  • 27.Gaiser E.E., Bell D.M., Castorani M.C.N., Childers D.L., Groffman P.M., Jackson C.R., Kominoski J.S., Peters D.P.C., Pickett S.T.A., Ripplinger J., et al. Long-Term Ecological Research and Evolving Frameworks of Disturbance Ecology. Bioscience. 2020;70:141–156. doi: 10.1093/biosci/biz162. [DOI] [Google Scholar]
  • 28.Bongiorno G., Bodenhausen N., Bünemann E.K., Brussaard L., Geisen S., Mäder P., Quist C.W., Walser J.C., de Goede R.G.M. Reduced tillage, but not organic matter input, increased nematode diversity and food web stability in European long-term field experiments. Mol. Ecol. 2019;28:4987–5005. doi: 10.1111/mec.15270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Chen J., Zhang Y., Liu C., Huang L. Distribution pattern of soil nematode communities along an elevational gradient in arid and semi-arid mountains of Northwest China. Front. Plant Sci. 2024;15:1466079. doi: 10.3389/fpls.2024.1466079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Chen Y., Chen Z., Li X., Malik K., Li C. Metagenomic Analysis: Alterations of Soil Microbial Community and Function due to the Disturbance of Collecting Cordyceps sinensis. Int. J. Mol. Sci. 2024;25:10961. doi: 10.3390/ijms252010961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zhang F.-X., Yang L.-H., Wang C.-J., Zhang C.-H., Wan J.-Z. Distribution and Conservation of Plants in the Northeastern Qinghai–Tibet Plateau under Climate Change. Diversity. 2022;14:956. doi: 10.3390/d14110956. [DOI] [Google Scholar]
  • 32.Yang X., Feng Q., Zhu M., Zhang J., Yang L., Zhang C., Wang Z., Feng Y. Vegetation communities and soil properties along the restoration process of the Jinqianghe mine site in the Qilian Mountains, China. Front. Plant Sci. 2024;15:1358309. doi: 10.3389/fpls.2024.1358309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Chen J., Li X., Xu C., Liang J., Tang C., Wang T., He H., Cao Z., Li Y. Soil Ecological Stoichiometry in the Excavated and Non-excavated Areas of Chinese Cordyceps in Qinghai Province. Acta Agrestia Sin. 2023;31:1134–1142. (In Chinese) [Google Scholar]
  • 34.Merl T., Rasmussen M.R., Koch L.R., Søndergaard J.V., Bust F.F., Koren K. Measuring soil pH at in situ like conditions using optical pH sensors (pH-optodes) Soil Biol. Biochem. 2022;175:108862. doi: 10.1016/j.soilbio.2022.108862. [DOI] [Google Scholar]
  • 35.Kanagaraj A., Kaliappan S.B., Shanmugam T., Alagirisamy B., Ramalingam K. Quantification techniques of soil organic carbon: An appraisal. Anal. Sci. 2025;41:759–776. doi: 10.1007/s44211-025-00746-4. [DOI] [PubMed] [Google Scholar]
  • 36.Arseneault H., Lynch D.H., Nyiraneza J., Stiles K., Mills A., Fraser T. Soil nematode communities differ across long-term land-use intensities in relation to soil physical, chemical, and biological parameters. Can. J. Soil Sci. 2024;104:482–495. doi: 10.1139/cjss-2024-0017. [DOI] [Google Scholar]
  • 37.Kong W., Eisenhauer N., Peñuelas J., Qiu L., Gou X., Song Y., Jiao J., Jia X., Wang X., Shao M., et al. Climate and soil pH modulate global negative effects of nitrogen enrichment on soil nematodes. Soil Biol. Biochem. 2025;208:109860. doi: 10.1016/j.soilbio.2025.109860. [DOI] [Google Scholar]
  • 38.Ferris H., Bongers T., de Goede R.G.M. A framework for soil food web diagnostics: Extension of the nematode faunal analysis concept. Appl. Soil Ecol. 2001;18:13–29. doi: 10.1016/S0929-1393(01)00152-4. [DOI] [Google Scholar]
  • 39.Hartmann M., Six J. Soil structure and microbiome functions in agroecosystems. Nat. Rev. Earth Environ. 2023;4:4–18. doi: 10.1038/s43017-022-00366-w. [DOI] [Google Scholar]
  • 40.Pang S., Hua B., Yang W., Zhang S., Guan Y., Bai K., Fadda C., Mao R., Zhang Y., Zhang X. Soil properties override climatic factors to shape soil nematode diversity in the eastern forest transect of China. Glob. Ecol. Conserv. 2024;54:e03061. doi: 10.1016/j.gecco.2024.e03061. [DOI] [Google Scholar]
  • 41.Yin H., Su Y., Zeng J., Li X., Fan C., Lu J.-Z., Zhou Z., Yu A., Wang S., Scheu S., et al. Forest gap regulates soil nematode community through understory plant diversity and soil pH. Geoderma. 2024;451:117086. doi: 10.1016/j.geoderma.2024.117086. [DOI] [Google Scholar]
  • 42.Bilias F., Barbayiannis N. Potassium availability: An approach using thermodynamic parameters derived from quantity-intensity relationships. Geoderma. 2019;338:355–364. doi: 10.1016/j.geoderma.2018.12.026. [DOI] [Google Scholar]
  • 43.Cheng J., Chen D., Chen X., Mao Y., Li A., Zhu K., Yu Y., Tan W., Li B., Zhao B., et al. Divergent responses of cropland soil available potassium to fertilization across the Sichuan Basin of China. Soil Tillage Res. 2025;253:106654. doi: 10.1016/j.still.2025.106654. [DOI] [Google Scholar]
  • 44.Basak B.B., Biswas D.R. Influence of potassium solubilizing microorganism (Bacillus mucilaginosus) and waste mica on potassium uptake dynamics by sudan grass (Sorghum vulgare Pers.) grown under two Alfisols. Plant Soil. 2009;317:235–255. doi: 10.1007/s11104-008-9805-z. [DOI] [Google Scholar]
  • 45.Blanchet G., Libohova Z., Joost S., Rossier N., Schneider A., Jeangros B., Sinaj S. Spatial variability of potassium in agricultural soils of the canton of Fribourg, Switzerland. Geoderma. 2017;290:107–121. doi: 10.1016/j.geoderma.2016.12.002. [DOI] [Google Scholar]
  • 46.Zhang M., Liang G., Ren S., Li L., Li C., Li Y., Yu X., Yin Y., Liu T., Liu X. Responses of soil microbial community structure, potential ecological functions, and soil physicochemical properties to different cultivation patterns in cucumber. Geoderma. 2023;429:116237. doi: 10.1016/j.geoderma.2022.116237. [DOI] [Google Scholar]
  • 47.Antoneli V., Bednarz J.A., Thomaz E.L. Tobacco harvest phase is critical to runoff and soil loss in conventional tillage system. Soil Use Manag. 2023;39:249–259. doi: 10.1111/sum.12824. [DOI] [Google Scholar]
  • 48.Zhu D., Chen X., Liu J. Response characteristics of soil enzyme activities to disturbance intensities in Phoebe bournei forests. J. For. Environ. 2025;46:1–8. doi: 10.13324/j.cnki.jfcf.202507009. (In Chinese) [DOI] [Google Scholar]
  • 49.Sun C., Xu L., Ullah A., Liu X., Sun J., Jiang D., Tian Z., Dai T. Drought priming combined with additional potassium application enhances wheat tolerance to post-anthesis drought via osmotic adjustment and leaf hydraulic conductance. Plant Physiol. Biochem. 2025;227:109984. doi: 10.1016/j.plaphy.2025.109984. [DOI] [PubMed] [Google Scholar]
  • 50.Yenesew S., Abate A., Teklay A., Bayabil H.K. Effect of land use change and soil depth on physico-chemical soil properties in Fagita Lekoma district, Northwestern Ethiopia. Discov. Soil. 2025;2:79. doi: 10.1007/s44378-025-00106-8. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.


Articles from Biology are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES