Effects of Different Application Methods of Copper-Loaded Montmorillonite on Growth Performance, Antioxidant Capacity, Gene Expression, and Intestinal Microbiota of Penaeus monodon

Abstract

Penaeus monodon is a major marine aquaculture species; however, production intensification has increased water-quality deterioration and disease pressure. Copper-loaded montmorillonite (Cu-MMT) is a functional clay additive with adsorption and antimicrobial properties, yet the optimal application mode remains unclear. We compared a control (KZ), water application (PZ), and dietary inclusion (BZ) of Cu-MMT in P. monodon. BZ was associated with higher survival and a numerically higher specific growth rate, whereas final body weight did not differ among treatments. Antioxidant status improved in BZ, with higher catalase (CAT) and total superoxide dismutase (T-SOD) activities (both p < 0.05). Hepatopancreas RNA-seq identified 949 differentially expressed genes (DEGs) for KZ vs. PZ and 814 DEGs for KZ vs. BZ. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses showed that PZ was enriched for redox processes, transporter activity, and amino-acid biosynthesis—indicative of a stress-defense state—whereas BZ was enriched for proteolysis, endoplasmic-reticulum protein processing, and proteasome pathways, consistent with an anabolic, protein-quality-control–oriented mode. Intestinal 16S rRNA profiling indicated higher diversity and reduced putative pathogens in BZ. Overall, dietary Cu-MMT is the preferred application, shifting shrimp from an energy-consuming stress response to efficient anabolism and thereby improving performance and survival.

1. Introduction

Black tiger shrimp (Penaeus monodon; Decapoda, Penaeus), commonly known in China as “giant tiger prawn”, is the largest species in the genus and an economically important marine shrimp [1]. Owing to its large body size, desirable flesh quality, and high market value, P. monodon is widely farmed along China’s southeastern coast as well as in Southeast Asia and several African countries; in China, annual production reached 138,000 tons in 2024, making it one of the nation’s most important maricultured shrimp species [2,3]. However, intensification has brought several pressing challenges: (i) water-quality deterioration (e.g., accumulation of ammonia and nitrite) that heightens stress responses and reduces survival; (ii) recurrent outbreaks of pathogenic bacteria—particularly Vibrio spp.—leading to acute and chronic diseases; and (iii) environmental stressors and potential dietary toxins that further compound production risks. Together, these factors constrain healthy culture and sustainable industry development. In this context, functional mineral additives have attracted increasing attention as a potential solution.

Montmorillonite (MMT) is a layered silicate clay mineral whose fundamental structural unit comprises two silica tetrahedral sheets sandwiching an alumina octahedral sheet, forming a canonical 2:1 lamellar structure [4]. In animal nutrition, MMT used as a feed additive has been shown to promote body-weight gain and improve feed efficiency, chiefly by efficiently adsorbing dietary mycotoxins and thereby mitigating their toxic effects [5]. Owing to its excellent adsorptive capacity and cation-exchange properties, MMT can also effectively remove harmful substances—such as ammonia nitrogen and heavy metals—from water, and has thus become an important water-quality conditioner in aquaculture [6]. In disease prevention and control of aquatic animals, MMT likewise plays a key role: it can physically adsorb and eliminate intestinal pathogens and their toxins and, through strong interlayer adsorption, bind bacteria and toxic metabolites to modulate the gut microbiota, protect the intestinal mucosal barrier, and ultimately enhance overall immunity [7]. To further improve functionality, MMT is often modified via inorganic, organic, or hybrid organic–inorganic approaches [8]. Copper-loaded montmorillonite (Cu-MMT) is a typical inorganic modification produced by ion exchange, whereby broadly antibacterial Cu²⁺ ions are intercalated into the interlayers or deposited on the surface of MMT [9]. Studies indicate that the loaded copper effectively inhibits common aquaculture pathogens such as Vibrio and Aeromonas, thereby reducing the incidence of related diseases (e.g., gill rot and black gill) [10,11]. Notably, the MMT framework confers a sustained-release profile for copper ions, enabling long-acting antibacterial effects while avoiding toxicity associated with transiently high concentrations of free copper [12]. Consequently, compared with unmodified MMT, Cu-MMT retains and enhances adsorption and cation-exchange performance while adding potent antimicrobial activity, conferring clear advantages for modern aquaculture applications [13].

Although copper-based additives and clay minerals have been explored in shrimp culture, direct comparisons between dietary delivery and water application within the same experimental design remain limited, particularly in P. monodon. Here, we comparatively evaluate these two application routes of Cu-MMT and integrate production performance with hepatopancreatic antioxidant enzymes and intestinal microbiota profiles. Here, we compared alternative Cu-MMT application strategies to evaluate their effects on P. monodon growth performance, antioxidant capacity, gene expression, and intestinal microbiota, with the aim of identifying the optimal mode of application.

2. Results

2.1. Effects of Application Mode on Growth Performance of Penaeus monodon

As shown in Table 1, initial body weight did not differ among groups (p = 0.737), indicating comparable starting conditions. By the end of the trial, the dietary-inclusion group (BZ) showed a higher final mean body weight than the water-application group (PZ) and the control group (KZ); however, these differences were not statistically significant (p = 0.248). Survival rate differed among treatments (p < 0.0001), with BZ exhibiting a higher survival rate than PZ and KZ. Specific growth rate also showed an increasing trend from KZ to PZ to BZ, but the overall difference among groups was not statistically significant under the present dataset (p = 0.131).

Table 1.

Growth performance of Penaeus monodon under different Cu-MMT application modes during the 8-week indoor tank trial (300 L tanks; 30 shrimp per tank; initial body weight: 3.25 ± 0.15 g).

Index	KZ	PZ	BZ	p Value
IBW (g)	3.35 ± 0.15	3.25 ± 0.15	3.32 ± 0.17	0.737
FBW (g)	11.66 ± 1.33	12.56 ± 1.01	13.68 ± 1.55	0.248
SR (%)	76.67 ± 0.01 c	83.33 ± 0.01 b	88.04 ± 0.02 a	<0.001
SGR (% d−1)	2.22 ± 0.17	2.41 ± 0.13	2.52 ± 0.16	0.131

KZ, control (basal diet); PZ, water application (Cu-MMT dispersed into rearing water daily); BZ, dietary inclusion (0.5% w/w Cu-MMT in feed). Values are means ± SD based on tank replicates (n = 3 tanks per treatment; tank as the experimental unit). Different superscript letters within the same row indicate significant differences (one-way ANOVA followed by Tukey’s test, p < 0.05). Exact p values are reported in the last column.

2.2. Effects of Application Mode on Non-Specific Immune Enzymes and Antioxidant Enzymes

As shown in Figure 1, acid phosphatase (ACP; panel A) and alkaline phosphatase (AKP; panel B) activities did not differ among treatments (one-way ANOVA: ACP, p = 0.485; AKP, p = 0.429). In contrast, antioxidant enzyme activities differed among groups. Total superoxide dismutase (T-SOD; panel C) activity was higher in BZ than in KZ and PZ (Tukey-adjusted p = 0.017 and 0.023, respectively; one-way ANOVA, p = 0.0125). Catalase (CAT; panel D) activity was also higher in BZ than in KZ and PZ (Tukey-adjusted p = 0.022 and 0.010, respectively; one-way ANOVA, p = 0.0088). Overall, dietary Cu-MMT was associated with elevated antioxidant enzyme activities (T-SOD and CAT) in the hepatopancreas, whereas ACP and AKP remained unchanged under the present conditions.

Figure 1.

Antioxidant capacity and non-specific immune enzyme activities in the hepatopancreas of Penaeus monodon. (A), ACP activity; (B), AKP activity; (C), T-SOD activity; (D), CAT activity. Values are presented as mean ± SD (n = 3 tanks per treatment). Differences among treatments were assessed by one-way ANOVA followed by Tukey’s multiple comparisons test. Only significant pairwise comparisons are annotated, and the displayed p values are Tukey-adjusted.

2.3. Effects of Application Mode on Gene Expression

2.3.1. Differentially Expressed Genes (DEGs)

As shown in Figure 2, comparison of KZ and PZ yielded 949 DEGs, including 449 upregulated and 500 downregulated DEGs. For KZ vs. BZ, 814 DEGs were identified, with 503 upregulated and 311 downregulated.

Figure 2.

Differentially expressed genes (DEGs) in Penaeus monodon. (A): Volcano plot of DEGs for KZ vs PZ; (B): Volcano plot of DEGs for KZ vs BZ. Differential expression was defined as |log2 fold change| ≥ 1 and Benjamini–Hochberg adjusted p value (padj; FDR) < 0.05 (DESeq2 v1.20.0). In the volcano plots, the label “p value” refers to the DESeq2 adjusted p value (padj), not the unadjusted p value.

2.3.2. GO Enrichment Analysis

As shown in Figure 3, among significantly enriched GO terms (FDR < 0.05), KZ vs. PZ was enriched for processes related to oxidation–reduction process, oxidoreductase activity, transporter activity, and transmembrane transporter activity. In contrast, KZ vs. BZ was primarily enriched for proteolysis, oxidoreductase activity, peptidase activity, and endopeptidase activity.

Figure 3.

GO enrichment analysis in Penaeus monodon. (A): Dot plot for KZ vs. PZ; (B): Dot plot for KZ vs. BZ. Dot size indicates the number of DEGs mapped to each term, and dot color represents the Benjamini–Hochberg adjusted p value (padj; FDR). Terms with FDR < 0.05 were considered significantly enriched.

2.3.3. KEGG Enrichment Analysis

As shown in Figure 4, among significantly enriched KEGG pathways (FDR < 0.05), KZ vs. PZ was enriched mainly in cofactor (coenzyme) biosynthesis, amino-acid biosynthesis, and cysteine and methionine metabolism. In contrast, KZ vs. BZ was chiefly enriched in pathways related to protein processing in the endoplasmic reticulum, proteasome, glycine biosynthesis, and various types of N-glycan biosynthesis.

Figure 4.

KEGG enrichment analysis in Penaeus monodon. (A): Dot plot for KZ vs. PZ; (B): Dot plot for KZ vs. BZ. Dot size indicates the number of DEGs mapped to each pathway, and dot color represents the Benjamini–Hochberg adjusted p value (padj; FDR). Pathways with FDR < 0.05 were considered significantly enriched.

2.3.4. Validation by qRT-PCR

To validate the RNA-seq results, ten representative DEGs were selected to cover both up- and down-regulated expression patterns, including nine upregulated genes (PHGDH, PSMB5, ATP5B, PRSS1, PSMA1, PSMC2, G2B, GANAB, and STT3B) and one downregulated gene (RDH12). qRT-PCR was performed using gene-specific primers and a SYBR Green-based assay. Relative transcript levels were calculated using the 2−ΔΔCt method with elongation factor (EF) as the internal reference gene. Each reaction was run in technical triplicate. Biological replication followed the tank-based experimental design (n = 3 tanks per treatment). As shown in Figure 5, qRT-PCR results were consistent with RNA-seq, with concordant expression directions for all tested genes, supporting the reliability of the transcriptomic dataset.

Figure 5.

qRT-PCR validation of differentially expressed genes identified by RNA-seq. Values are presented as mean ± SD (n = 3 tanks per treatment), with technical triplicates for each sample. Relative expression was calculated using the 2−ΔΔCt method and normalized to elongation factor (EF).

2.4. Effects of Application Mode on the Intestinal Microbiota

2.4.1. ASV Composition and Adequacy Assessment

High-throughput 16S rRNA sequencing yielded a total of 47 amplicon sequence variants (ASVs) after quality filtering. Venn analysis (Figure 6A) showed 20 ASVs shared by all three treatments, with 2, 6, and 10 ASVs unique to PZ, KZ, and BZ, respectively. Species accumulation curves approached a plateau (Figure 6B), suggesting that the sequencing depth and sampling effort were sufficient to capture the majority of detectable ASVs in the present dataset; additional sampling would be unlikely to substantially increase observed richness. Together, these analyses indicate that the ASV dataset is suitable for downstream community diversity and composition analyses.

Figure 6.

ASV composition and adequacy assessment of the intestinal microbiota in Penaeus monodon. (A): Venn diagram of shared and unique ASVs among treatments (P = water-application group1, B = dietary-inclusion group, K = control group); (B): species accumulation curve based on observed ASV richness. Each biological replicate represents one tank-level pooled sample (six shrimp per tank pooled equally; n = 3 tanks per treatment). The accumulation curve was generated by random permutations of sample order; boxplots indicate variability across permutations.

2.4.2. Diversity of the Intestinal Microbiota

For α-diversity, Shannon index showed a higher median value in BZ than in KZ, whereas PZ exhibited a lower Shannon index than KZ (Figure 7A). Given the tank-level replication (n = 3 per treatment), these patterns are described as trends unless supported by statistical testing. For β-diversity, principal coordinates analysis (PCoA) based on the binary Euclidean distance metric indicated a separation of the BZ microbial community from those of KZ and PZ (Figure 7B). Group differences in community structure were further evaluated by PERMANOVA using the same distance matrix.

Figure 7.

Diversity of the intestinal microbiota in Penaeus monodon. (A): Shannon α-diversity index. (B): PCoA ordination based on binary Euclidean distances. Each point represents one tank-level pooled sample (six shrimp per tank pooled equally; n = 3 tanks per treatment).

2.4.3. Gut Microbiota Composition and Sampling Adequacy

At the phylum level, the intestinal microbiota of P. monodon was dominated by Proteobacteria, followed by several minor phyla including Desulfobacterota, Firmicutes, Acidobacteriota, Bacteroidota, Myxococcota, Spirochaetota, Patescibacteria, and Dadabacteria (Figure 8A). Across treatments, Proteobacteria represented the largest proportion and appeared lower in the Cu-MMT groups than in the control, with the lowest proportion observed in BZ.

Figure 8.

Taxonomic composition (relative abundance) of the intestinal microbiota in Penaeus monodon. (A): Phylum-level stacked bar plots; (B): family-level stacked bar plots. Each bar represents one tank-level pooled sample (six shrimp per tank pooled equally; n = 3 tanks per treatment).

At the family level, relative-abundance profiles differed across treatments (Figure 8B). Vibrionaceae accounted for a substantial fraction in all groups and appeared highest in PZ. In BZ, Pseudomonadaceae and Rhodobacteraceae showed higher relative abundance compared with the other treatments, with Shewanellaceae also present at appreciable levels. In KZ, Colwelliaceae appeared more abundant than in the other groups, accompanied by higher proportions of Enterobacteriaceae and Pseudoalteromonadaceae. Because differential abundance testing was not performed and the analysis was based on tank-level pooled samples (n = 3 per treatment), these results are presented as descriptive patterns rather than statistically confirmed taxa-level differences. Future studies with increased replication and dedicated differential abundance methods (e.g., ANCOM or other compositional approaches with FDR control) are warranted to verify these taxa shifts and their functional relevance.

3. Discussion

Survival is a key production endpoint in intensive shrimp culture because it directly determines harvest biomass and interacts with stocking density to shape growth and feed utilization outcomes [14]. In the present study, the BZ showed higher survival than the control and water-application treatments, while final body weight remained comparable among groups. Mechanistically, dietary delivery provides a direct route to the gastrointestinal tract, where aluminosilicate clays have been reported to adsorb undesirable feed-borne contaminants (e.g., representative mycotoxins) and thereby alleviate luminal stressors [15], and copper-containing mineral additives may exert antimicrobial pressure against opportunistic vibrios [16]. Consistent with prior shrimp evidence, dietary montmorillonite has been reported to improve host robustness and modulate stomach/gut microbiota, and in specific contexts to enhance survival against AHPND in Litopenaeus vannamei [17]. In parallel, shrimp transcriptomic studies under environmental stress highlight the metabolic cost and energy reallocation associated with maintaining homeostasis, which may reduce resources available for growth [18]. In our study, microbiota profiling indicated that BZ was associated with a distinct community structure (higher diversity and a shift away from opportunistic taxa), which plausibly contributed to lower mortality during the culture period. Notably, family-level Vibrionaceae abundance does not necessarily reflect pathogenic burden because virulence is often strain- and gene-specific; therefore, mortality differences may occur even when broad taxonomic profiles appear counterintuitive. From an applied perspective, the combination of higher survival with similar final body weight implies a higher total biomass yield for BZ, which is the economically relevant output under commercial conditions [14]. Because feed intake and FCR were not quantified here, future trials should incorporate precise feed accounting to determine whether the survival advantage also translates into improved feed efficiency.

ACP and AKP are key effectors of crustacean humoral immunity; changes in their activities are commonly interpreted as indicators of host stimulation by pathogens or environmental stressors [18,19]. In this study, ACP and AKP activities were generally higher in the water-application group, plausibly reflecting a persistent, low-intensity stimulation of the shrimp immune system caused by direct dispersion of Cu-MMT into the rearing water [20]. SOD and CAT are central antioxidant enzymes that detoxify reactive oxygen species (ROS) and mitigate oxidative injury [21]. During culture, poor water quality, pathogen challenge, and heavy-metal exposure can elevate ROS production and trigger oxidative stress [22,23,24]. Here, the dietary-inclusion group exhibited significantly higher CAT and T-SOD activities, indicative of an “adaptive enhancement” of antioxidant defense. Mechanistically, Cu-MMT delivered via feed likely improves the intestinal milieu and suppresses deleterious bacteria, thereby reducing ROS generation at its source [25], while trace mineral supplementation provides substrates for antioxidant enzyme synthesis. In addition, montmorillonite may act as an immunomodulator that upregulates antioxidant-related genes through signaling pathways, further elevating overall antioxidant capacity [26]. Collectively, shrimp in the dietary-inclusion group displayed a favorable “low-stress, high-defense” physiological state, conferring stronger resilience to potential challenges.

DEGs between the water-application group and the control were predominantly enriched in pathways related to redox processes. Collectively, these patterns indicate sustained environmental stress requiring substantial metabolic mobilization to maintain homeostasis. Enrichment of “oxidation–reduction process” and “oxidoreductase activity” provides direct molecular evidence of responses to accumulated reactive oxygen species (ROS), consistent with the enzyme data showing no significant upregulation of antioxidant enzymes but a stress-like trend in immune enzymes in this group [27,28]. KEGG enrichment of “cysteine and methionine metabolism” further suggests enhanced glutathione (GSH) biosynthesis as a compensatory antioxidant strategy [29] while enrichment of “amino-acid metabolism” and “cofactor/coenzyme biosynthesis” is more indicative of supporting stress proteins and antioxidant enzymes than of promoting growth per se [30]. Enrichment of “transporter activity” implies increased transmembrane trafficking to maintain ion balance and eliminate toxicants [31]. Overall, the transcriptomic signature of the water-application group reflects a high-energy, passive-defense mode in which resources are diverted to repair and basic survival rather than to efficient growth.

By contrast, DEGs between the dietary-inclusion group and the control were mainly enriched in proteolysis-related pathways, revealing a “high-efficiency factory” configuration centered on protein metabolism. Enrichment of proteolysis and peptidase pathways indicates enhanced digestive capacity, enabling more efficient hydrolysis of dietary protein into amino acids and thereby supplying abundant substrates for growth [32]. KEGG enrichment of “protein processing in the endoplasmic reticulum” together with GO enrichment of “N-glycan biosynthetic process” suggests an increased capacity for ER co-/post-translational folding and N-glycosylation-dependent quality control, supporting enhanced maturation of secretory and membrane proteins [33]. Concurrent enrichment of the “proteasome” pathway indicates robust protein quality control that facilitates rapid degradation of misfolded or damaged proteins while new proteins are being synthesized [34]. Taken together, the dietary-inclusion group couples “high-throughput synthesis” with “stringent quality control,” providing a molecular basis for improved growth, survival, and environmental adaptability while maintaining cellular homeostasis.

Alpha diversity (within-sample diversity) integrates species richness and evenness, and higher alpha diversity generally confers greater ecological stability and resistance to disturbance [35,36]. Under the water-application regimen, Cu-MMT is evenly dispersed in the water column; released copper ions impose a non-selective pressure on the microbial community that can suppress not only deleterious taxa but also beneficial or commensal microbes, thereby reducing alpha diversity [37]. By contrast, dietary inclusion allows Cu-MMT to act primarily within the digestive tract, facilitating colonization by beneficial bacteria [38]. Feces containing both Cu-MMT and beneficial microbes are then deposited on the pond bottom, effectively delivering a targeted “microecological modulator” that helps maintain or increase community diversity. This pattern indicates a succession from potential dysbiosis toward a healthier, more stable state. Moreover, the dietary approach reshapes key ecological niches, optimizes water quality, and modulates microbial assemblages in the shrimp gut and benthic sediments [39], thereby improving intestinal health, suppressing harmful sediment bacteria, and restructuring the microbial network of the culture ecosystem.

Members of the phylum Proteobacteria encompass major opportunistic pathogens in aquaculture; their overgrowth often heralds water quality deterioration and disease outbreaks [40,41]. Cu-MMT administered via feed likely releases copper ions in a sustained manner along the gut, suppressing proteobacterial pathogens, lowering infection risk, and reducing pathogen shedding [42]. The Cu-MMT–containing fecal layer at the sediment–water interface can further act as a long-acting antibacterial barrier that limits pathogen proliferation and spread [43]. In both the control and water-application groups, Vibrionaceae constituted a high proportion of the gut microbiota—and nearly monopolized the community in the water-application group—signaling elevated disease risk [44]. In contrast, the dietary group showed a more balanced community structure, with reduced Vibrionaceae and increased representation of putative beneficial/functional taxa [45]. Collectively, dietary inclusion suppresses harmful bacterial enrichment, promotes intestinal microbiome diversity and functional stability, enhances the rearing environment, and ultimately supports better shrimp health. Notably, although Vibrionaceae abundance was lower in the control group, reduced overall microbial diversity may weaken community resilience and increase susceptibility to stress-related mortality. Therefore, shrimp survival cannot be explained by the abundance of a single taxon but rather by the integrated effects of microbial diversity, host antioxidant capacity, and physiological homeostasis.

Several limitations should be acknowledged. First, standardized pathogen challenge trials were not conducted; thus, the present findings should not be interpreted as confirmed disease resistance. Future studies should include sequential AHPND and WSSV challenge experiments. Second, because excessive copper can be hepatotoxic, the current supplementation level should not be considered optimal, and dose–response evaluations are warranted. Finally, raw qRT-PCR amplification data were not retained in this study; future work will preserve raw amplification curves and report primer efficiencies and R² values in accordance with MIQE guidelines.

4. Methods and Materials

4.1. Experimental Materials

The trial was conducted at the Shenzhen Experimental Base of the South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences (Shenzhen, China). Experimental shrimp were netted from an earthen grow-out pond, and feeding was withheld for 24 h before the start of the trial. A total of 270 healthy individuals of similar size and free of visible disease or injury were selected (initial mean body weight: 3.25 ± 0.15 g). Copper-loaded montmorillonite (Cu-MMT; Cu content 2%, w/w) was purchased from Inner Mongolia Hezhengmei Biotechnology Co., Ltd. (Chifeng, China) The basal diet was formulated mainly with fish meal, soybean meal, chicken meal, peanut hull, wheatmeal, beer yeast, shrimp meal, and soy protein concentrate. It also contained soybean lecithin (1.00%), fish oil (1.55%), soybean oil (1.55%), vitamin C polyphosphate (0.10%), cholesterol (0.50%), vitamin premix (1.00%), mineral premix (1.00%), Ca(H2_22PO4_44)2_22 (1.00%), carboxymethyl cellulose (1.00%), and taurine (0.10%) (%, w/w; total 100%). The basal diet contained 39.92% crude protein and 7.26% crude lipid, with methionine, lysine, and threonine levels of 0.83%, 2.58%, and 1.63%, respectively. This basal diet was used for KZ and PZ, while BZ was prepared by adding Cu-MMT at 0.5% (w/w) without changing other dietary components.

4.2. Husbandry and Experimental Design

To evaluate route-dependent effects of Cu-MMT in Penaeus monodon, an 8-week indoor rearing trial was performed. A total of 270 size-matched juveniles were randomly assigned to nine 300 L tanks (30 shrimp per tank), with three treatments and three replicate tanks per treatment (n = 3 tanks). Treatments were: (i) Control (KZ), basal commercial diet; (ii) Water application (PZ), basal diet with Cu-MMT dispersed into the rearing water; and (iii) Dietary inclusion (BZ), basal diet supplemented with 0.5% (w/w) Cu-MMT.

In the PZ group, Cu-MMT was applied at 24.4 mg tank⁻¹ day⁻¹, dispersed each morning immediately before the first feeding. In the BZ group, Cu-MMT was incorporated at 0.5% (w/w) in the daily feed offered. To support a route-based comparison, the nominal daily Cu-MMT input for the dietary treatment was estimated as: Cu-MMT_diet (mg tank⁻¹ day⁻¹) = daily feed offered (g tank⁻¹ day⁻¹) × 0.5% × 1000. Accordingly, the waterborne addition was set at 24.4 mg tank⁻¹ day⁻¹ to provide a comparable nominal external input at the tank level. We emphasize that this approach reflects nominal external input and does not assume equivalent internal copper bioavailability between dietary and waterborne exposure routes. The inclusion level was selected based on preliminary observations and literature-reported safe supplementation ranges, and the present study focused on delivery-route comparison rather than dose optimization.

For the BZ treatment, Cu-MMT was applied to basal pellets using a seawater-based top-coating procedure. Briefly, the required Cu-MMT was mixed with a small volume of seawater to form a homogeneous slurry, which was sprayed onto pellets under continuous mixing to ensure uniform coverage. Coated pellets were air-dried at room temperature until the surface was no longer tacky and then stored in sealed bags until use. Seawater served as the wetting/adhesion medium to promote particle attachment, and the drying step was used to reduce detachment/leaching during feeding.

Shrimp were fed three times daily (09:00, 15:00, and 21:00). The daily ration was initially set at approximately 5% of biomass and then adjusted weekly based on measured body weight and observed feed consumption to minimize feed waste while maintaining comparable feeding conditions across treatments. Tanks were continuously aerated. Water temperature was maintained at 30 ± 2 °C and pH at 7.0–8.0. To limit potential accumulation of Cu-MMT particles and/or released copper, tank bottoms were siphoned daily, and one-third of the water volume was renewed every five days.

4.3. Sample Collection

After the 8-week trial, feeding was withdrawn for 24 h. Shrimp were netted from each tank, survivors were counted, and individual body weight was measured to 0.01 g. Growth performance was calculated per tank and expressed as the mean of three replicates using the following formulas:

$$\mathrm{S}\mathrm{R} (\mathrm{\%})=100\times {\displaystyle \frac{{\mathrm{N}}_{\mathrm{f}}}{{\mathrm{N}}_{\mathrm{i}}}}$$

$$\mathrm{SGR}(\% {\mathrm{d}}^{-1})=100\times {\displaystyle \frac{\ln {\mathrm{W}}_{\mathrm{f}}-\ln {\mathrm{W}}_{\mathrm{i}}}{\mathrm{t}}}$$

where ${\mathrm{W}}_{\mathrm{i}}$ is the initial mean body weight per tank (g), ${\mathrm{W}}_{\mathrm{f}}$ is the final mean body weight per tank (g), ${\mathrm{N}}_{\mathrm{i}}$ is the number of shrimp stocked, and ${\mathrm{N}}_{\mathrm{f}}$ is the number of survivors at harvest. Treatment means were obtained from the three replicate tanks.

4.4. Hepatopancreas Enzyme Activity Assays

At the end of the rearing trial, all shrimp underwent a 24 h fasting period. Thereafter, six healthy, size-matched individuals were randomly sampled from each tank. Shrimp were surface-sterilized with 75% ethanol, and the hepatopancreas was aseptically excised on an ice-chilled tray using sterile instruments. Tissue samples were aliquoted into pre-labeled cryovials, snap-frozen in liquid nitrogen, and stored at −80 °C until analysis.

Activities of acid phosphatase (ACP), alkaline phosphatase (AKP), total superoxide dismutase (T-SOD), and catalase (CAT) were determined using commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), following the manufacturer’s instructions precisely.

4.5. Hepatopancreas Transcriptome Analysis

During sampling, shrimp were briefly anesthetized on ice and rapidly dissected. Hepatopancreas tissues were collected under aseptic conditions with RNase-free instruments, snap-frozen in liquid nitrogen, and stored at −80 °C until RNA extraction. Total RNA was extracted using TRIzol reagent, and RNA purity and integrity were assessed according to standard procedures. Qualified RNA was used for strand-specific mRNA library preparation, followed by paired-end sequencing (2 × 150 bp) on an Illumina NovaSeq platform. For each sample, at least 20 million clean reads were generated.

Clean reads were aligned to the Penaeus monodon reference genome assembly GCF_015228065.2 (NSTDA_Pmon_1) using HISAT2 (v2.0.5). Gene-level read counts were generated using featureCounts (v1.5.0-p3) based on the corresponding annotation file GCF_015228065.2_NSTDA_Pmon_1_genomic.gff from the same release.

Raw read counts were analyzed using DESeq2 (v1.20.0) in R. Counts were normalized using the median-of-ratios method, and differential expression was tested using the Wald test under a negative binomial model. Genes with |log2 fold change| ≥ 1 and Benjamini–Hochberg adjusted p value (padj) < 0.05 were considered differentially expressed genes (DEGs). Because DESeq2 (v1.20.0) does not apply log2 fold-change shrinkage by default, unshrunken log2 fold changes were reported (no lfcShrink() was applied). GO and KEGG enrichment analyses were performed using the R package clusterProfiler (v3.8.1). Enrichment significance was assessed using Benjamini–Hochberg FDR correction, and terms/pathways with FDR < 0.05 were considered significant.

4.6. qRT-PCR Validation of RNA-Seq

To validate the RNA-Seq results, the relative expression of selected DEGs was quantified by real-time reverse-transcription PCR (qRT-PCR) using a LightCycler^® 480 II system (Roche, Switzerland). Each 12.5 µL reaction contained 6.25 µL 2× SYBR^® Green Pro Taq HS Premix (Aikore Bio, Changsha, Hunan, China), 0.5 µL each of forward and reverse primers (10 µM), 1 µL cDNA template (~50 ng), and 4.25 µL nuclease-free water. The cycling program was: 95 °C for 30 s; followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. Three biological replicates and three technical replicates were included per sample.

Relative transcript abundance was calculated using the 2−ΔΔCT method, with elongation factor (EF) as the internal reference gene. Primer sequences used in this study are listed in Table 2. A limitation of this study is that amplification efficiencies for each primer pair were not determined using dilution-series standard curves, because no remaining biological material/cDNA was available and the original raw amplification curve files were not retained. Therefore, relative expression was calculated using the 2−ΔΔCt method under identical reaction conditions across targets, with primer specificity assessed by melting-curve analysis.

Table 2.

Primers for expression analysis.

Primer Name	Forward Primer (5′-3′)	Reverse Primer (5′-3′)
PHGDH	ATTGAAGAGCCATGACGGGG	TTCATCACAATGACGCCCCT
PSMB5	GCGTCGATTACCACAGCAAG	ACCTGGGATTCAGCCTTGGA
ATP5B	CCCCATTCCCACTGAACACT	CACCACCGAACAGACCAATC
PRSS1	AGCTATCTTGAGGACGACCC	TGGTCAGATACGTCCCGTTG
PSMA1	TAGCGGGCTTTGATGAGGATG	CATCCCGAGTGACGCTCAAA
RDH12	ATTTGCTCCTCGGGTTGCT	AAGCCCGAGATATGACCGTG
PSMC2	AAGGAATGAGGGTGGGTGTG	GGCTTCTCCTCGACTTGCAT
G2B	TCTGAGGGCAAGGATGAAGG	CTGGCTTTATTGGCAGCATCA
GANAB	GCTGAATGGAGTCATCTGCG	AAACCCAAGGGGTCTGTCCT
STT3B	CACGTCGGTCTTGCAGCTAT	CGACGCCCACCATGAATAGA
EF	TCGCCGAACTGCTGACCAAGA	CCGGCTTCCAGTTCCTTACC

4.7. Intestinal Microbiota Analysis

At the end of the rearing trial, all shrimp were fasted for 24 h. From each tank, six healthy individuals were randomly selected. Under aseptic conditions, the entire intestine was rapidly excised. From each tank, six healthy individuals were randomly selected. To obtain one biological replicate per tank, intestines from the six shrimp were pooled (equal mass per individual) to generate a single composite sample for DNA extraction. Therefore, n = 3 biological replicates (tanks) were analyzed per treatment. Intestinal contents were gently rinsed with sterile phosphate-buffered saline (PBS), and tissues were immediately transferred to sterile 1.5 mL microcentrifuge tubes, snap-frozen in liquid nitrogen, and stored at −80 °C until analysis.

Genomic DNA extracted from the pooled intestinal sample of each tank served as the template for PCR amplification of the bacterial 16S rRNA gene using universal primers. Purified and quantified amplicons were used to construct sequencing libraries and subjected to high-throughput sequencing on an Illumina NovaSeq platform (Illumina, San Diego, CA, USA). Raw sequencing reads were processed using QIIME2 (version 1.42.0). Paired-end reads were merged using the VSEARCH plugin, primer sequences were removed using the Cutadapt plugin, and low-quality reads were filtered using default QIIME2 quality-control parameters. Denoising, chimera removal, and amplicon sequence variant (ASV) inference were performed using the Deblur plugin implemented in QIIME2. Representative ASV sequences were taxonomically assigned against the SILVA database (version 138) using a QIIME2-trained Naïve Bayes classifier (classify-sklearn).

Prior to downstream analyses, sequences annotated as mitochondria, chloroplasts, or Archaea were removed. Rare ASVs with a total relative abundance below 0.00005 of the total sequencing reads were filtered out. To minimize the influence of unequal sequencing depth among samples, the ASV feature table was rarefied to the minimum sequencing depth across all samples.

Based on the rarefied ASV table, alpha diversity (Shannon index) was calculated to assess within-sample microbial diversity. Beta diversity was evaluated using principal coordinates analysis (PCoA) based on Bray–Curtis distances to compare community structure among treatment groups. Taxonomic composition was summarized at multiple taxonomic levels.

4.8. Statistical Analysis

Data are presented as mean ± SD, with the tank considered the experimental unit unless otherwise stated. Normality and homogeneity of variance were assessed prior to analysis. Differences among treatments were evaluated using one-way ANOVA followed by Tukey’s post hoc test for multiple comparisons. Statistical significance was set at p < 0.05. In tables/figures, different superscript letters indicate significant differences (Tukey’s test, p < 0.05), and no letters are used when differences are not significant. Analyses were performed using SPSS 19.0 and GraphPad Prism 9.5.

5. Conclusions

This study systematically evaluated the effects of different application strategies of copper-loaded montmorillonite (Cu-MMT) on the aquaculture performance of black tiger shrimp (P. monodon). Dietary inclusion of Cu-MMT was associated with improved survival and a numerically higher growth rate compared with the control and water-application treatments, supporting dietary delivery as a preferable application strategy under the present experimental conditions. Enzymatic assays showed higher total superoxide dismutase (T-SOD) and catalase (CAT) activities in the dietary group, consistent with enhanced antioxidant defense. Transcriptome profiling revealed that water sprinkling predominantly activated stress-response pathways, whereas dietary inclusion enriched pathways involved in protein digestion, biosynthesis, and protein quality control, suggesting a shift from passive defense to efficient anabolic processes. Intestinal microbiota analysis further demonstrated an over-representation of Vibrionaceae under water sprinkling, while the dietary group exhibited a more balanced community with increased proportions of beneficial taxa, thereby supporting gut homeostasis and culture-water health. Collectively, multi-level evidence—growth performance, molecular mechanisms, and microbial ecology—supports dietary Cu-MMT as the preferred application mode, providing a mechanistic basis for functional feed development and greener shrimp farming. Future work should integrate long-term on-farm trials with multi-omics to refine mode-of-action and assess applicability across other aquaculture species.

Author Contributions

Conceptualization, S.J. and X.S.; Methodology, J.W., Y.D. and F.Z.; Investigation (animal trial, sampling, and laboratory assays), J.W., Y.D., F.Z., J.S., Q.Y., Y.L., J.H. and L.Y.; Resources and project logistics, J.S., Q.Y., Y.L., J.H. and L.Y.; Data curation, J.W. and Y.D.; Formal analysis and statistics, J.W., Y.D. and X.S.; Visualization, J.W. and Y.D.; Writing—original draft, J.W. and Y.D.; Writing—review and editing, X.S., S.J. and F.Z.; Supervision, S.J. and X.S.; Project administration, S.J.; Funding acquisition, S.J. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

The present study was approved by the Animal Care and Use Committee of South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences (Approval number SCSFRI2021-0731) on 15 June 2021. All procedures were strictly carried out according to the regulations and guidelines approved by the committee.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

National Key R & D Program of China (2022YFD2400104), Innovative Team Building Project of Guangdong Modern Agricultural Industrial Technology System (2024CXTD25), the earmarked fund for CARS-48, Central Public-interest Scientific Institution Basal Research Fund, CAFS (NO. 2023TD34, NO. 2025XT0703), Guangdong Special Project: Science & Technology Achievements in Counties and Towns for Balanced Regional Development (2025B0202010003).