Abstract
Early and rapid diagnosis of drug resistance in tuberculosis (TB) plays a key role in reducing the spread of resistance and enabling effective treatment. The aim of this study was to investigate mutations in drug resistance-associated gene regions of Mycobacterium tuberculosis complex (MTBC) isolates resistant to at least two first-line anti-tuberculosis drugs through sequence analysis, in order to characterize the core molecular features of these strains in the region and to identify previously unreported, geographically distinct novel mutation sites. The drug susceptibility of 23 clinical isolates was assessed using the BACTEC MGIT 960 system, and resistance-associated point mutations were identified through DNA sequence analysis and comparison with GenBank reference sequences. AAG → AGG mutation was detected in the rpsL gene region at codon 43 (n = 7) and codon 88 (n = 1). Additionally, GAG → GCG point mutation was identified at codon 70 (n = 2), representing a new region not previously reported in the literature. The most frequent mutation was AGC → ACC at katG codon 315 (n = 10), followed by a C → T substitution at position −15 of the inhA promoter region (n = 4). Additionally, TCG → TTG at rpoB codon 531 (n = 4) and ATG → GTG at embB codon 306 (n = 1) were detected. The detection of resistance-associated mutations is essential for controlling drug-resistant tuberculosis. In this study, a novel rpsL mutation (GAG → GCG) at codon 70 and a previously unreported codon 88 mutation in our country were identified, contributing to the understanding of molecular resistance mechanisms and epidemiology.
Keywords: M. tuberculosis, mutation, rpsL codon 70, rpsL codon 88, sequence analysis
1. Introduction
Tuberculosis (TB) is a bacterial disease caused by a single pathogen, Mycobacterium tuberculosis (M. tuberculosis). It is reported that approximately 10 million people worldwide contract TB each year, and despite being preventable and treatable, it causes the death of nearly two million people [1]. TB has a high mortality rate (50%) when left untreated. Approximately 88% of TB patients can be successfully treated with the recommended standard anti-TB drug regimens [1]. The first-line anti-TB drugs used in the treatment regimen are streptomycin (SM), isoniazid (INH), rifampicin (RIF), pyrazinamide (PZA), and ethambutol (EMB). The long-term and combined use of these drugs causes the emergence and spread of drug-resistant strains [2]. Mutations in the genome of Mycobacterium tuberculosis complex (MTBC) isolates are associated with resistance to widely used anti-TB drugs in TB treatment. The resulting changes at the genetic level caused by these mutations lead to the development of drug resistance [3]. Drug-resistant TB is a major problem worldwide, and negatively affects treatment and control programs [4]. Early and rapid diagnosis of drug resistance plays a key role in reducing its spread and enabling effective treatment [5]. SM, one of the first-line anti-TB drugs, is an aminoglycoside drug that inhibits protein synthesis. SM resistance is associated with mutations in the rpsL, rrs, and gid gene regions [5]. Mutations occurring in the rrs gene (which encodes the 16S rRNA of the ribosomal protein) and the rpsL gene (which encodes the ribosomal S12 protein) are primarily responsible for 60–70% of SM resistance [4]. INH is a prodrug that inhibits mycolic acid synthesis and is activated by the catalase/peroxidase enzyme encoded by the katG gene. In INH resistance, various gene regions such as katG, inhA, kasA, ndh, and efpA are responsible [3]. INH resistance most frequently occurs in the katG and inhA genes. Specifically, the S315T mutation in the katG gene is responsible for 50–90% of cases [3]. INH resistance reduces the likelihood of treatment success and increases the risk of resistance to other anti-TB drugs such as RIF and multidrug-resistant (MDR)-TB [6]. RIF is a drug commonly used in the treatment regimen, and the rpoA, rpoB, rpoC, and rpoZ gene regions are implicated in RIF resistance. Mutations occurring in the rpoB gene, which encodes the beta subunit of RNA polymerase, are responsible for approximately 90–100% of cases. The development of RIF resistance is a significant problem in the control of TB [7]. Furthermore, EMB is a drug that inhibits arabinosyl transferase in the cell wall. The arabinosyl transferase enzyme is encoded by the embCAB operon gene region and is associated with the biosynthesis of arabinogalactan and lipoarabinomannan. Mutations occur in the embB gene region in approximately 50–70% of M. tuberculosis isolates [8]. The early and rapid diagnosis of drug resistance plays a crucial role in reducing the spread of resistance and establishing effective treatment [9]. In recent years, it has become possible to conduct comprehensive research targeting specific resistance quickly using molecular methods [9,10,11].
This study aims to investigate, through sequence analysis, mutations in drug resistance-associated gene regions in M. tuberculosis complex (MTBC) isolates resistant to at least two first-line anti-TB drugs. The objectives are to characterize the core molecular features of these strains in the region, assess the coverage of routinely used targeted gene-based resistance testing for local isolates, and explore the presence of previously unreported, geographically distinct novel mutation sites.
2. Materials and Methods
Ethical approval for this study was obtained from the Mersin University Rectorate, Clinical Research Ethics Committee Presidency, with approval number 2024/873 dated 18 September 2024. This study was conducted using archived clinical isolates of M. tuberculosis. All procedures involving pathogenic microorganisms were performed in compliance with national and international biosafety regulations under appropriate biosafety level (BSL) conditions and institutional laboratory safety guidelines.
2.1. Clinical Isolates
The study included clinical isolates with MTBC growth detected in the culture of clinical specimens sent to the Mycobacteriology Laboratory of Mersin University Hospital between 2016 and 2024 with a suspicion of TB. Löwenstein–Jensen (LJ) medium and the BACTEC MGIT 960 (Becton Dickinson, Franklin Lakes, NJ, USA) liquid automated system were used for the culture process. According to the culture results, 616 MTBC clinical isolates were detected. The susceptibility of the clinical isolates to the first-line anti-TB drugs SM, INH, RIF, and EMB was determined using the BACTEC MGIT 960 system [12]. Of the 616 MTBC clinical isolates, 87 were resistant to at least one of the first-line anti-TB drugs. Twenty-three clinical isolates determined to be resistant to at least two of the first-line anti-TB drugs were included in the study.
2.2. DNA Extraction of M. tuberculosis
The passages from the culture collection of the clinical isolates included in the study, which were stored at 4 °C, were subcultured onto LJ medium and incubated at 37 °C for four weeks. The rapid DNA extraction protocol was applied to the M. tuberculosis colonies grown on LJ medium. One loopful of colony was suspended in 1 mL of sterile distilled water, and the suspension was held at 80 °C for 20 min to ensure bacterial lysis. The suspension was then centrifuged at 12,000× g for 10 min, and the supernatant was discarded. Following this, 200 μL of chloroform and 200 μL of sterile distilled water were added to the pellet, and the sample was centrifuged again at 12,000× g for 10 min. The supernatant portion was transferred to a new sterile microcentrifuge tube and stored at −20 °C until it was used for molecular studies [13].
2.3. Investigation of Gene Regions Responsible for Drug Resistance
2.3.1. First-Line Anti-TB Primer Design
Nucleotide sequences of the primer used in this study are given in Table 1.
Table 1.
Gene regions, nucleotide sequences, and amplification characteristics of primers used for PCR amplification and detection of drug-resistant M. tuberculosis strains.
| Drug | Gene Regions | Nucleotide Sequence (5′-3′) | Annealing Temp (°C) | PCR Product Size (bp) | Reference |
|---|---|---|---|---|---|
| SM | rpsL | Forward: CCAACCATCCAGCAGCTGGT Reverse: ATCCAGCGAACCGCGGATGA |
62 | 306 | [14] |
| rrs (530) | Forward: GATGACGGCCTTCGGGTTGT Reverse: TCTAGCTGCCCGTATCGCC |
62 | 238 | ||
| rrs (912) | Forward: GTAGTCCACGCCGTAAACGG Reverse: AGGCCACAAGGAACGCCTA |
62 | 240 | ||
| INH | katG | Forward: GAAACAGCGGCGCTGATCGT Reverse: GTTGTCCCATTTCGTCGGGG |
54 | 209 | [15] |
| inhA | Forward: CCTCGCTGCCCAGAAAGGGA Reverse: ATCCCCCGGTTTCCTCCGGT |
64 | 248 | ||
| RIF | rpoB | Forward: TCGCCGCGATCAAGGAGT Reverse: GTGCACGTCGCGGGACCTCCA |
62 | 158 | [15] |
| EMB | embB (B1) | Forward: CCGACCACGCTGAAACTGC Reverse: GTAATACCAGCCGAAGGGATCCT |
63 | 364 | [16] |
SM: Streptomycin; INH: Isoniazid; RIF: Rifampicin; EMB: Ethambutol.
2.3.2. Determining SM Resistance
The rpsL gene region was amplified with specific primers [14]. The standard PCR reaction for the gene region was performed in a final volume of 50 µL, containing 5 µL of 10× PCR buffer, 3 µL of 25 mM MgCl2, 1 µL of 10 mM dNTP mix, 0.5 µL of each primer (100 pmol/µL), 0.25 µL of Taq DNA polymerase (5 U/µL), and 3 µL of extracted template DNA, with nuclease-free water added to reach the final volume. The conditions used for the amplification of this region were initial denaturation at 95 °C for 5 min, followed by 42 cycles of denaturation at 94°C for 30 s, primer annealing at 62 °C for 30 s, chain elongation at 72 °C for 45 s, and holding at 4°C. The amplicons were then held at 4 °C for subsequent electrophoresis [14].
2.3.3. Determining INH Resistance
The katG and inhA gene regions were amplified using the primer pairs TB86-TB87 and TB92-TB93, respectively [15]. The standard PCR reaction for the gene region was performed in a final volume of 50 µL, containing 5 µL of 10× PCR buffer, 3 µL of 25 mM MgCl2, 1 µL of 10 mM dNTP mix, 0.5 µL of each primer (100 pmol/µL), 0.25 µL of Taq DNA polymerase (5 U/µL), and 3 µL of extracted template DNA, with nuclease-free water added to reach the final volume. The conditions used for the amplification of both regions were initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 s, primer annealing at 54 °C (katG) and 64 °C (inhA) for 30 s, chain elongation at 72 °C for 45 s, and holding at 4 °C. The amplicons were then held at 4 °C for subsequent electrophoresis.
2.3.4. Determining RIF Resistance
The rpoB gene region was amplified using the primer pair TR9-TR8 [15]. The standard PCR reaction for the gene region was performed in a final volume of 50 µL, containing 5 µL of 10× PCR buffer, 3 µL of 25 mM MgCl2, 1 µL of 10 mM dNTP mix, 0.5 µL of each primer (100 pmol/µL), 0.25 µL of Taq DNA polymerase (5 U/µL), and 3 µL of extracted template DNA, with nuclease-free water added to reach the final volume. The conditions used for the amplification of the gene region were initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 s, primer annealing at 62 °C for 30 s, chain elongation at 72 °C for 45 s, and holding at 4 °C. The amplicons were then held at 4 °C for subsequent electrophoresis.
2.3.5. Determining EMB Resistance
The embB gene region was amplified using the embB1 primer [16]. The standard PCR reaction for the gene region was performed in a final volume of 50 µL, containing 5 µL of 10× PCR buffer, 3 µL of 25 mM MgCl2, 1 µL of 10 mM dNTP mix, 0.5 µL of each primer (100 pmol/µL), 0.25 µL of Taq DNA polymerase (5 U/µL), and 5 µL of extracted template DNA, with nuclease-free water added to reach the final volume. The conditions used for the amplification of the gene regions were initial denaturation at 95 °C for 7 min, followed by 35 cycles of denaturation at 95 °C for 1 min, primer annealing at 63 °C for 1 min, chain elongation at 72 °C for 5 min, and holding at 4 °C. The amplicons were then held at 4 °C for subsequent electrophoresis.
2.3.6. Agarose Gel Electrophoresis
The amplicons obtained after PCR were subjected to electrophoresis on a 1% agarose gel with ethidium bromide at 120 volts for 30 min. After electrophoresis, the gel was imaged with an imaging system (Vilber Lourmat Marne La Vallée, Collegien, France). A 100 bp marker (Thermo Scientific™ Gene Ruler 100 bp DNA Ladder, Thermo Fisher Scientific Inc., 168 Third Avenue, Waltham, MA, USA) was used to determine the band size. The visualization of DNA bands of the lengths presented in Table 1 was considered a positive result (Table 1).
2.3.7. DNA Sequence Analysis
The specific sequences belonging to the relevant gene regions obtained were examined through DNA sequence analysis. After the gene regions responsible for drug resistance were amplified using PCR, the resulting specific sequences were subjected to “Cycle Sequence” PCR using appropriate primers for the sense and antisense strands, utilizing the “BigDye Terminator v3.1 Cycle Sequencing Kit” (Applied Biosystems, Foster City, CA, USA), which contains labeled dideoxynucleotides.
2.3.8. Analysis of Sequence Analysis Data
In the CLUSTAL X (Version 1.83) program, both strands that had undergone sequence analysis were aligned by matching them against each other. Subsequently, the final consensus sequence was recorded in a DNA sequence analysis program such as GENDOC (version 2.6.002) after the unaligned sequences at the ends were trimmed. These sequenced gene regions from each clinical isolate were compared with the reference M. tuberculosis H37Rv sequence data published in the PubMed GenBank database to determine specific nucleotide changes and other possible polymorphic regions in the gene region responsible for drug resistance.
3. Results
Twenty three MTBC isolates that were found to be resistant to at least two first-line anti-TB drugs using the BACTEC MGIT 960 system were included in this study. Of these isolates, seven (30.5%) were obtained from female patients and sixteen (69.5%) were obtained from male patients. A total of Twenty-two (95.6%) of the cases were pulmonary TB, while one (4.3%) was extrapulmonary. The number of male and female patients, the average age of the patients, and the site of disease involvement are provided in Table 2.
Table 2.
Number of male and female patients, average ages, and disease location information of the 23 clinical isolates included in the study.
| Disease Location | |||
|---|---|---|---|
| Average Ages | Pulmonary | Extrapulmonary | |
| Male (n = 16) | 57 (min: 34, max: 79) | 15 (65.2%) | 1 (4.3%) |
| Female (n = 7) | 43 (min: 25, max: 57) | 7 (30.5%) | --- |
Of the 23 clinical isolates, 18 (78.3%) were resistant to two drugs and five (21.7%) were resistant to three drugs. Furthermore, five (21.7%) of these clinical isolates were identified as MDR-TB (Table 3).
Table 3.
The resistance profiles of 23 isolates determined to be resistant to at least two first-line anti-TB drugs.
| First-Line Anti-TB Drug | Resistant |
|---|---|
| SM+INH | 14 (60.9%) |
| INH+RIF | 2 (8.7%) |
| SM+EMB | 3 (13.1%) |
| SM+RIF+EMB | 1 (4.3%) |
| SM+INH+RIF | 3 (13%) |
| Total | 23 (100%) |
SM: Streptomycin; INH: Isoniazid; RIF: Rifampicin; EMB: Ethambutol.
Genetic resistance was detected in 10 of the 21 clinical isolates phenotypically resistant to SM. Of the ten patients in whom resistance was detected, six were male and four were female, and all were diagnosed with pulmonary TB. Eight of the patients were of Turkish nationality, while two were of Russian nationality. Phenotypic drug susceptibility testing detected resistance to SM+INH in seven patients, SM+INH+RIF in two patients, and SM+RIF+EMB in one patient. In seven of these isolates, an AAG → AGG (Lysine [Lys] → Arginine [Arg]) substitution was detected at codon 43 of the rpsL gene region, which is the most frequently mutated site, and in one isolate an AAG → AGG (Lys → Arg) mutation was detected at codon 88 of the same gene region. Furthermore, a point mutation in the form of a GAG → GCG (Glutamate [Glu] → Alanine [Ala]) substitution was determined at codon 70 of the rpsL gene in two isolates, which is a new region not previously reported in the literature [17] (Figure 1) (see Supplementary Materials, Figure S1). Both patients were of Turkish nationality, and it was determined that they were diagnosed with TB within the same year. Phenotypic drug susceptibility testing detected resistance to SM+INH in both patients. While both isolates harbored mutations within the inhA promoter region, the katG gene remained wild-type. No mutation was detected in the rpsL gene region in the remaining 11 clinical isolates. The rpsL gene sequences analyzed in this study are available in GenBank (accession no: PX905871–PX905891). The accession numbers for the novel mutation at codon 70 of the rpsL gene are PX905878 and PX905879.
Figure 1.
Image of polymorphic regions showing AAG → AGG conversion at codon 43, GAG → GCG at codon 70, and AAG → AGG conversion at codon 88 of the rpsL gene region responsible for SM resistance.
Among the 19 clinical isolates showing INH resistance, mutations were identified in 13 isolates. Of these 13 patients, seven were male and six were female; 12 were diagnosed with pulmonary TB and one with extrapulmonary TB (abscess material). Eleven of the patients were of Turkish nationality, while two were of Russian nationality. Phenotypic drug susceptibility testing detected resistance to SM+INH in nine patients, SM+INH+RIF in three patients, and INH+RIF in one patient. Of the 13 mutation-positive isolates, an AGC → ACC (Serine [Ser] → Threonine [Thr]) substitution was detected at codon 315 of the katG gene in 9 isolates (Figure 2) (see Supplementary Materials, Figure S1), which is the most frequently mutated site, and a C → T mutation was detected at the −15 position of the inhA gene region in four isolates (Figure 3) (see Supplementary Materials, Figure S1). No mutations were detected in the katG and inhA gene regions in the remaining six clinical isolates. The gene sequence accession numbers are PX905833–PX905851 for inhA and PX905852–PX905870 for katG.
Figure 2.
Image of polymorphic regions showing AGC → ACC conversion at codon 315 of the katG gene region responsible for INH resistance.
Figure 3.
Polymorphic image of the promoter region containing the C → T conversion mutation at position −15 in the inhA gene region responsible for INH resistance.
Mutations were detected in four out of six clinical isolates that showed phenotypic RIF resistance. Of these four patients, one was male and three were female; all were diagnosed with pulmonary TB. Three of the patients were of Turkish nationality, while one was of Russian nationality. Phenotypic drug susceptibility testing detected resistance to SM+INH+RIF in two patients, SM+RIF+EMB in one patient, and INH+RIF in one patient. A mutation in the form of a TCG → TTG (Ser → Leucine [Leu]) substitution was detected at codon 531 of the rpoB gene region, which is the most frequently encountered site, in four of the six clinical isolates resistant to RIF (Figure 4) (see Supplementary Materials, Figure S1). No mutation was detected in the rpoB gene region in the remaining two clinical isolates. The gene sequence accession numbers for rpoB are PX905827–PX905832.
Figure 4.
Image of polymorphic regions showing TCG → TTG conversion at codon 531 of the rpoB gene region responsible for RIF resistance.
In one of the four clinical isolates resistant to EMB, a mutation in the form of an ATG → GTG (Methionine [Met] → Valine [Val]) substitution was detected at codon 306 of the embB gene region, which is the most frequently mutated site (Figure 5) (see Supplementary Materials, Figure S1). This patient was a female of Russian nationality and was diagnosed with pulmonary TB. Phenotypic drug susceptibility testing detected resistance to SM+RIF+EMB in the patient. No mutation was detected in the embB gene region in the remaining three clinical isolates. The gene sequence accession numbers for embB are PX905892–PX905895.
Figure 5.
Image of polymorphic regions showing ATG → GTG conversion at codon 306 of the embB gene region responsible for EMB resistance.
According to the resistance patterns of the clinical isolates included in the study, mutations were detected in the katG gene region in five, the rpsL gene region in seven, and the inhA gene region in three of the fourteen clinical isolates resistant to SM+INH. No mutations were detected in any of the three clinical isolates resistant to SM+EMB. Mutations were determined in the katG and rpoB gene regions in two clinical isolates resistant to INH+RIF. Furthermore, mutations were detected in the rpsL gene region in two, the inhA gene region in one, the katG gene region in three, and the rpoB gene region in two of the four clinical isolates resistant to SM+INH+RIF. In one clinical isolate resistant to SM+INH+EMB, mutations were detected only in the rpsL and embB1 gene regions. Additionally, genotypic resistance was detected in three of the five MDR-TB isolates (Table 4).
Table 4.
Genetic mutations observed in clinical isolates resistant to at least two of the first-line anti-TB drugs (rpsL, inhA, katG, rpoB, and embB).
| Nucleotide and Amino Acid Changes | ||||||
|---|---|---|---|---|---|---|
| Resistance Pattern | Number of Isolates | rpsL | inhA | katG | rpoB | embB (B1) |
| SM+INH | 4 (17.4%) | Wild-type | Wild-type | Wild-type | - | - |
| 2 (8.7%) | Wild-type | Wild-type | S315T (AGC → ACC) | - | - | |
| 2 (8.7%) | L43A (AAG → AGG) | Wild-type | S315T (AGC → ACC) | - | - | |
| 2 (8.7%) | G70A (GAG → GCG) | −15 C → T | Wild-type | - | - | |
| 2 (8.7%) | L43A (AAG → AGG) | Wild-type | Wild-type | - | - | |
| 1 (4.4%) | Sokak tipi | −15 C → T | Wild-type | - | - | |
| 1 (4.4%) | L88A (AAG → AGG) |
Wild-type | S315T (AGC → ACC) | - | - | |
| SM+EMB | 3 (13%) | Wild-type | - | - | - | Wild-type |
| INH+RIF | 1 (4.4%) | - | Wild-type | S315T (AGC → ACC) | S531L (TCG → TTG) | - |
| 1 (4.4%) | - | −15 C → T | Wild-type | S531L (TCG → TTG) | - | |
| SM+INH+RIF | 1 (4.4%) | L43A (AAG → AGG) | Wild-type | S315T (AGC → ACC) | Wild-type | - |
| 1 (4.4%) | Wild-type | Wild-type | S315T (AGC → ACC) | Wild-type | - | |
| 1 (4.4%) | L43A (AAG → AGG) | Wild-type | S315T (AGC → ACC) | S531L (TCG → TTG) | - | |
| SM+RIF+EMB | 1 (4.4%) | L43A (AAG → AGG) | - | - | S531L (TCG → TTG) | M306V (ATG → GTG) |
SM: Streptomycin; INH: Isoniazid; RIF: Rifampicin; EMB: Ethambutol; S: Serine (Ser); T: Threonine (Thr); L: Lysine (Lys); A: Arginine (Arg); G: Glutamate (Glu); A: Alanine (Ala); L: Leucine (Leu).
4. Discussion
The emergence and spread of drug-resistant M. tuberculosis strains cause serious difficulties for both treatment regimens and disease control. Specifically, resistance that develops against first-line anti-TB drugs increases the spread of MDR-TB isolates, complicates treatment, and necessitates the use of more toxic, long-term drugs. Early and rapid diagnosis of drug resistance is critical for reducing the spread of resistant isolates, establishing effective treatment regimens, and ensuring global TB control [1,5,18].
This study investigated the gene regions responsible for drug resistance in MTBC clinical isolates resistant to at least two first-line anti-TB drugs and found that the most frequent mutations were located in the katG and rpsL gene regions. A rare mutation in the rpsL gene was detected in one isolate at codon 88. Studies in Türkiye have not found any mutations in codon 88 of the rpsL gene. Furthermore, a previously unreported GAG → GCG (Glu → Ala) substitution at codon 70 in the rpsL gene region was detected in two clinical isolates. This unique mutation provides a significant contribution to the current knowledge and the literature regarding a potential new molecular mechanism that may contribute to SM resistance.
Studies conducted in different countries reveal variable mutation rates in the rpsL gene. These variations are thought to be due to differences in study application methods, the number of samples examined, regional isolates, and antibiotic use profiles. The literature reports that rpsL-mediated resistance is most commonly caused by mutations in codon 43 (Lys → Arg), while mutations in codon 88 are generally less common [19].
Studies conducted in Türkiye and around the world have reported that SM resistance is most commonly associated with mutations in the rpsL gene region [20,21,22,23]. Studies in various global populations have shown that the mutation frequency at codon 43 of the rpsL gene varies widely, ranging from 89.1% to 13.2% [24,25,26,27,28,29]. At codon 88, which shows fewer mutations, mutation rates have been reported to range from 16.7% to 6.6% [26,27,28,29]. Among the 21 clinical isolates examined, 7 exhibited a mutation in the most frequently mutated region of the rpsL gene, with an AAG → AGG (Lys → Arg) substitution at codon 43, whereas 1 isolate exhibited a mutation in the same gene region with an AAG → AGG (Lys → Arg) substitution at codon 88. In seven clinical isolates with mutations in codon 43 of the rpsL gene region, phenotypic resistance to SM+INH was detected in four, to SM+RIF+EMB in one, and to SM+INH+RIF in two isolates.
Similarly, only one clinical isolate was found to be resistant at codon 88 of the rpsL gene, exhibiting phenotypic resistance to SM+INH. These findings suggest that mutations at codons 43 and 88 of the rpsL gene are strongly correlated with phenotypic resistance patterns, implicating this region as a pivotal component in the molecular basis of SM resistance. Our results align with the existing literature, which predominantly identifies codon 43 substitutions as primary drivers of such resistance.
Since the rpsL gene encodes the ribosomal protein S12, amino acid alterations in this domain are hypothesized to cause functional impairment in drug ribosome binding, thereby facilitating resistance. Consequently, these specific codons represent high-priority targets for the molecular diagnosis of SM resistance [27].
Furthermore, while the L43R mutation in the rpsL gene emerged as the dominant variant, the L88R mutation was observed only sporadically. The prevalence of L43R may reflect a selective advantage that enhances bacterial survival and adaptation under SM-induced pressure; conversely, the rarity of the L88R mutation suggests a more constrained contribution to the overall resistance profile. These observations indicate that certain rpsL mutations may have acquired an evolutionary edge due to their specific impact on drug–target affinity, allowing for resistance without compromising biological fitness [5].
The discovery of two isolates harboring the GAG → GCG (Glu → Ala) mutation at codon 70 of the rpsL gene, both submitted to the TB laboratory within just a month of each other, strongly points toward a potential epidemiological link rather than a mere coincidence. While a clonal relationship between these isolates remains a distinct possibility, such a connection must be validated through advanced molecular typing techniques (such as MIRU-VNTR, spoligotyping, or whole-genome sequencing) [30]. Although no direct molecular correlation has been established between inhA mutations and rpsL resistance, the co-existence of inhA-mediated INH resistance in strains carrying the rpsL codon 70 mutation suggests a cumulative acquisition of multiple resistance mechanisms within these specific isolates. One possible explanation for the observed mutations in the rpsL gene is the frequent use of SM in local TB treatment regimens, which may exert selective pressure and contribute to the emergence of these resistance-associated mutations [3].
In MDR-TB isolates and extensively drug-resistant MTBC clinical isolates, it was emphasized that a rare AAG → AGG change was observed in codon 88 of the rpsL gene in all clinical isolates and that this change created a mutation on the surface of the protein via Lys → Arg conversion [31]. In our study, phenotypic resistance to the SM+INH+RIF combination was identified in two of the ten clinical isolates harboring mutations in the rpsL gene region. The isolate with a mutation at codon 88 of the rpsL gene was not classified as MDR, but instead displayed an SM+INH resistance profile. Codon 88 mutation is not always associated with MDR and in some cases can lead to resistance to different drugs. This suggests that resistance profiles are influenced not only by the presence of the mutation but also by local treatment practices (selective imprinting) or co-occurring mutations [3].
According to the literature data, the Met → Val substitution at codon 306 in the embB gene, which is the region where mutations are most frequently reported, is a common target in research [32,33,34]. Although EMB aims to limit the development of resistance as part of multidrug therapy regimens, embB mutations can also be found in multidrug-resistant strains. In our study, a Met → Val mutation at codon 306 of the embB gene was detected in one of the four clinical isolates resistant to EMB (Table 4). This co-occurrence (though observed in only a single sample) is noteworthy. However, whether it indicates a general association between the embB M306V mutation and broader multidrug resistance profiles requires validation in larger-scale studies.
Codon 306 of the embB gene lies within a functionally critical region of the arabinosyltransferase involved in arabinogalactan biosynthesis of the mycobacterial cell wall. Mutations in the embB gene decrease the binding affinity of EMB to arabinosyltransferase, enabling continued cell wall biosynthesis and thereby constituting the molecular basis of EMB resistance. Furthermore, these changes can occur through differences in a single or limited number of nucleotides; this could lead to evolutionary selection of codon 306 of the embB gene under therapeutic pressure, resulting in its frequent appearance in clinical isolates [8,35].
Different studies have reported that the most commonly observed point mutations associated with INH resistance are a Ser → Thr substitution at codon 315 of the katG gene and a C → T substitutions at position −15 of the inhA gene [36,37,38,39,40]. The S315T mutation in the katG gene has been reported to be responsible for 50–95% of INH resistance [3]. The findings in our study are consistent with the literature. Of the 19 phenotypically INH-resistant clinical isolates, 9 had the AGC → ACC (Ser315Thr) mutation at codon 315 of katG, and 4 had the C → T mutation at position −15 of the inhA gene. These results once again demonstrate that the most common mutations in INH resistance are concentrated particularly in the katG and inhA gene regions. The most frequently detected mutations associated with INH resistance, namely alterations at codon 315 of the katG gene and the C → T transition at position −15 in the promoter region of the inhA gene, reduce the efficacy of INH by decreasing its activation and increasing the expression of the target enzyme, respectively [35]. These mutations allow the bacterium to largely preserve its essential metabolic functions and virulence, confer a selective advantage under drug pressure, and consequently facilitate its persistence and widespread dissemination among clinical isolates [41].
In other studies including clinical isolates resistant to INH and RIF, it has been reported that the most frequent point mutation associated with INH resistance is an AGC → ACC substitution at codon 315 of the katG gene, followed by a C → T transition at position −15 of the inhA gene. For RIF resistance, the most common point mutation has been identified as a TCG → TTG substitution at codon 531 of the rpoB gene [15,42,43,44,45,46]. In our study, mutations were observed in 13 of the 19 INH-resistant clinical isolates, while a Ser→Leu mutation was detected at codon 531 of the rpoB gene in four of the six RIF-resistant clinical isolates (Table 4). These findings are similar to the results reported in the literature, and similar mutation profiles were identified. In the present study, the most prevalent mutations among RIF- and INH-resistant isolates were identified as S531L in the rpoB gene and S315T in the katG gene, in agreement with previous findings. In addition, the C15T mutation in the inhA gene represents one of the most frequently reported alterations associated with INH resistance. Surveillance of these key resistance-associated mutations (S531L, S315T, and C15T) in local MTBC isolates is therefore essential for strengthening molecular diagnostic approaches and regional epidemiological monitoring. Such efforts may enable the earlier detection of MDR-TB and support the optimization of treatment regimens, thereby limiting the emergence and spread of multidrug- and extensively drug-resistant TB [3,35].
Resistance at the genotypic level was observed in three out of five MDR-TB isolates included in this study. This finding demonstrates that the concordance between phenotypically determined resistance and genotypic results was partially achieved. Of the two INH+RIF-resistant clinical isolates, one had mutations in the katG and rpoB gene regions, and the other had mutations in the inhA and rpoB gene regions. Furthermore, of the three SM+INH+RIF-resistant clinical isolates, two had mutations in the rpsL gene, three in the katG gene, and one in the rpoB gene (Table 4). These findings suggest that the development of resistance in MDR-TB isolates is associated with multigenic mutations. The presence of multiple resistance-associated mutations across different gene regions suggests that diagnostic tests targeting only a single gene region may fail to detect certain resistant isolates, potentially reducing test sensitivity and specificity. Identifying gene regions that harbor mutations predominant in the local population may support faster and more accurate clinical decision-making by incorporating these regions into rapid molecular diagnostic assays, thereby facilitating timely and appropriate treatment [47].
In our study, mutations in the most frequently observed resistance genes were investigated in clinical isolates resistant to at least two anti-TB drugs; while this approach provides valuable insights into the molecular basis of multidrug resistance, the focus on only the most common mutations does not capture the potential contribution of rare or previously uncharacterized mutations, nor the possible interactions between different genes.
This study is the first in Türkiye and worldwide to report a previously unidentified mutation (GAG → GCG, G70A) at codon 70 of the rpsL gene in clinical isolates of M. tuberculosis. The codon 70 mutation in the rpsL gene, which encodes the ribosomal protein S12, may induce conformational changes in the 30S ribosomal subunit, potentially affecting SM binding. These changes could indirectly influence ribosomal fidelity, protein synthesis, and drug susceptibility. However, this position has not been functionally characterized previously, and the structural and functional effects of the mutation have not yet been experimentally validated. Furthermore, we identified the rare L88A (AAG → AGG) mutation at codon 88 of the rpsL gene, which has not been previously reported in Türkiye. This finding provides novel insights and represents an important contribution to the understanding of the genetic mechanisms underlying drug resistance in M. tuberculosis.
The main limitations include the relatively small sample size and the inability to examine all gene regions responsible for the drug resistance. The absence of detectable mutations in the investigated gene regions does not rule out the presence of resistance in other loci; thus, further studies are warranted to examine alternative mutation patterns that may contribute to drug resistance. Our study provides novel information by identifying the previously unreported rpsL mutation G70A and characterizing mutational patterns in drug-resistant isolates in this region. These findings highlight the importance of our study and provide a foundation for future research.
5. Conclusions
In conclusion, DNA sequencing and genotypic analyses yielded results that are consistent with the previously reported mutation data for first-line anti-TB drugs on a global scale. This study is the first to identify a previously unidentified mutation (GAG → GCG, G70A) at codon 70 of the rpsL gene in clinical isolates from Turkey and worldwide. This finding provides a more detailed understanding of the molecular mechanisms of SM resistance, points to the existence of potential novel resistance sites, and offers a potential target for future functional studies and diagnostic marker development. DNA sequencing is utilized not only for the confirmation of known drug resistance-associated gene regions but also for the identification of novel genetic loci that may contribute to resistance, thereby providing a foundation for future molecular studies.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/pathogens15020222/s1, Figure S1: Chromatogram images of the rpsL, katG, inhA, rpoB and embB gene regions from the isolates.
Author Contributions
Conceptualization, M.U. and N.B.; methodology, M.U., N.B. and S.T.U.; laboratory experiments, M.U., N.B., and S.T.U.; data analysis, M.U., N.B., S.T.U. and G.A.; manuscript drafting, M.U., N.B., S.T.U. and G.A. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
The study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of Mersin University Clinical Research Ethics Committee (2024/873, 18 September 2024).
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.
Conflicts of Interest
The authors declare no conflicts of interest.
Funding Statement
This research received no external funding.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.World Health Organization . Global Tuberculosis Report 2024. World Health Organization; Geneva, Switzerland: 2024. [(accessed on 2 November 2025)]. Available online: https://www.who.int/teams/global-tuberculosis-programme/tb-reports. [Google Scholar]
- 2.An Q., Li C., Chen Y., Deng Y., Yang T., Luo Y. Repurposed drug candidates for antituberculosis therapy. Eur. J. Med. Chem. 2020;192:112175. doi: 10.1016/j.ejmech.2020.112175. [DOI] [PubMed] [Google Scholar]
- 3.Khawbung J.L., Nath D., Chakraborty S. Drug resistant Tuberculosis: A review. Comp. Immunol. Microbiol. Infect. Dis. 2021;74:101574. doi: 10.1016/j.cimid.2020.101574. [DOI] [PubMed] [Google Scholar]
- 4.Dookie N., Rambaran S., Padayatchi N., Mahomed S., Naidoo K. Evolution of drug resistance in Mycobacterium tuberculosis: A review on the molecular determinants of resistance and implications for personalized care. J. Antimicrob. Chemother. 2018;73:1138–1151. doi: 10.1093/jac/dkx506. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Rocha D.M.G.C., Viveiros M., Saraiva M., Osório N.S. The Neglected Contribution of Streptomycin to the Tuberculosis Drug Resistance Problem. Genes. 2021;12:2003. doi: 10.3390/genes12122003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Jhun B.W., Koh W.J. Treatment of Isoniazid-Resistant Pulmonary Tuberculosis. Tuberc. Respir. Dis. 2020;83:20–30. doi: 10.4046/trd.2019.0065. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Xu G., Liu H., Jia X., Wang X., Xu P. Mechanisms and detection methods of Mycobacterium tuberculosis rifampicin resistance: The phenomenon of drug resistance is complex. Tuberculosis. 2021;128:102083. doi: 10.1016/j.tube.2021.102083. [DOI] [PubMed] [Google Scholar]
- 8.Mohammadi B., Ramazanzadeh R., Nouri B., Rouhi S. Frequency of Codon 306 Mutations in embB Gene of Mycobacterium tuberculosis Resistant to Ethambutol: A Systematic Review and Meta-Analysis. Int. J. Prev. Med. 2020;11:112. doi: 10.4103/ijpvm.IJPVM_114_19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Liebenberg D., Gordhan B.G., Kana B.D. Drug resistant tuberculosis: Implications for transmission, diagnosis, and disease management. Front. Cell. Infect. Microbiol. 2022;12:943545. doi: 10.3389/fcimb.2022.943545. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Viñuelas-Bayón J., Vitoria M.A., Samper S. Rapid diagnosis of tuberculosis. Detection of drug resistance mechanisms. Enferm. Infecc. Microbiol. Clin. 2017;35:520–528. doi: 10.1016/j.eimc.2017.01.015. [DOI] [PubMed] [Google Scholar]
- 11.Lopez-Avalos G., Gonzalez-Palomar G., Lopez-Rodriguez M., Vazquez-Chacon C.A., Mora-Aguilera G., Gonzalez-Barrios J.A., Villanueva-Arias J.C., Sandoval-Diaz M., Miranda-Hernández U., Alvarez-Maya I. Genetic diversity of Mycobacterium tuberculosis and transmission associated with first-line drug resistance: A first analysis in Jalisco, Mexico. J. Glob. Antimicrob. Resist. 2017;11:90–97. doi: 10.1016/j.jgar.2017.07.004. [DOI] [PubMed] [Google Scholar]
- 12.Sağlık Bakanlığı T.C. Ulusal Mikrobiyoloji Standartları: Ulusal Tüberküloz Tanı Rehberi (UTTR) Aydoğdu Ofset Matbaacılık; Ankara, Turkey: 2014. [(accessed on 2 November 2025)]. Available online: https://hsgm.saglik.gov.tr/depo/birimler/mikrobiyoloji-referans-laboratuvarlari-ve-biyolojik-urunler-db/Dokumanlar/Rehberler/0_TuberkulozRehberi_UTTR.pdf. [Google Scholar]
- 13.Sajduda A., Brzostek A., Poplawska M., Augustynowicz-Kopec E., Zwolska Z., Niemann S., Dziadek J., Hillemann D. Molecular characterization of rifampin- and isoniazid-resistant Mycobacterium tuberculosis strains isolated in Poland. J. Clin. Microbiol. 2004;42:2425–2431. doi: 10.1128/JCM.42.6.2425-2431.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Tracevska T., Jansone I., Nodieva A., Marga O., Skenders G., Baumanis V. Characterisation of rpsL, rrs and embB mutations associated with streptomycin and ethambutol resistance in Mycobacterium tuberculosis. Res. Microbiol. 2004;155:830–834. doi: 10.1016/j.resmic.2004.06.007. [DOI] [PubMed] [Google Scholar]
- 15.Aslan G., Tezcan S., Serin M.S., Emekdas G. Genotypic analysis of isoniazid and rifampin resistance in drug-resistant clinical Mycobacterium tuberculosis complex isolates in southern Turkey. Jpn. J. Infect. Dis. 2008;61:255–260. doi: 10.7883/yoken.JJID.2008.255. [DOI] [PubMed] [Google Scholar]
- 16.Xu Y., Jia H., Huang H., Sun Z., Zhang Z. Mutations Found in embCAB, embR, and ubiA Genes of Ethambutol-Sensitive and Resistant Mycobacterium tuberculosis Clinical Isolates from China. Biomed Res. Int. 2015;2015:951706. doi: 10.1155/2015/951706. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.World Health Organization . Catalogue of Mutations in Mycobacterium Tuberculosis Complex and Their Association with Drug Resistance. 2nd ed. World Health Organization; Geneva, Switzerland: 2023. [(accessed on 23 January 2026)]. Available online: https://www.who.int/publications/i/item/9789240082410. [Google Scholar]
- 18.Alsayed S.S.R., Gunosewoyo H. Tuberculosis: Pathogenesis, Current Treatment Regimens and New Drug Targets. Int. J. Mol. Sci. 2023;24:5202. doi: 10.3390/ijms24065202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Khosravi A.D., Etemad N., Hashemzadeh M., Khandan Dezfuli S., Goodarzi H. Frequency of rrs and rpsL mutations in streptomycin-resistant Mycobacterium tuberculosis isolates from Iranian patients. J. Glob. Antimicrob. Resist. 2017;9:51–56. doi: 10.1016/j.jgar.2017.01.005. [DOI] [PubMed] [Google Scholar]
- 20.Ulger M., Aslan G., Emekdaş G., Tezcan S., Serin M.S. Streptomisine dirençli Mycobacterium tuberculosis kompleks izolatlarinda rpsL ve rrs gen bölgesi mutasyonlarinin araştırılması [Investigation of rpsL and rrs gene region mutations in streptomycin resistant Mycobacterium tuberculosis complex isolates] Mikrobiyol. Bul. 2009;43:115–120. [PubMed] [Google Scholar]
- 21.Ozturk C.E., Sanic A., Kaya D., Ceyhan I. Molecular analysis of isoniazid, rifampin and streptomycin resistance in Mycobacterium tuberculosis isolates from patients with tuberculosis in Düzce, Turkey. Jpn. J. Infect. Dis. 2005;58:309–312. doi: 10.7883/yoken.JJID.2005.309. [DOI] [PubMed] [Google Scholar]
- 22.Huy N.Q., Banuls A.L., Van Anh N.T. Characterization of mutations conferring streptomycin resistance in Mycobacterium tuberculosis in Vietnam. Acad. J. Biol. 2023;45:87–97. doi: 10.15625/2615-9023/18156. [DOI] [Google Scholar]
- 23.Feuerriegel S., Oberhauser B., George A.G., Dafae F., Richter E., Rüsch-Gerdes S., Niemann S. Sequence analysis for detection of first-line drug resistance in Mycobacterium tuberculosis strains from a high-incidence setting. BMC Microbiol. 2012;12:90. doi: 10.1186/1471-2180-12-90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Shafipour M., Shirzad-Aski H., Mohammadzadeh A., Ghazvini K., Zamani S., Koohi P.M., Ghaemi S., Ghaemi E.A. Evaluation of Mutations Related to Streptomycin Resistance in Mycobacterium tuberculosis Clinical Isolates. Curr. Microbiol. 2022;79:343. doi: 10.1007/s00284-022-03043-9. [DOI] [PubMed] [Google Scholar]
- 25.Farzamfar A., Farahani A., Mohajeri P., Shamseddin J., Habibipour R., Dastranj M. Characterization of rrs and rpsL Mutations in Aminoglycoside-Resistant Mycobacterium tuberculosis Strains Isolated from Clinical Specimens in the West of Iran. J. Cell. Mol. Anesth. 2024;9:e146643. doi: 10.5812/jcma-146643. [DOI] [Google Scholar]
- 26.Sun Y.J., Luo J.T., Wong S.Y., Lee A.S. Analysis of rpsL and rrs mutations in Beijing and non-Beijing streptomycin-resistant Mycobacterium tuberculosis isolates from Singapore. Clin. Microbiol. Infect. 2010;16:287–289. doi: 10.1111/j.1469-0691.2009.02800.x. [DOI] [PubMed] [Google Scholar]
- 27.Smittipat N., Juthayothin T., Billamas P., Jaitrong S., Rukseree K., Dokladda K., Chaiyasirinroje B., Disratthakit A., Chaiprasert A., Mahasirimongkol S., et al. Mutations in rrs, rpsL and gidB in streptomycin-resistant Mycobacterium tuberculosis isolates from Thailand. J. Glob. Antimicrob. Resist. 2016;4:5–10. doi: 10.1016/j.jgar.2015.11.009. [DOI] [PubMed] [Google Scholar]
- 28.Cuevas-Córdoba B., Cuellar-Sánchez A., Pasissi-Crivelli A., Santana-Álvarez C.A., Hernández-Illezcas J., Zenteno-Cuevas R. rrs and rpsL mutations in streptomycin-resistant isolates of Mycobacterium tuberculosis from Mexico. Tuberculosis. 2013;46:30–34. doi: 10.1016/j.jmii.2012.08.020. [DOI] [PubMed] [Google Scholar]
- 29.Anwaierjiang A., Wang Q., Liu H., Yin C., Xu M., Li M., Liu M., Liu Y., Zhao X., Liu J., et al. Prevalence and Molecular Characteristics Based on Whole Genome Sequencing of Mycobacterium tuberculosis Resistant to Four Anti-Tuberculosis Drugs from Southern Xinjiang, China. Infect. Drug Resist. 2021;14:3379–3391. doi: 10.2147/IDR.S320024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Biltekin N., Ülger M., Kayar M.B., Yakıcı G., Ülger S.T., Aslan G., Köksal F. Tüberkülozlu Hastalara Ait Mycobacterium tuberculosis Kompleks İzolatlarının MIRU-VNTR ve Spoligotiplendirme Yöntemleri ile Genotiplendirilmesi. Turk. Mikrobiyol. Cemiy. Derg. 2023;53:84–92. doi: 10.54453/TMCD.2023.89421. [DOI] [Google Scholar]
- 31.Arjomandzadegan M., Gravand S. Analysis of rpsL and rrs genes mutations related to streptomycin resistance in Mdr and Xdr clinical isolates of Mycobacterium tuberculosis. Tuberk. Toraks. 2015;63:235–242. doi: 10.5578/tt.6474. [DOI] [PubMed] [Google Scholar]
- 32.Yaşar N., Tezcan Ülger S., Ülger M., Arslantürk A., Aslan G., Köksal F. Etambutole Dirençli ve Duyarlı Mycobacterium tuberculosis Kompleksi Klinik İzolatlarında embA, embB ve embC Gen Bölgesi Mutasyonları. Mikrobiyol. Bul. 2023;57:45–59. doi: 10.5578/mb.20239904. [DOI] [PubMed] [Google Scholar]
- 33.Sun Q., Xiao T.Y., Liu H.C., Zhao X.Q., Liu Z.G., Li Y.N., Zeng H., Zhao L.L., Wan K.L. Mutations within embCAB Are Associated with Variable Level of Ethambutol Resistance in Mycobacterium tuberculosis Isolates from China. Antimicrob. Agents Chemother. 2017;62:e01279-17. doi: 10.1128/AAC.01279-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Nan X.T., Li M.C., Xiao T.Y., Liu H.C., Lin S.Q., Wang W., Qian C., Hang H., Li G.L., Zhao X.-Q., et al. Different Contributions of embB and ubiA Mutations to Variable Level of Ethambutol Resistance in Mycobacterium tuberculosis Isolates. Infect. Drug Resist. 2024;17:3125–3132. doi: 10.2147/IDR.S466371. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Palomino J.C., Martin A. Drug resistance mechanisms in Mycobacterium tuberculosis. Antibiotics. 2014;3:317–340. doi: 10.3390/antibiotics3030317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Yıldırım E., Uzun M. İzoniazide Dirençli Mycobacterium tuberculosis İzolatlarında Minimal İnhibitör Konsantrasyonun ve Gen Mutasyonlarının Belirlenmesi. Mikrobiyol. Bul. 2017;51:305–316. doi: 10.5578/mb.57614. [DOI] [PubMed] [Google Scholar]
- 37.Charan A.S., Gupta N., Dixit R., Arora P., Patni T., Antony K., Singh M. Pattern of InhA and KatG mutations in isoniazid monoresistant Mycobacterium tuberculosis isolates. Lung India. 2020;37:227–231. doi: 10.4103/lungindia.lungindia_204_19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Isakova J., Sovkhozova N., Vinnikov D., Goncharova Z., Talaibekova E., Aldasheva N., Aldashev A. Mutations of rpoB, katG, inhA and ahp genes in rifampicin and isoniazid-resistant Mycobacterium tuberculosis in Kyrgyz Republic. BMC Microbiol. 2018;18:22. doi: 10.1186/s12866-018-1168-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Yao C., Zhu T., Li Y., Zhang L., Zhang B., Huang J., Fu W. Detection of rpoB, katG and inhA gene mutations in Mycobacterium tuberculosis clinical isolates from Chongqing as determined by microarray. Clin. Microbiol. Infect. 2010;16:1639–1643. doi: 10.1111/j.1469-0691.2010.03267.x. [DOI] [PubMed] [Google Scholar]
- 40.Kigozi E., Kasule G.W., Musisi K., Lukoye D., Kyobe S., Katabazi F.A., Wampande E.M., Joloba M.L., Kateete D.P. Prevalence and patterns of rifampicin and isoniazid resistance conferring mutations in Mycobacterium tuberculosis isolates from Uganda. PLoS ONE. 2018;13:e0198091. doi: 10.1371/journal.pone.0198091. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Al-Saeedi M., Al-Hajoj S. Diversity and evolution of drug resistance mechanisms in Mycobacterium tuberculosis. Infect. Drug Resist. 2017;10:333–342. doi: 10.2147/IDR.S144446. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Şahin İ.H., Akpolat N., Yakıcı G., Özcan N. PrimerAntitüberküloz İlaçlara Dirençli MycobacterumTuberculosis Kompleks İzolatlarında Dirençle İlişkili Yaygın Mutasyonların Araştırılması. Dicle Tıp Derg. 2024;51:461–469. doi: 10.5798/dicletip.1552636. [DOI] [Google Scholar]
- 43.Aktas E., Durmaz R., Yang D., Yang Z. Molecular characterization of isoniazid and rifampin resistance of Mycobacterium tuberculosis clinical isolates from Malatya, Turkey. Microb. Drug Resist. 2005;11:94–99. doi: 10.1089/mdr.2005.11.94. [DOI] [PubMed] [Google Scholar]
- 44.Solo E.S., Nakajima C., Kaile T., Bwalya P., Mbulo G., Fukushima Y., Chila S., Kapata N., Shah Y., Suzuki Y. Mutations in rpoB and katG genes and the inhA operon in multidrug-resistant Mycobacterium tuberculosis isolates from Zambia. J. Glob. Antimicrob. Resist. 2020;22:302–307. doi: 10.1016/j.jgar.2020.02.026. [DOI] [PubMed] [Google Scholar]
- 45.Yenew B., Kebede A., Alemu A., Diriba G., Mehammed Z., Amare M., Dagne B., Sinshaw W., Tesfaye E., Beyene D., et al. Genotypic and phenotypic drug resistance patterns of Mycobacterium tuberculosis isolated from presumptive pulmonary tuberculosis patients in Ethiopia: A multicenter study. PLoS ONE. 2024;19:e0303460. doi: 10.1371/journal.pone.0303460. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Seid A., Berhane N., Nureddin S. Frequency of rpoB, katG, and inhA Gene Polymorphisms Associated with Multidrug-Resistant Mycobacterium tuberculosis Complex Isolates among Ethiopian TB Patients: A Systematic Review. Interdiscip. Perspect. Infect. Dis. 2022;2022:1967675. doi: 10.1155/2022/1967675. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Nguyen T.N.A., Anton-Le Berre V., Bañuls A.L., Nguyen T.V.A. Molecular Diagnosis of Drug-Resistant Tuberculosis; A Literature Review. Front. Microbiol. 2019;10:794. doi: 10.3389/fmicb.2019.00794. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.





