Protocol for chromatin immunoprecipitation using isolated antheridia of Marchantia polymorpha

Summary

Chromatin immunoprecipitation (ChIP) is a fundamental technique used to investigate the binding sites of transcription factors (TFs) and histone modifications throughout the genome. Here, we present the ChIP protocol using the model bryophyte Marchantia polymorpha. We describe steps for collecting antheridia, the ChIP procedure, and validating binding sites of TFs by ChIP-qPCR. This protocol, with modifications, can be applied to ChIP and its associated techniques for other TFs or DNA-binding proteins in other tissues of M. polymorpha.

Graphical abstract

Highlights

• •Instructions for collecting antheridia of Marchantia polymorpha
• •Steps for nuclei isolation and chromatin immunoprecipitation using isolated antheridia
• •Guidance on evaluation of signal enrichment on specific target regions by qPCR

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Chromatin immunoprecipitation (ChIP) is a fundamental technique used to investigate the binding sites of transcription factors (TFs) and histone modifications throughout the genome. Here, we present the ChIP protocol using the model bryophyte Marchantia polymorpha. We describe steps for collecting antheridia, the ChIP procedure, and validating binding sites of TFs by ChIP-qPCR. This protocol, with modifications, can be applied to ChIP and its associated techniques for other TFs or DNA-binding proteins in other tissues of M. polymorpha.

Before you begin

The protocol below describes the ChIP assay using antheridia (male reproductive organs) of M. polymorpha and the ChIP-qPCR analysis to investigate the TF binding sites on the target locus. The liverwort M. polymorpha is an excellent model system for evolutionary developmental (evo-devo) studies, particularly for investigating sexual reproduction,¹ owing to its basal phylogenetic position and the availability of robust molecular genetic tools.² We usually use fluorescent protein knock-in plants for ChIP assays to investigate genome-wide TF binding sites in cells where the target TF is endogenously expressed, while transgenic plants that ectopically express epitope-tagged proteins can be used. Although the protocol below is optimized for antheridia which have densely packed cells, it can be easily applicable for other cell-dense materials, such as sporelings and young plants developing from gemmae.

Innovation

Despite the significance of ChIP techniques in molecular biology, ChIP in plants remains challenging except for Arabidopsis.^3,4 The difficulties in using plant materials can be attributed to several factors. Approximately 10⁸ cells are generally required for ChIP, but obtaining large numbers of target cells is difficult due to the low numbers of target cells within the tissues.⁵ In addition, various contaminants, such as chloroplast genomes and polysaccharides, have inhibitory effects on ChIP. For these reasons, even in Arabidopsis, ChIP is often performed by using transgenic plants which ectopically over-express epitope-tagged proteins.^6,7,8 However, ChIP using ectopic expression lines can generate considerable artifacts due to the difference of chromatin states from those of the authentic cell types. Recently, the methods called chromatin immunocleavage, such as CUT&RUN⁹ and CUT&Tag,¹⁰ and chromatin integration labelling¹¹ have been developed to analyze genome-wide protein-DNA interactions using minimal starting materials. However, these methods are not easy to perform and require high cost for subsequent sequencing. Hence, conventional ChIP, which allows PCR-based analysis, remains useful.

This protocol using antheridia of M. polymorpha¹² as the experimental material overcomes the above-mentioned difficulties, because they can be easily dissected out and contain more than 10⁵ cells of the same developmental stage. By using a fluorescent protein knock-in plant,¹³ we efficiently enriched target cells and succeeded in examining TF binding sites in the native chromatin with a high signal-to-noise ratio. It is a powerful tool to elucidate the transcriptional networks in male gametogenesis and can be applicable to other plant materials.

Preparation of control plants

Timing: Variable

• 1.Setting of a genetic control.

Note: If using plants expressing an epitope-tagged protein and antibodies for the epitope tag, the use of a non-transformed parental line for small peptide tags or plants expressing only epitope tags for large protein tags is recommended as negative controls. In this protocol, we use the Citrine knock-in plant (MpDUO1-Citrine^ki) as the experimental sample and the plant expressing mCitrine fused to a nuclear localization signal (NLS) under the control of the MpDUO1 promoter (_proMpDUO1:mCitrine-NLS) as the negative control sample. If using wild-type plants and specific antibodies against the proteins of interest (POI), the use of null mutant plants, ideally large deletion mutants, is highly recommended as negative controls. Using genetic negative controls is more appropriate than using pre-immune IgG as a negative control, because both the experimental and control samples are subjected to identical treatments.

Primer design for ChIP-qPCR

Timing: 1–2 h

• 2.Design of qPCR primers.

Note: Design primers for the region to be verified. Primers for the target sequences should be designed with careful consideration of thermodynamic parameters to ensure high amplification efficiency and specificity. The primary criteria included a primer length of 18–25 nucleotides, a melting temperature (Tm) between 60°C and 64°C, a GC content of 40–60%, and a product size of approximately 100–200 bp. We highly recommend designing all primers with similar Tm values to allow multiple target regions to be analyzed simultaneously under the same thermal cycling conditions. To minimize the formation of secondary structures, such as hairpins and primer-dimers, we recommend using online computational tools, including NCBI Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?GROUP_TARGET=on), Primer3Plus (https://www.primer3plus.com/index.html), and IDT OligoAnalyzer (https://sg.idtdna.com/pages/tools/oligoanalyzer). If binding sites of the POI can be inferred from the presence of cis-regulatory elements or based on results of other experiments, it is advisable to design primers for regions including those sites. However, if such information is not available for the POI, we recommend designing primers near the transcription start site (TSS), as most TFs bind within a ±1 kb of the TSS.¹⁴ Additionally, design primers for the gene body or 3′-terminal region of the target genes as a negative control region of the same locus. For the negative control locus, design primers for genes unlikely to be bound by the POI. If no such information is available for the POI, “housekeeping” genes are candidates for negative control loci.

• 3.Validation of qPCR primers.

Note: Verify the PCR efficiency and specificity of the designed primers using genomic DNA. Since DNA samples for ChIP are typically in a tiny amount, create a template dilution series and confirm specific amplification, even with low template amounts.

CRITICAL: Promoter sequences near the TSS tend to be difficult to amplify because of the high GC content or low sequence complexity. We highly recommend performing qPCR with initial denaturation at 98°C for 2 min and cycle denaturation at 98°C for 10 s to fully denature the template.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit polyclonal anti-GFP (1:100)	MBL	Cat#598; RRID:AB_591819
Chemicals, peptides, and recombinant proteins
Pierce 16% Formaldehyde (w/v), Methanol-free	Thermo Fisher Scientific	Cat#28906
Phosphate Buffered Saline(10×) (pH 7.4)	NACALAI TESQUE, INC.	Cat#27575-31
Glycine	NACALAI TESQUE, INC.	Cat#09591-55
MOPS	NACALAI TESQUE, INC.	Cat#23438-35
Magnesium Chloride Hexahydrate	NACALAI TESQUE, INC.	Cat#20909-55
Sucrose	NACALAI TESQUE, INC.	Cat#09589-05
Dextran 40, MW ca 40,000	NACALAI TESQUE, INC.	Cat#B997
Ficoll PM 400	Sigma-Aldrich	Cat#F4375
2-Mercaptoethanol	NACALAI TESQUE, INC.	Cat#21438-82
cOmplete EDTA-free Protease Inhibitor Cocktail	Sigma-Aldrich	Cat#04693124001
Triton X-100	NACALAI TESQUE, INC.	Cat#12968-35
Tris(hydroxymethyl)aminomethane	NACALAI TESQUE, INC.	Cat#35406-75
EDTA	NACALAI TESQUE, INC.	Cat#15105-35
Sodium Lauryl Sulfate	NACALAI TESQUE, INC.	Cat#08933-05
Sodium Chloride	NACALAI TESQUE, INC.	Cat#31319-45
Lithium Chloride, Anhydrous	NACALAI TESQUE, INC.	Cat#20645-05
Deoxycholic Acid Sodium Salt Monohydrate	NACALAI TESQUE, INC.	Cat#02889-72
IGEPAL CA-630	Sigma-Aldrich	Cat#I8896
Sodium Hydrogen Carbonate	NACALAI TESQUE, INC.	Cat#08932-15
Dynabeads Protein G	VERITAS	Cat#DB10003
RNase A, DNase and protease-free (10 mg/mL)	Thermo Fisher Scientific	Cat#EN0531
Proteinase K (Lyophilized)	Promega	Cat#V3021
SYBR Gold Nucleic Acid Gel Stain	Thermo Fisher Scientific	Cat#S11494
Critical commercial assays
HiYield Gel/PCR DNA Fragments Extraction Kit	RBC Bioscience	Cat#YDF300
ChIP DNA Clean & Concentrator	ZYMO RESEARCH	Cat#D5201
KOD SYBR qPCR Mix	TOYOBO	Cat#QKD-201
Experimental models: Organisms/strains
MpDUO1-Citrineki	Higo et al (2018)13	N/A
proMpDUO1:mCitrine-NLS	This paper	N/A
Oligonucleotides
TUA5 region a Forward: GGAAGGTATATGTGGGGAGTCAAC Reverse: ACCTCCGGCCTCATACTACC	This paper	N/A
TUA5 region b Forward: TGCAATCTCATCCTCCGCTACC Reverse: CCATGTAGGGTAGTGGGTGGTC	This paper	N/A
TUB4 region a Forward: GGATACGGAAGGAAGTAACTGC Reverse: GTTTCAGACTGGGCTCTCACTC	This paper	N/A
TUB4 region b Forward: CGACGAGGAGGGAGAGTTTGAG Reverse: ATAAAGTCCGACCCCACCGTTG	This paper	N/A
TUA3 region a Forward: TCTGAGTGGAGCAAAGAAGGTG Reverse: TCCCTCGGATGAAACTTCTGTC	This paper	N/A
TUA3 region b Forward: TCTGTAGGAATCGGCGAGTGTG Reverse: GAGATTCCCGGTGATCAGATGC	This paper	N/A
Other
S220 Focused-ultrasonicator	Covaris	Cat#500217
Holder microTUBE	Covaris	Cat#500114
microTUBE AFA Fiber Pre-Slit Snap-Cap 6 × 16 mm	Covaris	Cat#520045
DNA LoBind Tubes 1.5 mL	Eppendorf	Cat#0030108051
MagnaStand	FastGene	Cat#FG-SSMAG1.5
CFX96 Real-Time PCR System	Bio-Rad	Cat#1845096

Materials and equipment

Fixing solution

Reagent	Final concentration	Amount
10×PBS	1×	80 μL
Pierce 16% Formaldehyde (w/v), Methanol-free	1%	50 μL
ddH2O	N/A	To 800 μL
Total	N/A	800 μL

Note: Prepare fresh for each experiment.

CRITICAL: Formaldehyde is harmful. Wear personal protective equipment and use it under a chemical hood.

Quenching solution

Reagent	Final concentration	Amount
10×PBS	1×	80 μL
2 M Glycine	125 mM	50 μL
ddH2O	N/A	To 800 μL
Total	N/A	800 μL

Note: Prepare fresh for each experiment.

Nuclei extraction buffer

Reagent	Final concentration	Amount
1 M MOPS-KOH pH7.6	100 mM	1 mL
2 M MgCl2	10 mM	50 μL
2 M Sucrose	250 mM	1.25 mL
Dextran 40	5%	500 mg
Ficoll 400	2.5%	250 mg
2-Mercaptoethanol	0.3%	30 μL
cOmplete EDTA-free Protease Inhibitor Cocktail	1×	N/A
ddH2O	N/A	To 10 mL
Total	N/A	10 mL

Note: Filter and store at 4°C for up to 1 month. 2-Mercaptoethanol and cOmplete EDTA-free Protease Inhibitor Cocktail should be freshly added to the buffer immediately before use.

CRITICAL: 2-Mercaptoethanol is harmful. Wear personal protective equipment and use it under a chemical hood.

Nuclei wash buffer

Reagent	Final concentration	Amount
Nuclei Extraction Buffer	N/A	4.9 mL
10% Triton X-100	0.2%	100 μL
Total	N/A	5 mL

Note: Prepare fresh for each experiment.

Nuclei lysis buffer

Reagent	Final concentration	Amount
1 M Tris-HCl pH8.0	20 mM	20 μL
0.5 M EDTA	10 mM	20 μL
10% SDS	1%	100 μL
cOmplete EDTA-free Protease Inhibitor Cocktail	1×	N/A
ddH2O	N/A	To 1 mL
Total	N/A	1 mL

Note: Prepare fresh for each experiment.

ChIP dilution buffer without Triton

Reagent	Final concentration	Amount
1 M Tris-HCl pH8.0	16.7 mM	167 μL
5 M NaCl	167 mM	333 μL
0.5 M EDTA	1.2 mM	24 μL
10% SDS	0.01%	10 μL
ddH2O	N/A	To 10 mL
Total	N/A	10 mL

Note: Store at 4°C for up to 1 month.

ChIP dilution buffer

Reagent	Final concentration	Amount
1 M Tris-HCl pH8.0	16.7 mM	167 μL
5 M NaCl	167 mM	333 μL
0.5 M EDTA	1.2 mM	24 μL
10% Triton X-100	1.1%	1.1 mL
10% SDS	0.01%	10 μL
ddH2O	N/A	To 10 mL
Total	N/A	10 mL

Note: Store at 4°C for up to 1 month.

Low salt wash buffer

Reagent	Final concentration	Amount
1 M Tris-HCl pH8.0	20 mM	200 μL
5 M NaCl	150 mM	300 μL
0.5 M EDTA	2 mM	40 μL
10% Triton X-100	1%	1 mL
10% SDS	0.1%	100 μL
ddH2O	N/A	To 10 mL
Total	N/A	10 mL

Note: Store at 4°C for up to 1 month.

High salt wash buffer

Reagent	Final concentration	Amount
1 M Tris-HCl pH8.0	20 mM	200 μL
5 M NaCl	500 mM	1 mL
0.5 M EDTA	2 mM	40 μL
10% Triton X-100	1%	1 mL
10% SDS	0.1%	100 μL
ddH2O	N/A	To 10 mL
Total	N/A	10 mL

Note: Store at 4°C for up to 1 month.

LiCl wash buffer

Reagent	Final concentration	Amount
1 M Tris-HCl pH8.0	10 mM	100 μL
5 M LiCl	250 mM	500 μL
0.5 M EDTA	1 mM	20 μL
10% Sodium Deoxycholate	1%	1 mL
10% IGEPAL-CA630	1%	1 mL
ddH2O	N/A	To 10 mL
Total	N/A	10 mL

Note: Store at 4°C for up to 1 month.

ChIP elution buffer

Reagent	Final concentration	Amount
NaHCO3	0.1 M	84 mg
10% SDS	1%	1 mL
ddH2O	N/A	To 10 mL
Total	N/A	10 mL

Note: Prepare fresh for each experiment.

Reverse crosslink buffer

Reagent	Final concentration	Amount
1 M Tris-HCl pH8.0	400 mM	400 μL
5 M NaCl	2 M	400 μL
0.5 M EDTA	100 mM	200 μL
Total	N/A	1 mL

Note: Prepare fresh for each experiment.

Step-by-step method details

Collecting antheridia and cross-linking

Timing: 3 h

This section describes how to dissect out antheridia from an antheridial receptacle under a stereo microscope (Figure 1) and how to cross-link to fix protein-DNA interactions. While the antheridia are embedded in the antheridial receptacle, they can be readily dissected out from the ventral surface of the receptacle.

• 1.Take a glass slide and drop 100–200 μL of sterile water onto it.
• 2.Cut off an antheridial receptacle from an antheridiophore at stages 3–5.¹²
• 3.Place the receptacle upside down onto sterile water on the glass slide (Figure 1A).

Note: If the antheridial receptacle contains mature antheridia, sperm will be released into the water. Wash out the sperm with sterile water to prevent contamination of the sample.

• 4.Remove ventral scales using tweezers under a stereo microscope (Figure 1B).
• 5.Take another glass slide and drop 100–200 μL of PBS onto it.
• 6.Transfer the antheridial receptacle onto PBS on the glass slide.
• 7.Gently scratch the ventral side of the antheridial receptacle with the tip of tweezers or syringe needles (21–26G) to dissect out antheridia (Figure 1C).
• 8.Transfer all dissected antheridia into a 1.5 mL tube using a pipette.

Note: Use 20–200 μL tips with an inner diameter of approximately 1.5 mm to ensure the antheridia are not damaged during transfer. When using fluorescent proteins as epitope tags, you can enrich target cells by collecting the fluorescent-positive antheridia under a fluorescence stereo microscope (Figure 1D).

• 9.Repeat steps 1–8 until the required number of antheridia is obtained.

Note: The required numbers of antheridia will depend on the POI and the stage at which the POI is expressed. Typically, around 300 antheridia are sufficient to get good results for TFs expressed at the spermatid stage.

• 10.Remove PBS as much as possible.
• 11.Add 800 μL of Fixing solution.

CRITICAL: Perform this step inside a chemical hood to avoid exposure to hazardous vapors.

• 12.
  Perform vacuum infiltration (Figure 2).

  • a.
    Start the vacuum infiltration and keep it for 2 min.
  • b.
    Gently release the vacuum for 1 min.
  • c.
    Repeat steps 12a and 12b.

Note: The optimal time for fixation will vary between tissues. We usually perform 3 cycles of the vacuum for 2 min and release for 1 min (9 min in total) to fix antheridia.

• 13.Remove Fixing solution as much as possible.

Note: Antheridia typically settle at the bottom of the tube following vacuum infiltration. If they remain suspended, a quick spin on a benchtop centrifuge will facilitate collection.

• 14.Add 800 μL of Quenching solution.
• 15.
  Perform vacuum infiltration (Figure 2).

  • a.
    Start the vacuum infiltration and keep it for 2 min.
  • b.
    Gently release the vacuum for 1 min.
  • c.
    Repeat steps 15a and 15b for 1 time.
• 16.Remove Quenching solution as much as possible.

Note: Antheridia typically settle at the bottom of the tube following vacuum infiltration. If they remain suspended, a quick spin on a benchtop centrifuge will facilitate collection. After this step, perform the subsequent procedure on ice or in the cold room.

• 17.Add 1 mL of pre-chilled PBS.
• 18.Remove PBS as much as possible.

Note: Antheridia typically settle at the bottom of the tube within tens of seconds. A quick spin on a benchtop centrifuge will facilitate collection.

• 19.Repeat steps 17 and 18.
• 20.Remove PBS completely from the tube.

Note: Use a thin gel-loading tip (inner diameter below 0.5 mm) to avoid accidental aspiration of the antheridia during this step.

• 21.Snap freeze in liquid nitrogen and store at −80°C.

Note: Frozen samples should be used within a few months to avoid degradation of protein-DNA complexes for better results.

Figure 1.

Collecting antheridia under a fluorescence stereo microscope

(A) Photographs of an antheridiophore (male sexual branch) taken from above (left) and side (right). A disk-shaped antheridial receptacle is formed on the stalk. Antheridia (spermatid-forming organs) are embedded in the antheridial receptacle. Scale bar in each panel represents 1 mm.

(B) Photographs of ventral side of the antheridial receptacle before (left) and after (right) removing ventral scales. Ventral side of the antheridial receptacle is covered in ventral scales, which are obstacles for dissecting antheridia out of antheridial receptacle. Scale bar in each panel represents 1 mm.

(C) Enlarged image of the boxed area in (B) before (left) and after (right) dissecting out antheridia. The approximate border of some embedded antheridia is indicated by a white dotted outline (left). Isolated antheridia are indicated by black arrow heads (right). Scale bar in each panel represents 1 mm.

(D) Representative images of isolated antheridia from MpDUO1-Citrine^ki plants under bright field (left) and YFP filter (right). The Citrine-positive antheridia were collected for ChIP experiments. Younger antheridia with spermatogenous cells (lower left) or mature ones with differentiated spermatids (upper right) can be easily distinguished. Scale bar in each panel represents 500 μm.

Figure 2.

Procedure of vacuum infiltration

(A) Set up a vacuum desiccator and a vacuum pump inside a fume hood.

(B) Place the sample tube in the desiccator with the cap open.

(C) Connect the desiccator to the vacuum pump, evacuate the chamber, and keep the vacuum pump on for 2 min.

(D) Close the valve of the desiccator and detach the vacuum tube.

(E) Slightly open the valve to allow slow release of the negative pressure in the desiccator over 1 min.

(F) Open the desiccator lid and remove the sample tube. Repeat steps (B)-(F) if required.

Nuclei isolation and DNA sonication

Timing: 3 h

This section describes how to isolate clean nuclei from frozen samples and shear the genomic DNA by sonication.

• 22.Grind the sample into a fine powder using a mortar and pestle.

CRITICAL: Keep the sample frozen throughout the entire process. Frequently replenish with liquid nitrogen to prevent thawing.

• 23.Add 1 mL of Nuclei extraction buffer to the frozen powder.
• 24.Keep grinding the mixture until the sample is thawed.
• 25.Filter the homogenized sample with a 50 μm cell strainer.
• 26.Centrifuge the sample at 1,500 × g for 10 min at 4°C and discard the supernatant.
• 27.Resuspend the pellet with 1 mL of Nuclei wash buffer to remove chloroplasts.
• 28.Centrifuge the sample at 1,500 × g for 10 min at 4°C and discard the supernatant.
• 29.Repeat steps 27 and 28 until the supernatant appears clear.

Note: The pellet will typically turn from green to grayish-white as chloroplasts and other pigments are removed. Continue the wash cycles until this visual change is complete to ensure the purity of the nuclei. The optimal number of washes will vary depending on tissues. We usually perform 2 washes for antheridial samples.

• 30.Resuspend the pellet with 70 μL of Nuclei lysis buffer.

Note: The viscosity of the solution increases due to the release of genomic DNA.

• 31.Incubate on ice for at least 30 min.
• 32.Add 590 μL of the ChIP dilution buffer without Triton.
• 33.Mix well by gently pipetting without generating bubbles.
• 34.Transfer 130 μL of the sample to a microTUBE AFA Fiber Pre-Slit Snap-Cap 6 × 16 mm.
• 35.Sonicate the sample using the Covaris S220 Focused-ultrasonicator at 4–6°C for 50 sec with the following parameter: peak power, 175; duty factor, 5; cycles per burst, 200.

Alternatives: Bath sonicators, such as Bioruptor and Picoruptor, can be used as alternatives to the Covaris S220. When using bath sonicators, parameters must be carefully optimized to achieve the optimal fragment sizes for your specific application.

• 36.Transfer the sonicated sample to a 1.5 mL DNA LoBind tube.
• 37.Repeat steps 34–36 using the rest of the sample and combine them.
• 38.Add 130 μL of the ChIP dilution buffer without Triton and 100 μL of 10% Triton X-100.

Note: The final concentration of Triton X-100 is approximately 1.1% during immunoprecipitation. While a final concentration of approximately 1% Triton X-100 is typically used, the type and concentration of detergents may be adjusted depending on the antibody used and the POI.

• 39.Centrifuge the sample at a minimum of 10,000 × g for 5 min at 4°C.
• 40.Transfer the supernatant to a new 1.5 mL DNA LoBind tube.

Immunoprecipitation and reversal of cross-linking

Timing: 2 days

This section describes how to purify protein-DNA complexes and reverse the cross-linking.

• 41.Aliquot the required volume of Dynabeads Protein G into a new 1.5 mL tube.

Note: Resuspend the beads thoroughly by vortexing or manual inversion before use. 20 μL beads per sample are required for subsequent preclearing.

• 42.Wash the Dynabeads with 200 μL of ChIP dilution buffer for 5 min at 4°C with end-over-end rotation.

Note: Briefly centrifuge the tube to recover any bead slurry trapped in the cap before placing them on the magnetic rack.

• 43.Place the tube on the magnetic rack and allow beads to separate until the supernatant becomes clear.
• 44.Repeat steps 42 and 43 two more times for a total of three washes.
• 45.Add 20 μL of the pre-washed Dynabeads and incubate the tube at 4°C for 2 h with gentle end-over-end rotation.

Note: This preclearing step is performed to remove non-specific binding components from the sample, thereby reducing background noise in the subsequent immunoprecipitation. We have confirmed that preclearing with 20 μL of beads is sufficient to eliminate background signals from non-specific binding when using antheridia samples. However, larger volumes of beads may be required depending on the tissue type.

• 46.Place the tube on the magnetic rack and allow beads to separate until the supernatant becomes clear.
• 47.Transfer the supernatant to a new 1.5 mL DNA LoBind tube.
• 48.Save 18 μL of the sample as the input control (2% input) and store it at −80°C.
• 49.Add the appropriate volume of the desired antibody and incubate the tube at 4°C for 16 h with gentle end-over-end rotation.

Note: We highly recommend using ChIP-validated antibodies whenever possible. It is crucial to optimize the antibody titration, as the required amount varies depending on the specific antibody. Generally, a range of 1–10 μg per reaction is optimal for ChIP analysis. In this protocol, we utilized 10 μg of a GFP-polyclonal antibody, which is also cross-reactive with GFP variants such as Citrine.

• 50.Aliquot the required volume of Dynabeads Protein G into a new 1.5 mL tube.

Note: Resuspend the beads thoroughly by vortexing or manual inversion before use. The appropriate volume of beads should be determined according to the starting material, the antibody of choice, and the target POI before proceeding with the ChIP procedure.

• 51.Wash the Dynabeads with 200 μL of ChIP dilution buffer for 5 min at 4°C with end-over-end rotation.

Note: Briefly centrifuge the tube to recover any bead slurry trapped in the cap before placing them on the magnetic rack.

• 52.Place the tube on the magnetic rack and allow beads to separate until the supernatant becomes clear.
• 53.Repeat steps 51 and 52 two more times for a total of three washes.
• 54.Add the appropriate volume of the pre-washed Dynabeads and incubate the mixture at 4°C for 4 h with gentle end-over-end rotation.

Note: In this protocol, we use 50 μL of beads to accommodate approximately 10 μg of antibody based on the binding capacity, following the manufacturer’s instructions (https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0015809_Dynabeads_Protein_G.pdf). Briefly centrifuge the tube to recover any bead slurry trapped in the cap before placing them on the magnetic rack.

• 55.Place the tube on the magnetic rack and allow beads to separate until the supernatant is clear.
• 56.Save 120 μL of the supernatant and store it at −80°C for later validation of the sheared chromatin.

Note: To conserve sample, sonication efficiency can be assessed using the unbound chromatin fraction. Since the bound fraction is generally negligible relative to the total input, the fragment size distribution of the unbound DNA accurately reflects that of the entire sample.

• 57.Discard the rest of the supernatant.
• 58.
  Perform all subsequent wash steps using 1 mL of the specified buffer for 5 min at 4°C with gentle end-over-end rotation.

  • a.
    Wash the beads twice with Low salt wash buffer.
  • b.
    Wash the beads twice with High salt wash buffer.
  • c.
    Wash the beads twice with LiCl wash buffer.
  • d.
    Wash the beads twice with 0.5× TE.

CRITICAL: After each 5-min rotation, place the tube on a magnetic rack until the supernatant is completely clear. Carefully remove and discard the supernatant before adding the next wash buffer to ensure the total removal of non-specific contaminants.

Note: Briefly centrifuge the tube to recover any bead slurry trapped in the cap before placing them on the magnetic rack.

• 59.Following the last wash, completely remove the supernatant.
• 60.Add 60 μL of ChIP elution buffer and incubate at 65°C for 30 min.

Note: We recommend manual agitation by tapping or vortexing every 5–10 min to keep the beads in suspension. Alternatively, a thermoshaker can be used for continuous mixing, which may improve experimental consistency. To minimize evaporation and ensure uniform heating, we recommend using an incubator with aluminum tube racks. If a bench-top block heater is used, brief centrifugation should be performed after incubation to collect any condensation from the lid and maintain a consistent reaction volume.

• 61.Place the tube on the magnetic rack and allow beads to separate until the supernatant is clear.
• 62.Transfer the supernatant to a new 1.5 mL DNA LoBind tube.
• 63.Repeat steps 60–62 and combine the eluates to 120 μL.
• 64.Adjust the input control (18 μL from step 48) to a final volume of 120 μL by adding 102 μL of ChIP elution buffer.

Note: After this step, perform the following procedures for each of the ChIP sample from step 63, input sample from step 64, and validation sample from step 56.

• 65.Add 2 μL of RNase A (10 mg/mL; final concentration ∼0.16 mg/mL).
• 66.Incubate at 37°C for 30 min.
• 67.Add 14 μL of Reverse crosslink buffer and 4 μL of Proteinase K (10 mg/mL; final concentration ∼0.29 mg/mL).
• 68.Incubate at 45°C for 30 min for Proteinase K digestion.
• 69.Incubate at 65°C for 16 h to complete the reverse-crosslinking.

Note: To minimize evaporation and ensure uniform heating, we recommend using an incubator with aluminum tube racks. If a bench-top block heater is used, brief centrifugation should be performed after incubation to collect any condensation from the lid and maintain a consistent reaction volume.

DNA purification and quality check

Timing: 2 h

This section describes how to purify recovered DNA and validate the size range of the sheared chromatin.

• 70.Purify the validation sample using a PCR purification kit.

Note: This protocol used the HiYield Gel/PCR DNA Fragments Extraction Kit from RBC Bioscience, following the manufacturer’s instruction (https://download.rbcbioscience.com/RBC%20Real%20Genomics/DNA/HiYield%20Gel%20PCR%20DNA%20Fragments%20Extraction%20Kit/GEL%20PCR%20DNA%20Fragments%20Extraction%20Kit%28YDF%29%20protocol%20V2017-1.pdf).

Alternatives: Conventional phenol-chloroform extraction followed by ethanol precipitation serves as a reliable alternative for recovering DNA, particularly if commercial cleanup kits are unavailable.

• 71.Collect the DNA in 20 μL of the elution buffer provided with the kit (e.g., 10 mM Tris-HCl, pH 8.5) or nuclease-free water.
• 72.Load 5 μL of the purified DNA on a 2% agarose gel with a DNA ladder.

Note: Use a DNA ladder that covers the range of 100 bp to 1,500 bp (e.g., a 100 bp DNA ladder) to accurately assess the size of the fragmented chromatin.

• 73.Stain the gel using the SYBR Gold Nucleic Acid Gel Stain.

Note: Perform the staining according to the manufacturer’s instructions (https://documents.thermofisher.com/TFS-Assets/LSG/manuals/mp11494.pdf). To proceed with purification of the ChIP DNA, the size range of the sheared chromatin should be between 200–700 bp (Figure 3).

Alternatives: While SYBR Gold provides higher sensitivity, conventional staining with ethidium bromide (EtBr) serves as a reliable alternative for DNA visualization.

• 74.Purify the ChIP and input samples (from step 69).

Note: This protocol used the ChIP DNA Clean & Concentrator from ZYMO RESEARCH, following the manufacturer’s instruction (https://files.zymoresearch.com/protocols/_d5201_d5205_chip_dna_clean_concentrator_kit.pdf).

Alternatives: Conventional phenol-chloroform extraction followed by ethanol precipitation serves as a reliable alternative for recovering DNA, particularly if commercial cleanup kits are unavailable.

• 75.Collect DNA in 30 μL of elution buffer provided with the kit (e.g., 10 mM Tris-HCl, pH 8.5) or nuclease-free water.

Note: The purified DNA can be stored at −80°C for several months or used right away for ChIP-qPCR analysis.

Figure 3.

A gel image of sheared chromatin

The purified DNA from step 71 was run on a 2% agarose gel and stained with SYBR Gold Nucleic Acid Gel Stain.

ChIP-qPCR analysis

Timing: 3 h

This section describes how to evaluate signal enrichment by qPCR.

• 76.Prepare the PCR reaction master mix as follows.

Note: The purified DNA can be accordingly diluted for many reactions. We usually take the required amount of the DNA solution and dilute 10 times with nuclease-free water.

PCR reaction master mix

Reagent	Amount
1:10 diluted DNA template	3 μL
2× SYBR mix	10 μL
Forward primer (10 μM stock; final concentration 0.2 μM)	0.4 μL
Reverse primer (10 μM stock; final concentration 0.2 μM)	0.4 μL
ddH2O	6.2 μL
Total	20 μL

• 77.Run qPCR using the following cycling conditions to evaluate signal enrichment.

Note: This protocol used the KOD SYBR qPCR Mix from TOYOBO and the BioRad CFX96 Real-Time PCR System, following the manufacturer’s instructions (https://www.toyobo-global.com/sites/default/static_root/products/lifescience/support/manual/QKD-201.pdf).

CRITICAL: Confirm the generation of a single PCR product by examining the melting curve results. The annealing temperature is highly dependent on the Tm of the specific primers used. Therefore, the annealing temperature should be optimized for each primer set to ensure maximum amplification efficiency and specificity. We highly recommend designing all primers with similar Tm values (e.g., 62°C ± 2°C) to allow multiple target regions to be analyzed simultaneously under the same thermal cycling conditions. We highly recommend performing qPCR with denaturation steps at 98°C for appropriate amplification.

PCR cycling conditions

Steps	Temperature	Time	Cycles
Initial Denaturation	98°C	120 sec	1
Denaturation	98°C	10 sec	40 cycles
Annealing	60°C	10 sec
Extension	68°C	20 sec
Melt Curve	65°C to 95°C, increment 0.5°C	5 sec	1
Hold	12°C	forever

Expected outcomes

If the ChIP assay is successful, enrichment for the target TF at the specific genomic regions (often near the TSS) should be observed. In this protocol, the binding sites of MpDUO1¹³ on the antheridium-specific tubulin genes, MpTUA5¹³ and MpTUB4¹² are evaluated as the test cases. We used MpTUA3, whose expression level is very low in antheridia and sperm (Figure 4A), as a negative control locus. We examined signal enrichment in each region by calculating the percentage relative to the input samples (%input) using the following formula:

$$\%input=100\times 2^{\{Cq\left(input\right)-Cq\left(ChIP\right)+{\mathit{Log}}_2\left(Dilutionfactor\right)\}}$$

Figure 4.

An example of ChIP-qPCR results

(A) Tissue expression pattern of alpha-tubulin genes in M. polymorpha. Transcripts per million (TPM) values are log2-transformed after adding a pseudo count of 1 to avoid negative values for expression levels. Raw TPM values are obtained from MarpolBase Expression¹⁵ (MBEX, https://marchantia.info/mbex/).

(B) Schematic diagrams of genomic regions of MpTUA5, MpTUB4, and MpTUA3. Black closed boxes represent exons. PCR amplicons used for ChIP-qPCR are indicated as short bars with letters, a and b. The DUO1 consensus DNA-binding motif (5′-RRCSGTT-3′) is shown as a blue vertical line.

(C) ChIP-qPCR analysis showing the enrichment of MpDUO1 on the TSS of MpTUA5 and MpTUB4. _proMpDUO1:mCitrine-NLS plant was used as a negative control. The ChIP DNA was quantified by qPCR, and the DNA enrichment was shown as a percentage of input DNA (%input). MpTUA3, whose expression level is very low in antheridia and sperm was used as a negative control. Error bars indicate SD of three biological replicates (n = 3).

Dilution factor is defined by the percentage of starting material which is used as an Input. In the protocol, we used 2% input (18 μL/900 μL) and therefore dilution factor is 0.02. For example, the %input for the TSS-adjacent region (region a) of MpTUA5, where the average Cq(input) was 24.27 and the average Cq(ChIP) was 26.33, was calculated as follows:

$$\%input=100\times 2^{\{24.27-26.33+{\mathit{Log}}_2\left(0.02\right)\}}$$

$$\%input=100\times 2^{\left\{24.27-26.33-5.64\right\}}$$

$$\%input=100\times 2^{-7.70}\approx 0.48\%$$

Signal enrichment of the MpDUO1-Citrine^ki is detected in proximity to the TSS of both the MpTUA5 and MpTUB4, where the DUO1-binding motif is located (Figures 4B and 4C).

Limitations

Although this protocol has been used to carry out successful ChIP assays using antheridia of M. polymorpha, it has not been tested for other tissues. We recommend pilot experiments and optimization for each step, especially time for fixation, nuclei isolation, and parameters for sonication, when applying this protocol for other tissues. In addition, the success of ChIP assays relies on the antibody you choose. We highly recommend using ChIP-grade antibodies, if they are available.

Troubleshooting

Problem 1

Yield of the sheared chromatin is too low to detect (step 73).

Potential solution

Ensure that griding frozen tissues is fully completed and increase starting materials. If increasing starting materials, increase the amount of the buffers to use accordingly.

Problem 2

Size range of the sheared chromatin is too large (step 73).

Potential solution

Optimize parameters for sonication. Carefully adjust the parameters because sonication with high intensity can damage the protein and lead to signal reduction. If the large amount of undigested genomic DNA is detected, over-fixation may be the cause. Over-fixation with formaldehyde can result in reduction of efficiency for sonication. Shorter time for fixation may improve the situation.

Problem 3

Low signal enrichment or high background noise in ChIP-qPCR (step 77).

Potential solution

If abundance of the POI is suspected to be low, increase the starting material and optimize sampling conditions to maximize abundance of the POI. In addition, changing the antibody or epitope tags to use may improve the situation. Generally, smaller epitope tags tend to offer low background noise, resulting in a high signal-to-noise ratio.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Takashi Araki (araki.takashi.5a@kyoto-u.ac.jp).

Technical contact

Technical questions on executing this protocol should be directed to and will be answered by the technical contact, Keisuke Inoue (inoue.keisuke.6w@kyoto-u.ac.jp).

Materials availability

Plant lines used in this study are available from the lead contact upon request. Sequence information used in this study can be found in MarpolBase (https://marchantia.info) under the following accession numbers: MpTUA1 (Mp4g00550), MpTUA2 (Mp1g24530), MpTUA3 (Mp8g12620), MpTUA4 (Mp2g23500), MpTUA5 (Mp4g08430), MpTUA6 (Mp6g11660), and MpTUA7 (Mp3g11780).

Data and code availability

This study did not generate new data or code.

Acknowledgments

This work was supported by JSPS KAKENHI grant nos. 23K23909, 22H02646, 19H03244 (to T.A.), 20H05780 (to S.Y.), 24K09486, 20K15818 (to K.I.), and 23KJ1256 (to K.K.), the Ohsumi Frontier Science Foundation (to S.Y.), and the Nagase Science and Technology Foundation (to S.Y.). DNA sonication using Covaris S220 Focused-ultrasonicator was performed at the Medical Research Support Center, Graduate School of Medicine, Kyoto University.

Author contributions

K.I. and T.A. conceived the project with the help of S.Y. K.I. optimized the protocol with the help of K.K. and wrote the original manuscript. S.Y. and T.A. edited the manuscript with critical reviewing. All the authors approved the manuscript.

Declaration of interests

The authors declare no competing interests.