Lavender Essential Oil-Induced Enhancement of Exercise-Responsive Myokine Expression and Alteration of Muscle-Related Gene Networks in an in Vitro Muscle Contraction Model

Abstract

Lavender essential oil (LEO) is commonly used in aromatherapy for stress reduction, relaxation and recovery from (muscle) fatigue. However, molecular mechanisms underlying its potential physiological effects on the skeletal muscle remain unclear. This study investigates whether LEO affects the intracellular signaling pathways in skeletal muscle cells that respond to physical activity. Prior to the experiment, GC-MS analysis confirmed linalyl acetate and linalool as the main components of LEO used in this study. Transdermal permeability was assessed using a reconstructed human epidermis model, which showed that linalool permeated the epidermal layer, while linalyl acetate showed minimal permeation. Following this confirmation, the differentiated C2C12 myotubes were treated with LEO in an in vitro muscle contraction model using electrical pulse stimulation (EPS). LEO significantly increased Interleukin 6 (IL-6) mRNA expression under EPS, and DNA whole-genome microarray analysis showed that LEO induced different gene expression profiles depending on the contraction state of the muscle cells. These results provide the first molecular evidence that LEO modulates skeletal muscle gene networks in a stimulation-dependent manner and may indicate its potential use as an aid to recovery (from fatigue) after exercise. Notably, the skin permeation of LEO components showed a saturation trend at concentrations above 5%, suggesting the presence of an optimal concentration range for topical application in sports aromatherapy.

1. Introduction

Aromatherapy uses essential oils extracted from natural plants and has been reported to provide a variety of physiological benefits, including improvements in sleep quality [1], anxiolytic [2] and anti-stress [3] effects, antidepressant actions [4], and antimicrobial properties [5]. As more evidence has emerged, aromatherapy has become increasingly adopted in clinical practice and is now recognized as a complementary medical approach, often referred to as medical aromatherapy [6]. Essential oils can be administered via inhalation, transdermal application, or, less commonly, through oral intake [7]. Inhalation is the most common method, and endocrine responses, such as reduction in the level of stress hormones and improvement in cognitive and emotional states [8], are seen.

By contrast, evidence regarding the biological effects of topically applied essential oils is limited. Although in vitro studies have suggested anti-inflammatory and antioxidant properties of essential oils [9,10], the mechanisms underlying their physiological effects beyond the skin barrier are not well understood. Essential oils contain low-molecular-weight, lipid-soluble compounds with relatively high skin permeability, suggesting that certain constituents may pass through the stratum corneum and reach deeper tissues [11,12]. Indeed, reconstructed human epidermis models are widely used to evaluate essential oil permeability and dermal absorption [13].

Essential oils are incorporated into massage protocols in sports and rehabilitation settings, and post-exercise aromatherapy has received increasing attention as a strategy to enhance relaxation and recovery [14,15]. Concurrently, recent advances in exercise physiology have revealed that contracting skeletal muscle acts as an endocrine organ that secretes cytokines known as myokines, which regulate metabolism, inflammation, and tissue repair. Interleukin 6 (IL-6) is one of the most prominent myokines induced by muscle contraction and plays a significant role in exercise-induced adaptations [14,15].

Based on this concept, it is plausible that massage with essential oils performed after exercise may modulate myokine responses and improve muscle recovery. However, this hypothesis has not been evaluated experimentally. The present study therefore aimed to investigate whether lavender essential oil (LEO)—a widely used, therapeutic-grade LEO —modulates muscle-related molecular pathways in vitro. To this end, we examined (i) the skin permeability of LEO constituents using a reconstructed human epidermis model, (ii) the effects of LEO on an IL-6 expression-based in vitro model, and (iii) the broader gene expression changes involved in muscle metabolism, remodeling, and adaptation.

2. Results

2.1. GC–MS-Based Chemical Characterization of Lavender Essential Oil

Component analysis revealed that the two main constituents of the LEO used in this study were linalyl acetate (37.6%) and linalool (28.0%). These results are consistent with the typical chemical profiles reported for Lavandula angustifolia essential oils (Table 1). Together, these two compounds accounted for around 60% of the total composition. This chemical profile is also consistent with that of the lavender EO commonly used in aromatherapy.

Table 1.

The composition of lavender essential oil.

Peak No.	Compound Name	Area (%)
1	α-pinene	0.37
2	Camphene	0.20
3	β-Pinene	0.21
4	Sabinene	0.07
5	Δ-3-carene	0.11
6	Myrcene	0.31
7	Limonene	0.26
8	1,8-Cineole	0.92
10	Cis-β-osimene	2.80
11	γ-Terpinene	0.07
12	Trans-β-osimene	2.94
13	p-Cymene	0.61
17	Matsutake acetate	0.04
18	Cis-3-hexenol	0.92
23	Matsutakeol	0.33
26	Camphor	0.04
28	Linalool	28.01
29	Linalyl acetate	37.60
31	Labanduryl acetate	8.33
38	α-farnesene	2.71
39	Borneol	1.62
42	Nveryl acetate	0.27
43	Geranyl acetate	0.73
45	Nerol	0.12
49	Geraniol	0.31
52	Caryophyllene oxide	0.81
56	Eugenol	0.27
57	α-cadinol	0.04
58	α-eudesmol	0.05
60	Coumarin	0.05

2.2. Evaluation of the Transdermal Permeability of Lavender Essential Oil

Table 2 shows the content of linalool and linalyl acetate, the main components of LEO, in the skin model 60 min after sample application. In the control group treated with jojoba oil alone, both components were completely undetectable (0 µg). In contrast, the group treated with 5% LEO showed detectable levels of linalool (2.20 ± 0.64 µg) and linalyl acetate (3.00 ± 0.77 µg), demonstrating statistically significant differences compared to the control group (p = 0.008 and p = 0.005, respectively).

Table 2.

Evaluation of the Skin Permeability of Lavender Essential Oil by Quantification of Linalool and Linalyl Acetate in a 3D Skin Model.

Test Sample	Linalool Content (µg)			Linalyl Acetate Content (µg)
	Mean	S.D.	p	Mean	S.D.	p
Jojoba oil	0	0	0.008	0	0	0.005
5% lavender essential oil	2.20	0.64	-	3.00	0.77	-
10% lavender essential oil	2.15 *	0.54	N.S.	3.00	1.25	N.S.

p: Significant difference compared to 5% lavender essential oil (n = 3). *: Calculated value excluding undetected values (n = 2). N.S.: Not significant difference compared to 5% lavender essential oil. Red: Significant difference.

In the 10% LEO group, linalool (2.15 ± 0.54 µg) and linalyl acetate (3.00 ± 1.25 µg) were also detected, but no significant difference was observed compared to the 5% group (N.S.: Non-significant difference compared to 5% LEO) (Table 2). In particular, the linalool value for the 10% group was calculated excluding samples not detected (n = 2), requiring caution in interpreting the results. Both the 5% and 10% LEO groups showed significantly higher concentrations of these compounds compared to the jojoba oil group (0 µg), with a statistically significant increase also observed in the 5% group. The 10% group value was equivalent to the 5% group, and statistical analysis was not performed (N.S.). This suggests that transdermal absorption of these components may reach a saturation point at concentrations exceeding 5%. These findings indicate that 5% concentration of LEO is effective in promoting the penetration of aromatic components in the skin model.

Figure 1A shows the concentrations of linalool and linalyl acetate in the acceptor fluid on the skin model after 30 min and 60 min application of 5% and 10% concentrations of LEO. At 30 min, the 5% LEO group showed linalool levels of 3.87 ± 0.13 µg and linalyl acetate levels of 1.62 ± 0.01 µg. In the 10% group, linalool concentration increased significantly to 4.72 ± 0.24 µg (p = 0.011), while linalyl acetate concentration was 1.76 ± 0.09 µg, showing no significant difference compared to the 5% group (p = 0.1935). At 60 min, the concentration of both compounds further increased. In the 5% group, linalool and linalyl acetate levels reached 6.33 ± 0.08 µg and 2.14 ± 0.11 µg, respectively. In the 10% group, linalool reached 8.84 ± 0.21 µg, and linalyl acetate reached 2.39 ± 0.11 µg. These values were significantly higher than those at the 30 min time point (p < 0.01), and linalyl acetate in the 10% group showed a near-significant difference compared to the 5% group at 60 min (p = 0.095). In contrast, no detectable levels of either compound were observed in the control group treated with jojoba oil at any time point (Figure 1A). Figure 1B illustrates the time-dependent changes in the penetration of linalool and linalyl acetate into the skin model. Both compounds showed a progressive increase over time, with consistently higher levels in the 10% lavender EO group compared to the 5% group throughout the experimental period. Asterisks in the figure indicate statistically significant differences (p < 0.05). No components were detected in the jojoba oil control group, confirming the absence of contamination or background levels. These results suggest that the percutaneous penetration of LEO components is influenced by both concentration and exposure time.

Figure 1.

Time-dependent changes in the amount of linalool and linalyl acetate permeating from lavender essential oil into the 3D skin model acceptor fluid. (A) Shows the concentrations of linalool and linalyl acetate in the acceptor fluid after 30-min and 60-min application of 5% and 10% LEO concentrations. (B) Graph showing the time-dependent change in the amount of linalool and linalyl acetate permeating into the acceptor fluid * p < 0.01 vs. 5% LEO, Tukey’s test.

2.3. Stimulatory Effects of Lavender Essential Oil on Myokine Secretion in C2C12 Cells

In an in vitro exercise model, C2C12 myotubes were subjected to electrical pulse stimulation (EPS) for 3 h. Either control jojoba oil or LEO was then added, and the gene expression levels of the representative myokine IL-6 were examined 60 min later. As shown in Figure 2, LEO at concentrations of 0.05% and 0.1% increased IL-6 gene expression in a concentration-dependent manner, compared with the control. However, the addition of linalool or linalyl acetate significantly decreased IL-6 expression at a concentration of 0.1% compared with the control (Figure 2).

Figure 2.

IL-6 gene expression levels after the addition of lavender essential oil (LEO) and their main components to C2C12 cells (following 3 h of electrical pulse stimulation, EPS). After treating C2C12 cells with EPS for 3 h, jojoba oil, LEO, linalool, and linalyl acetate were added to achieve concentrations of 0.01%, 0.05%, and 0.1%, respectively. RNA was extracted after 60 min, and IL6 gene expression was confirmed by RT-PCR. Error bars represent SE (mean ± standard error). ** p < 0.01, * p < 0.05 vs. Jojoba oil, Tukey method (Biological iteration = 3, Technical iteration = 4).

2.4. Number of Genes Altered by Lavender Essential Oil in C2C12 Cells With or Without Electrical Stimulation

Figure 3 shows the changes in gene expression observed in C2C12 cells following LEO supplementation, with or without electrical pulse stimulation (EPS). The number of genes that were either upregulated or downregulated was quantified under both conditions. In the absence of EPS, lavender EO treatment resulted in the upregulation of 1109 genes and the downregulation of 732 genes (Figure 3). In contrast, under EPS conditions, 405 genes were upregulated and 557 genes were found to be downregulated (Figure 3).

Figure 3.

Number of genes whose expression was altered by the lavender essential oil in C2C12 cells under electrical pulse stimulation and without stimulation, as determined by means of DNA microarray analysis. (A) Total RNA was extracted from samples treated with 0.05% LEO for 60 min compared to 0.05% jojoba oil without treatment (LEO + EPS (−)) and from samples treated with 0.05% LEO for 60 min followed by 3 h of EPS treatment compared to 0.05% jojoba oil (LEO + EPS (+)), and DNA microarray analysis was performed on each. (B) Genes whose expression changed with EO treatment compared to jojoba oil are shown in the graph.

2.5. Muscle Function-Related Genes Affected by Lavender Essential Oil Upregulated Genes in EPS-Stimulated C2C12 Cells

DNA microarray analysis revealed distinct gene expression patterns in C2C12 myotubes in response to LEO supplementation, depending on whether or not EPS was present. Notably, LEO treatment under EPS conditions resulted in robust transcriptional activation of several regulatory and exercise-responsive genes, indicating a condition-dependent molecular shift. The most strongly induced genes were Nr4a1 (12.71-fold), Il6 (10.18-fold), and Nr4a2 (10.13-fold), which represented the most prominent transcriptional signatures in the dataset (Table 3). Nr4a1 and Nr4a2 act as important transcriptional regulators that respond to exercise and orchestrate metabolic adaptation, mitochondrial biogenesis and remodeling of the oxidative muscle phenotype. Additionally, muscle-derived IL-6 is a major exercise-induced myokine that regulates glucose uptake, lipid metabolism, mitochondrial biogenesis and satellite cell activation. Ultimately, it contributes to muscle repair and adaptation to contractile activity. Concurrent elevation of these genes indicates activation of a gene program functionally linked to exercise adaptation and cellular plasticity (Table 3A). Taken together, the significant increase in the expression of these genes when EPS and lavender are used together suggests that the two substances enhance molecular pathways associated with metabolic health and muscle endurance synergistically. Furthermore, the upregulation of Capza1, a gene involved in the combined application of lavender and EPS, could promote the remodeling of skeletal muscle fibers and encourage transcriptional profiles consistent with enhanced functional conditioning (Table 3A).

Table 3.

Muscle function-related genes affected by lavender essential oil showing the list of up-/downregulated genes in EPS-stimulated (+)/non-stimulated (−) C2C12 cells. (A): LEO + EPS (+) UP: List of muscle function-related genes whose expression increased after 0.05% LEO treatment for 60 min compared to jojoba oil following 3 h of EPS treatment. (B): LEO + EPS (+) Down: List of muscle function-related genes whose expression decreased after 0.05% LEO treatment for 60 min compared to jojoba oil following 3 h of EPS treatment. (C): LEO + EPS (−) UP: List of muscle function-related genes whose expression increased after 60 min of 0.05% LEO treatment compared to jojoba oil, without EPS treatment. (D): LEO + EPS (−) Down: List of muscle function-related genes whose expression decreased after 60 min of 0.05% LEO treatment compared to jojoba oil, without EPS treatment.

A	EPS (+) Up		B	EPS (+) Down
	Gene Name	AVERAGE Fold		Gene Name	AVERAGE Fold
	Nr4a1	12.71		Myo1a	0.66
	Il6	10.18		Myo1b	0.63
	Nr4a2	10.13		Vav2	0.53
	Neb	8.67		Jam3	0.50
	Egr1	7.41		Gm4532	0.49
	Capza1	5.50		Arvcf	0.44
	Ttn	4.97
	Hes1	4.46
	Hey1	4.11	C	EPS ( −) Up
	Cxcl1	3.86
	Myh2	3.51		Gene Name	AVERAGE Fold
	Slc25a25	3.17		Nr4a1	7.23
	P2rx7	2.99		Il6	5.34
	Slc25a25	2.66		Hey1	3.55
	Neb	2.58		Angptl4	3.39
	Myh1	2.57		Cxcl1	2.13
	Efcab11	2.36		Ttn	1.94
	Frs3	2.23
	Myh3	2.22
	Pde4dip	2.22	D	EPS (−) Down
	Myh7	2.22
	Kdm6b	2.18		Gene Name	AVERAGE Fold
	Ryr1	2.15		Myo1d	0.60
	Syne3	2.13		Myod1	0.47
	Cacna1s	2.11		Myod1	0.50
	Mest	2.06		Myod1	0.58
	Bin3	2.04		Myog	0.69
	Bnip3	2.04		Tnfrsf1a	0.44
	Angptl4	1.94
	Obscn	1.94
	Myh3	1.94		Regulation, Myogenesis, Signaling
	Ccl7	1.93
	Pamr1	1.91		Contractile, Sarcomere, EC coupling
	Myo18a	1.87
	Vegfa	1.78		Metabolic, Mitochondrial
	Myh9	1.76
	Myh8	1.71		Immune, Myokine-like
	Ccl25	1.70
	Myo18b	1.69

2.6. Downregulated Muscle-Related Genes in EPS-Treated C2C12 Cells with Lavender Essential Oil

In the EPS-treated condition, LEO supplementation led to a clear downregulation of a specific cluster of genes, including Myo1a, Myo1b, Vav2, Jam3, Gm4532, and Arvcf, which are associated with cytoskeletal organization, membrane dynamics, and cell–cell adhesion pathways (Table 3B). Myo1a and Myo1b, which are members of the unconventional myosin family, showed reduced expression. This indicates the suppression of genes involved in actin-associated structural and trafficking functions. Additionally, Vav2, which regulates Rho GTPase signaling, and Jam3 and Arvcf, which are related to cell junction stability and cadherin–catenin interactions, exhibited decreased expression (Table 3B). This pattern demonstrates that lavender administration under EPS selectively suppresses genes linked to structural maintenance and adhesion rather than decreasing transcriptional activity broadly.

2.7. Upregulated Muscle-Related Genes in EPS-Treated and Untreated C2C12 Cells with Lavender Essential Oil

In the absence of EPS, LEO supplementation was found to result in the upregulation of a defined group of genes in C2C12 myotubes. Notable increases were observed in the upregulation of Nr4a1 and IL-6, indicating the activation of transcriptional and cytokine response pathways under lavender treatment (Table 3A,C). Hey1, a Notch-associated transcriptional regulator, and Angptl4, a gene related to lipid metabolism, were also elevated (Table 3C). Furthermore, the chemokine gene Cxcl1 and the sarcomeric structural gene Ttn were also found to be upregulated in these conditions (Table 3C). Taken together, these findings demonstrate that LEO alone can selectively induce genes associated with transcriptional regulation, metabolic signaling, inflammatory cytokine responses, and contractile structures in non-stimulated C2C12 cells.

2.8. Downregulated Muscle-Related Genes in EPS-Untreated C2C12 Cells with Lavender Essential Oil

By contrast, LEO supplementation in the absence of EPS resulted in the downregulation of a specific set of genes in C2C12 myotubes. The suppressed transcripts included Myo1d, Myod1, and Myog, which are associated with myogenic regulation and differentiation processes (Table 3D). Additionally, Tnfrsf1a, a receptor gene associated with inflammatory signaling pathways, was also downregulated in this case (Table 3C). These findings suggest that LEO treatment alone can selectively reduce the expression of genes involved in myogenic regulatory signaling and cytokine receptor pathways in non-stimulated C2C12 cells.

3. Discussion

This study provides the first evidence that LEO modulates the molecular pathways involved in skeletal muscle adaptation and recovery in an in vitro exercise model. Three key findings emerged. Firstly, the chemical analysis and permeation assays revealed that LEO contains bioactive constituents that can penetrate the reconstructed epidermal barrier. Secondly, LEO supplementation was found to enhance IL-6 expression in electrically stimulated C2C12 myotubes, indicating an amplified myokine response. Thirdly, transcriptomic profiling revealed distinct patterns of regulatory gene expression depending on whether electrical stimulation was present or not, suggesting that LEO exerts condition-dependent effects.

The GC-MS analysis confirmed the presence of linalyl acetate and linalool as the major physiologically active components, which matches the chemical profile of standard therapeutic-grade LEO commonly used in clinical aromatherapy [6,16]. Furthermore, LEO, which is characterized by its high content of linalool and linalyl acetate, has been demonstrated to have sedative, anti-anxiety, anti-inflammatory, and transdermal absorption properties, making it promising for use in medical aromatherapy beyond simple fragrance applications [17,18]. And, these monoterpene components are small lipophilic molecules, which are known to promote skin penetration [19].

The three-dimensional human skin model used in this study is an in vitro experimental system that reproduces the structural and functional characteristics of human skin and is therefore useful for evaluating the skin permeation of essential oils. Reconstructed human epidermis (RHE) models possess a multilayered structure including a well-differentiated stratum corneum and reproduce key barrier functions of native human skin, such as lipid lamellar organization and keratinocyte differentiation [20]. Accordingly, RHE models enable quantitative assessment of stepwise skin permeation behavior, including the retention of essential oil constituents within the stratum corneum and their subsequent penetration into the viable epidermis [11,21]. In addition, because human-derived 3D skin models are less affected by interspecies differences, they provide high translational relevance to humans and allow evaluation under conditions that more closely reflect clinical use [12].

Previous studies have demonstrated the validity of the SkinEthic^® RHE model for percutaneous absorption assessment. Gabbanini et al. evaluated the skin permeation of essential oils and their major constituents, including linalool and camphor, and confirmed the suitability of this model as an in vitro system for skin permeation studies [11]. Similarly, Valgimigli et al. reported that the incorporation of lemon essential oil into topical emulsions significantly enhanced the permeation of lipid-soluble vitamins through SkinEthic™ RHE, suggesting that essential oils can function as penetration enhancers [21]. Furthermore, Longgos et al. [22] reported that the enhanced skin permeation of naturally derived terpenes is mediated by their high affinity for stratum corneum lipids, enabling passive diffusion, as well as by transient disruption of lipid organization within the stratum corneum. These effects are attributed to multiple mechanisms, including loosening of lipid chains, disruption of hydrogen bonding, and alterations in the hydration state of the skin barrier. Although the precise concentration of LEO constituents reaching skeletal muscle after topical application remains difficult to determine, the permeated amount observed in the RHE model suggests that muscle tissue exposure would occur at relatively low concentrations after tissue distribution and dilution. Therefore, the in vitro concentrations used in this study were designed to model localized cellular exposure and mechanistic responses rather than to directly replicate in vivo muscle concentrations.

In the present study, analysis using the three-dimensional skin model demonstrated that linalool permeated beyond the stratum corneum, whereas linalyl acetate accumulated within the epidermis without migrating into deeper layers. This component-specific and layer-dependent skin distribution provides important insights into the mechanisms underlying the effects of essential oil massage in sports aromatherapy. Volatile components retained in the superficial skin layers may indirectly influence muscle function and recovery through olfactory stimulation and cutaneous sensory input, whereas components such as linalool that penetrate the stratum corneum may reach subcutaneous tissues or areas adjacent to muscle tissue and potentially modulate exercise-induced myokine responses, including IL-6. Collectively, these findings suggest that the rational selection of essential oils based on their skin permeation characteristics may optimize myokine responses involved in post-exercise muscle conditioning and recovery, thereby providing a molecular basis for evidence-based sports aromatherapy.

However, Schmook et al. reported that the SkinEthic RHE model exhibits higher permeability than native human skin, leading to a tendency to overestimate permeation levels compared with in vivo conditions [23]. Therefore, as a future perspective, in vivo studies using animal models may be required to more comprehensively evaluate the skin permeation of essential oils under various experimental conditions. Aromatherapy, which utilizes aromatic plant extracts and essential oils to support physical and psychological health, has recently attracted attention as a novel conditioning strategy aimed at enhancing post-exercise recovery, particularly among athletes. Clinical and experimental studies have suggested that essential oils may contribute to mood regulation, fatigue reduction, alleviation of muscle soreness, and promotion of post-exercise recovery and relaxation, supporting their potential role as complementary interventions in sports medicine and athletic training [24,25,26].

Specifically, peppermint and eucalyptus essential oils have been reported to exhibit analgesic and anti-inflammatory properties, which may help reduce exercise-induced muscle soreness and discomfort [27,28]. In contrast, LEO is well known for its anxiolytic and sedative effects and has been associated with enhanced relaxation and improved sleep quality following exercise—both of which are critical components of effective recovery strategies [29,30]. However, most of these reported benefits are based on subjective assessments or systemic physiological responses. To date, molecular-level evidence directly linking aromatherapy to skeletal muscle adaptation mechanisms, such as myokine regulation or metabolic remodeling, remains limited [31]. Thus, further mechanistic studies are required to clarify how aromatherapy may influence muscle-specific recovery and adaptation processes.

Sports aromatherapy is a complementary intervention that utilizes essential oils in combination with massage and/or olfactory stimulation, with the aim of promoting post-exercise recovery, relaxation, and physical conditioning [32,33]. In recent years, skeletal muscle has been recognized as an endocrine organ that secretes myokines in response to exercise or contractile stimuli [34]. Accordingly, myokines have attracted considerable attention as key molecular mediators underlying recovery and adaptive processes following exercise [35]. Myokines are defined as cytokines and peptide factors that are produced and secreted by skeletal muscle cells in response to exercise or contractile stimulation. These molecules exert autocrine effects on muscle cells themselves, paracrine effects on neighboring tissues, and endocrine effects on distant organs—including the liver, adipose tissue, brain, and immune system—via the circulation. This concept, originally proposed by Pedersen and Febbraio, established a new paradigm in which skeletal muscle is recognized not merely as a locomotor organ but also as an endocrine organ with secretory functions [31,34].

Among myokines, IL-6 is one of the most representative and well-characterized factors robustly induced during exercise. Skeletal muscle-derived IL-6 is released in response to contractile activity and functions not only as an inflammatory cytokine but also as a metabolic regulator, thereby redefining skeletal muscle as an endocrine organ [31]. Exercise-induced IL-6 has been shown to regulate a wide range of physiological processes, including mitochondrial biogenesis, glucose uptake, lipid oxidation, and stimulation of lipolysis, contributing to systemic energy homeostasis [31,35]. Furthermore, IL-6 plays an important role in muscle adaptation and regeneration by regulating immune responses and promoting the activation and proliferation of muscle satellite cells after exercise and muscle injury [35,36]. In vitro studies using electrically stimulated myotubes have shown that IL-6 expression is consistently elevated in response to contractile-like stimuli, supporting its role as a molecular marker of exercise responsiveness at the cellular level [37]. Taken together, these findings suggest that increased IL-6 expression is a core myokine mediating metabolic adaptation, tissue remodeling, and recovery processes associated with physical activity.

In the present study, LEO significantly enhanced IL-6 expression under exercise-like conditions induced by electrical pulse stimulation (EPS) when compared with the control jojoba oil. IL-6 is widely recognized as a contraction-induced myokine that plays a central role in exercise-associated metabolic regulation, including mitochondrial biogenesis, glucose uptake, lipid metabolism, and satellite cell activation [35,38,39]. Therefore, the observed increase in IL-6 expression suggests that lavender essential oil does not merely act as a sensory or cosmetic stimulus, but may actively modulate intracellular signaling pathways involved in exercise adaptation.

Interestingly, although significant increases in IL-6 expression were also observed when the major constituents of LEO, linalool and linalyl acetate, were administered individually, the magnitude of IL-6 induction was consistently greater following treatment with the whole essential oil. This finding indicates that the complete phytochemical matrix of LEO, rather than isolated single components, is critical for sufficiently activating exercise-responsive molecular pathways [40,41,42]. Such synergistic effects are a recognized characteristic of essential oils [40,41], and interactions between linalool and linalyl acetate have also been reported to contribute to the biological activity of LEO [42,43].

The results of the whole-genome DNA microarray analysis further supported this interpretation. Under EPS conditions, LEO robustly induced the expression of Nr4a1 [44], Nr4a2, and IL-6, genes that are well known to respond to contractile activity and to play central roles in metabolic remodeling and skeletal muscle plasticity [38,45]. In contrast, genes related to cytoskeletal anchoring and cell–cell adhesion were downregulated, suggesting a transient loosening of structural constraints that may facilitate tissue remodeling [46,47]. Collectively, this coordinated gene expression profile is indicative of a priming response, enabling skeletal muscle cells to transition toward a more metabolically adaptive state following contractile stimulation [48].

By contrast, LEO treatment in non-stimulated C2C12 cells elicited a distinct transcriptional signature characterized by the selective induction of transcriptional regulators (Nr4a1 and Hey1), metabolic modulators (Angptl4), and inflammatory mediators (Cxcl1), accompanied by suppression of myogenic differentiation markers such as Myod1 and Myog [49,50,51]. This pattern indicates that LEO does not directly mimic exercise-induced transcriptional programs, but instead modulates muscle gene expression in a stimulus-dependent manner. Such context-specific effects suggest a regulatory role rather than a direct pharmacological or anabolic action, for the LEO [52].

Taken together, these findings provide molecular evidence that LEO may support post-exercise muscle conditioning by enhancing myokine release and promoting gene expression programs associated with recovery and endurance-related adaptation [38,44,53]. Given the widespread clinical application of aromatherapy in sports massage and rehabilitation settings, the observed ability of LEO to augment muscle-derived signaling pathways may help explain subjective reports of improved recovery, relaxation, and readiness for subsequent performance [54,55]. Nevertheless, several limitations should be acknowledged. The present study was conducted exclusively under in vitro conditions, and it remains unclear whether transdermally absorbed essential oil components can reach skeletal muscle at physiologically relevant concentrations in vivo [56]. Furthermore, the mechanistic pathways linking dermal exposure to intracellular muscle signaling require further elucidation, including the identification of potential receptors, the contribution of sensory–neural pathways, and detailed dose–response relationships [57,58,59]. Addressing these issues in future in vivo and clinical studies will be essential to fully clarify the translational relevance of these findings.

4. Materials and Methods

4.1. GC–MS Analysis of Lavender Essential Oil

The LEO used in this study was analyzed using a GC-MS-QP2010 SE gas chromatography–mass spectrometry system (Shimadzu, Kyoto, Japan). The analytical parameters follow established methods for profiling LEO, whose principal constituents—linalool and linalyl acetate—have been widely documented in chemical characterization studies [60]. Component identification was based on reference standards and mass spectral library comparisons, consistent with validated GC–MS approaches for essential oil compositional analysis [60,61].

4.2. Assessment of Lavender Essential Oil Skin Permeability in a 3D Cultured Skin Model

To evaluate the dermal permeability of LEO, a Reconstructed Human Epidermis (RHE) model (SkinEthic™ RHE) was used. The RHE system is widely recognized as a reliable in vitro alternative model for human skin and is routinely used in percutaneous absorption testing, irritation testing, and essential oil permeability studies [62,63,64]. Jojoba oil, linalool, and linalyl acetate at 5% and 10% concentrations were applied to the stratum corneum. Quantification of linalool and linalyl acetate in the skin model was performed after 60 min. Additionally, 5% and 10% concentrations of jojoba oil, linalool, and linalyl acetate were applied to the stratum corneum, and the permeation of linalool and linalyl acetate into the acceptor fluid was analyzed at 30 and 60 min. The concentrations of linalool and linalyl acetate were quantified using LC-MS (LCMS-2020, Shimadzu, Kyoto, Japan). Previous studies have demonstrated that monoterpenoids such as linalool exhibit detectable skin permeability in reconstructed epidermis tests [62,63,64].

4.3. Cell Culture

The C2C12 cells are a subclone differentiated by H. Blau et al. [65] from a mouse myoblast cell line established by D. Yaffe and O. Saxel from the leg muscles of normal adult C3H mice [66]. This cell line differentiates rapidly, forming extensive contractile myotubes that express characteristic myofibrillar proteins. This clone provides an excellent model for studying myogenesis and cell differentiation in vitro. C2C12 cells were cultured under standard proliferation and differentiation conditions. The differentiated myotubes are an established model for analyzing molecular responses to exercise-like stimuli, including metabolic and transcriptional changes [67]. The cell culture method used in this experiment is based on the protocols of Fujii et al. and Nedachi et al. [45,68]. C2C12 cells were seeded at 1.25 × 10⁵ cells/well in 4-well plates and cultured in 5 mL of Dulbecco’s Modified Eagle’s Medium (DMEM, 4.5% glucose) supplemented with 10% fetal bovine serum (FBS) and 30 μg/mL penicillin–streptomycin at 37 °C under 5% CO₂ conditions. After 3 days, cells reaching 80–90% confluence were transferred to 5 mL of DMEM (1.0% glucose) supplemented with 2.0% horse serum (HS) and 30 μg/mL penicillin–streptomycin at 37 °C under 5% CO₂ conditions. The medium was changed every other day, and the cells were differentiated for 7–9 days until myotubes became visible.

4.4. Preparation of Essential Oil Samples

LEO was dissolved in a 10% dimethyl sulfoxide (DMSO) solution and prepared as a 10% (v/v) sample solution. Jojoba oil, used as the carrier oil, was similarly dissolved in a 10% DMSO solution and prepared as a 10% (v/v) sample solution. Linalool and linalyl acetate were adjusted in jojoba oil to contain 45.57% linalool and 27.73% linalyl acetate, according to the attached composition (Table 1). They were then dissolved in a 10% DMSO solution to form a 10% (v/v) sample solution.

MTT Assay

We seeded C2C12 cells at 2.0 × 10³ cells/well in a 96-well plate and cultured them at 37 °C with 5% CO₂ until 70–80% confluence using medium containing 100 μL of DMEM, supplemented with 10% FBS and 30 μg/mL penicillin–streptomycin. The above 10% LEO and 10% jojoba oil adjusted sample solutions were added to a final concentration of 0.01–1% (oil concentrations equivalent to 0.1–10 mg/mL). The DMSO concentration in the medium for the LEO and jojoba oil-added groups was 0.01%. After sample addition, the cells were incubated at 37 °C and 5% CO₂ for 1 and 2 h, after which the MTT assay was performed. The MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (Roche Life Science, Mannheim, Germany) labeling reagent (1×) was added at 10 µL/100 µL in a 96 well-microplate and incubated at 37 °C and under 5% CO₂ for 4 h. Subsequently, 100 μL/well of solubilizing solution (0.01 M HCl, 10% SDS) was added and incubated for 17 h at 37 °C under 5% CO₂. Post-incubation, the absorbance at 570 nm was measured on an iMark microplate reader (Bio-Rad, CA, USA) at a reference wavelength of 650 nm. The number of viable cells in the group to which DMSO-free phosphate-buffered saline (PBS) was added was set at 100, and the average cell viability (%) when the evaluation sample was added was calculated (n = 12) (Figure 4).

Figure 4.

Toxicity evaluation of the lavender essential oil on C2C12 cells using the MTT assay. Results from the MTT assay confirming cell viability in the jojoba oil and LEO addition groups compared to the PBS addition group are shown. Evaluation was performed at 1 h (upper graph) and 2 h (lower graph) after jojoba oil and LEO addition. Typically, cytotoxicity is determined when cell viability falls below 70%. Based on these results, LEO was found to be toxic at concentrations of 0.25% or higher after a 2 h treatment. Therefore, for this study, LEO concentrations were set to 0.1% or lower. Error bars represent SE (mean ± standard error). ** p < 0.01, * p < 0.05 vs. PBS, Tukey method.

4.5. Electric Pulse Stimulation (EPS) Treatment

The EPS treatment protocol for C2C12 cells was performed using the same method as described by Nedachi et al. and Fujita et al. [45,68]. After differentiating C2C12 cells in a 4-well plate (Thermo Scientific Nunc, Rochester, NY, USA), the medium was removed and 5 mL of serum-free DMEM was added. After 2 h, the medium was removed and 5 mL of freshly prepared serum-free DMEM was added. C-Dish carbon electrodes and C-Pace EM were placed in a well plate and connected to a C-Pace pulse generator (C-Pace 100; IonOptix, Milton, Westwood, MA, USA). EPS treatment was performed at 37 °C, 5% CO₂ for 3 h at 1 Hz, 2 ms, 40 V. After the 3 h EPS treatment, adjusted 10% (v/v) sample solution was added to each well. After addition to achieve final sample concentrations of 0.01%, 0.05%, and 0.1% (oil concentrations equivalent to 0.1, 0.5, and 1 mg/mL), incubation was continued for an additional 60 min at 37 °C under 5% CO₂ conditions.

4.6. RT-PCR Analysis

After EPS treatment, the medium was immediately removed, washed twice with PBS at 37 °C, and total RNA was extracted using the RNeasy Micro Kit (74104, Qiagen, Hilden, Germany). RNA quality was confirmed by measuring yield and purity using a DS-11 spectrophotometer (DeNovix, Wilmington, DE, USA) and further verified by means of formaldehyde–agarose gel electrophoresis. cDNA was synthesized using the Affinity Script QPCR cDNA Synthesis Kit (Agilent, CA, USA) with the extracted RNA as template. PCR products targeting GAPDH (forward (5′-3′): gctacactgaggaccaggttttgt, reverse (3′-5′): ctcctgttattatgggggtctg) and IL6 (forward (5′-3′): aggataccactcccaacaga, reverse (3′-5′): ctgaaggataccactctggctttgtct) were separated on a 1.6% agarose gel, visualized using ethidium bromide staining on a ChemiDoc XRS+ (BioRad, CA, USA) system with Image Lab software version 5.2.1 (BioRad, CA, USA) [69,70], and quantified as representative of contraction-induced myokines [71,72]. IL-6 expression consistently increases during exercise-like stimulation and is widely used as a molecular marker of muscle tubule responsiveness to EPS [45,68,73].

4.7. DNA Microarray Analysis

Total RNA was extracted as described above. To verify the quality of this RNA, yield and purity were determined spectrophotometrically with DS-11 (DeNovix, Wilmington, DE, USA) and confirmed using formaldehyde-–agarose gel electrophoresis. To check the quality of the synthesized cDNA using the Affinity Script QPCR cDNA synthesis kit (600559, Agilent, CA, USA), PCR reaction was performed to confirm the expression of housekeeping genes (beta-actin or GAPDH) using Emerald Amp PCR Master (RR300A, Takara, Shiga, Japan). PCR products were separated on a 1.6% agarose gel and visualized with ethidium bromide staining under UV light [74,75]. Total RNA extracted from C2C12 cells for each control and treatment (n = 3) was pooled in each group, prior to DNA microarray analysis (Whole Mouse Genome DNA microarray 4 × 44 K Ver. 2.0). The microarray experiment was described previously in the studies of Ogawa et al. and Hori et al. [74,75]. Total RNA (400 ng) was labeled with either Cy3 or Cy5 dye using an Agilent Low RNA Input Fluorescent Linear Amplification Kit (Agilent, CA, USA). Fluorescently labeled targets of control as well as treated samples were hybridized to the same microarray slide with 60 mer probes. A flip labeling (dye-swap or reverse labeling with Cy3 and Cy5 dyes) procedure was followed to nullify the dye bias associated with unequal incorporation of the two Cy dyes into cDNA. Briefly, to select differentially expressed genes using the dye-swap approach, hybridization and wash processes were performed according to the manufacturer’s instructions, and hybridized microarrays were scanned using an Agilent Microarray scanner G2505C. For the detection of significantly differentially expressed genes between control and treated samples, each slide image was processed using Agilent Feature Extraction software (version 9.5.3.1). This program measures Cy3 and Cy5 signal intensities of whole probes. Dye-bias tends to be signal intensity dependent; therefore, the software selected probes using a set by rank consistency filter for dye normalization. Said normalization was performed by means of LOWESS (locally weighted linear regression), which calculates the log ratio of dye-normalized Cy3- and Cy5-signals, as well as the final error of log ratio. The significance (p) value was based on the propagate error and universal error models. In this analysis, the threshold of significant differentially expressed genes was <0.01 (for the confidence that the feature was not differentially expressed). In addition, erroneous data generated due to artifacts were eliminated before data analysis using the software. The Functional_Categories (KEYWORDS) and pathway (KEGG pathway) of the list of variable genes selected through microarray analysis were analyzed using Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.8.

4.8. DNA Microarray Data

The gene expression datasets generated and analyzed in this study are available in the Gene Expression Omnibus (GEO) repository under accession number GSE273992 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE273992) (accessed on 26 December 2025). All data are publicly accessible.

5. Conclusions

In conclusion, this study provides new evidence that lavender EO modulates muscle-related molecular responses in an in vitro exercise model. Lavender EO supplementation was found to enhance IL-6 expression in response to EPS stimulation, inducing distinct transcriptional signatures associated with muscle adaptation, metabolic remodeling and structural regulation. This report focused on the myokine IL-6, whose expression increases with LEO, because among numerous myokines, IL-6 is the most strongly associated with exercise. It was established as the first myokine identified to be secreted into the bloodstream in response to muscle contraction and to exhibit anti-inflammatory effects [76]. The discrepancy between the robust induction of IL-6 mRNA expression by whole LEO and the limited effects observed when its major constituents, linalool and linalyl acetate, were tested individually highlights the complexity of essential oil-mediated biological responses. Although linalool and linalyl acetate together account for more than 60% of LEO, these findings suggest that the IL-6-enhancing effect cannot be sufficiently explained by the actions of the major components alone. One possible contributing factor is that minor constituents, despite their lower abundance, may exert disproportionately strong biological effects or modulate key signaling pathways involved in the regulation of exercise-responsive myokines. Furthermore, interactions among multiple components within the complete essential oil may give rise to synergistic or emergent biological effects that are not reproduced by single compounds. Such synergistic interactions may influence membrane permeability, intracellular uptake, or downstream signaling events under EPS conditions, thereby amplifying IL-6 gene expression. In this DNA microarray analysis, more muscle function-related genes were detected in the LEO + EPS (−) group compared to the LEO + EPS (+) group. In the context of the above findings, it is considered that exercise activates the genes related to mitochondrial synthesis and angiogenesis while restricting other unnecessary pathways. However, since more muscle function-related genes, such as myokines, were detected in the LEO + EPS (+) group, we believe synergistic effects can also be expected from the LEO + EPS (+) treatment.

Future studies comparing whole LEO with reconstituted mixtures containing only linalool and linalyl acetate would be valuable for elucidating the relative contributions of minor constituents and component–component interactions. Furthermore, component and permeation analyses revealed that the main constituents of LEO, particularly linalool, can penetrate a reconstructed skin barrier, suggesting the potential for transdermal delivery. The observation that skin permeation plateaued at LEO concentrations exceeding 5% provides practical guidance for sports aromatherapy, indicating that higher concentrations do not necessarily result in greater tissue exposure and may be unnecessary. Together, these findings suggest that LEO could be used to support post-exercise muscle conditioning by influencing exercise-responsive signaling pathways. Although these results were obtained in vitro, they provide a molecular basis for the therapeutic use of LEO in sports massage, recovery strategies and integrative exercise care. Further in vivo research and clinical trials are necessary to determine its functional significance, optimal application parameters, and relevance in athletic and rehabilitation settings.

Author Contributions

Conceptualization, F.T. and S.S.; methodology, J.S., M.Y. and M.K.; software, J.S.; validation, J.S. and F.T.; formal analysis, J.S. and M.Y.; investigation, F.T., J.S. and M.Y.; resources, F.T., S.S. and Y.C.; data curation, J.S. and M.Y.; writing—original draft preparation, F.T. and J.S.; writing—review and editing, R.R., M.K., Y.Y. and T.H.; supervision, F.T.; project administration, F.T.; funding acquisition, F.T. and S.S. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

This study was performed under the strict guidelines of the Hoshi University of Pharmacy and Life Sciences Animal Ethics Review Board.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the article. The raw data are available upon reasonable request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This study was funded in part by a Grant-in-Aid for Scientific Research (C) (24K14491, to F.T.).