Development and Evaluation of Immunoprotective Efficacy of Membrane Protein Vaccine Against Scuticociliatosis

Abstract

Objective: To develop a novel and efficient vaccine for controlling scuticociliatosis in turbot (Scophthalmus maximus), this study targeted the parasitic ciliate Pseudocohnilembus persalinus for membrane protein vaccine preparation. Methods: The immunoprotective efficacy and underlying molecular mechanisms of the vaccine were systematically evaluated through immunization–challenge experiments, immune parameter detection, and transcriptomic analysis. Results: Results showed that the serum IgM level in turbot immunized with the membrane protein vaccine reached its peak one week after the second immunization, which was significantly higher than that in the control group and the whole-cell protein vaccine group (p < 0.05). Additionally, the activities of serum peroxidase (POD), total superoxide dismutase (T-SOD), acetylcholinesterase (ACH), and lysozyme (LZM) were significantly enhanced (p < 0.05). At 24 h and 48 h post-challenge, the relative parasite reduction rates at the wound sites in the membrane protein vaccine group were 87.79% and 74.17%, respectively. Transcriptomic analysis revealed 1063 differentially expressed genes (DEGs) in the spleen tissue of turbot immunized with the membrane protein vaccine, including 734 upregulated and 329 downregulated genes. These DEGs were significantly enriched in pathways such as glycine, serine and threonine metabolism and one carbon pool by folate, which are involved in immune responses by regulating immune cell proliferation, antioxidant defense, and immune substance synthesis. Conclusions: This study successfully developed a P. persalinus membrane protein vaccine with excellent immunoprotective efficacy and elucidated its molecular mechanisms of protection. It provides a novel vaccine candidate for the green control of turbot scuticociliatosis and offers a theoretical basis and technical support for the development of fish parasite subunit vaccines.

1. Introduction

Scuticociliates are a group of pathogenic ciliates widely distributed in marine environments, which belong to the family Philasteridae, order Scuticociliatida, class Oligohymenophorea, phylum Ciliophora [1]. They include more than 20 pathogenic species that can infect a variety of marine-cultured fish [2]. Among them, Philasterides dicentrarchi, Miamiensis avidus, and Uronema marinum are the major pathogens causing scuticociliatosis in farmed fish worldwide, posing significant threats to economically important fish species such as turbot (Scophthalmus maximus) [3], olive flounder (Paralichthys olivaceus) [4], and gilthead seabream (Sparus aurata) [5,6]. Over the past two decades, with the rapid development of intensive marine fish farming, the increased stocking density and environmental stress have led to a significant rise in the outbreak frequency of scuticociliatosis, which has become one of the key diseases restricting the sustainable development of the global marine aquaculture industry.

As typical facultative parasitic pathogens, scuticociliates exhibit both free-living and parasitic lifestyles, with distinct pathogenic mechanisms. These parasites can invade hosts through wounds or mucous membranes of the skin and gills, and spread systemically via the circulatory system, causing specific pathological damage to multiple organs including the brain, eyes, muscles, liver, and kidneys [7,8]. Infected fish often display clinical symptoms such as anemia, dark body color, hemorrhagic spots on the skin, abnormal mucus secretion, and gill tissue necrosis. In severe cases, it can lead to mass mortality, with a mortality rate of up to 60–80% [2,9]. Geographically, scuticociliatosis has caused harm in major marine aquaculture regions worldwide: in Europe, turbot farms in Spain, Norway, and Portugal suffer economic losses accounting for 15–20% of the total farming costs annually due to infection by Philasterides dicentrarchi [10,11]; in South Korea, the olive flounder farming industry on Jeju Island has been affected by scuticociliatosis since 1995, with a single outbreak resulting in 60% mortality of cultured individuals [12]; in Japan, scuticociliate infections have been frequently detected in the farming of red sea bream (Pagrus major) and black rockfish (Sebastes schlegelii) [3]; additionally, farmed species such as southern bluefin tuna (Thunnus maccoyii) in Australia and silver pomfret (Pampus argenteus) in Kuwait are also threatened by this disease, highlighting its globally distributed harmful characteristics [13,14].

To address the inherent limitations of chemical control, immunoprophylaxis has gradually become the core direction in the research on scuticociliatosis prevention and control. Our research team previously developed a formalin-inactivated whole-cell vaccine targeting Uronema marinum and validated its application in the farming of tiger puffer (Takifugu rubripes) [9]. Results showed that the activities of immune enzymes such as serum lysozyme (LZM) and superoxide dismutase (SOD) in the immunized fish were significantly enhanced, and the relative protection rate after challenge reached 62.5–81.25% without detectable drug residue risks [9]. Furthermore, research teams from Spain, Japan, and other countries have achieved effective control of scuticociliatosis in turbot and olive flounder through whole-cell vaccines or adjuvant-improved vaccines, confirming the feasibility of the vaccine strategy [15,16]. Despite the certain efficacy of whole-cell vaccines in scuticociliatosis control, they still have problems such as complex antigen components and potential side effects (e.g., local inflammatory reactions). Previous studies have shown that the surface membrane proteins of scuticociliates are key antigens inducing protective immune responses in hosts. Among them, the 38 kDa membrane-associated immobilization antigen (i-antigen) can specifically activate humoral and cellular immune pathways in fish, and the antibodies induced thereby can inhibit parasite invasion and proliferation through complement-dependent cytotoxicity (ADCC) [5,17]. Based on this, building on the previous whole-cell vaccine, this study further optimized the antigen preparation strategy by extracting membrane proteins from P. persalinus to develop a membrane protein vaccine, and evaluated its immunoprotective efficacy in turbot. Meanwhile, transcriptome sequencing and analysis were conducted on turbot samples before and after immunization with the membrane protein vaccine, which is intended to provide data support for the subsequent in-depth exploration of relevant immune regulatory factors. The aim is to provide a novel vaccine candidate for the efficient and safe control of scuticociliatosis, as well as a theoretical basis and technical support for the development of fish parasite subunit vaccines.

2. Materials and Methods

2.1. Experimental Animals and Feeding

Turbots (average body weight 50 g) were obtained from a Dalian-based breeding center in Liaoning Province, China, and acclimated in a recirculating aquaculture system for 2 weeks. Seawater was membrane-filtered, with salinity controlled at 29–32% and temperature stabilized at 16 °C. One random fish was tested for Pseudocohnilembus persalinus infection using the blocking assay established by Li et al. (2013) [18]. The results showed a serum immobilization titer of zero and no agglutination activity. Healthy fish were then randomly allocated into three groups (control, experimental group 1, experimental group 2), with 25 individuals per group.

2.2. Scuticociliates Cultivation

In this study, Pseudocohnilembus persalinus was used as the antigen and transferred from the previously established laboratory culture system to a modified cell culture medium (main component: L-15 and chicken serum) for subsequent cultivation. High purity and freedom from contamination were ensured throughout the cultivation process.

2.3. Membrane Protein Extraction

Pseudocohnilembus persalinus was propagated until reaching the logarithmic growth phase, inactivated via formalin treatment (fixed concentration: 0.1%), and harvested through centrifugation. Membrane proteins were extracted using the commercial membrane protein extraction kit (Biosharp, BL671A, Beijing, China). The membrane protein concentration was determined and recorded by the Bradford method and then stored at −80 °C.

2.4. Preparation of Membrane Protein Vaccine

The pre-prepared membrane protein was adjusted to a concentration of 0.6 mg/mL with sterile Phosphate-Buffered Saline (PBS), and then mixed with Freund’s adjuvant at a volume ratio of 1:1. The mixture was well mixed for 50 min to achieve complete emulsification. For the primary immunization, Freund’s complete adjuvant was used, while for the booster immunization, Freund’s incomplete adjuvant was employed. The final membrane protein vaccine injection concentration of experimental group 2 was 0.3 mg/mL. For the whole-cell protein vaccine (experimental group 1), the scuticociliates (P. persalinus) collected by centrifugation were resuspended in 1 mL of sterile PBS, frozen at −80 °C for 10 min, and then thawed in a 37 °C water bath for 10 min. This freeze–thaw cycle was repeated three times to extract the whole insect protein. The method referred to Wang et al. (2024) [9]. After concentration determination via the aforementioned method, the whole-cell proteins were diluted to 0.6 mg/mL and fully emulsified with Freund’s adjuvant. For the control group, sterile PBS was thoroughly mixed with an equal volume of Freund’s adjuvant to prepare the control inoculum.

2.5. Vaccine Immunization and Challenge

Each fish in the three groups was given 0.1 mL of the respective vaccine via intraperitoneal injection. The primary immunization was implemented using the vaccine emulsified with Freund’s complete adjuvant, and a booster immunization was administered two weeks later with the same vaccine formulated with Freund’s incomplete adjuvant. A challenge experiment was performed one week following the booster immunization. Prior to the operation, all scraping instruments were sterilized thoroughly, after which two 1.5 cm × 1.5 cm (4.5 cm²) square wounds were created on the dorsal muscle of each turbot via scraping. Subsequently, all the experimental fish were exposed to the pre-cultured suspension of Pseudocohnilembus persalinus, resulting in a final concentration of 3000 individuals per milliliter in the aquaculture water. Throughout the challenge phase, ensure a continuous oxygen supply and suspend feeding as well as water changes so as to rule out interfering factors. On the 7th, 14th, and 21st days after the initial immunization, 5 fish were randomly selected from each group to collect blood. The serum was isolated, purified, and stored at −80 °C for subsequent experimental detection. The collected blood was placed in a sterile centrifuge tube and allowed to stand at room temperature for 1 h, then transferred to 4 °C for overnight storage. On the following day, after centrifugation (3000 rpm; 10 min), the upper serum was collected into a new sterile centrifuge tube and stored at −80 °C for subsequent experiments.

2.6. Determination of Relative Parasite Reduction Rate

At 24 h and 48 h post-challenge, 10 fish were randomly selected from each group, and mucus was scraped from the wound sites. The mucus from each fish was diluted to 200 μL with sterile seawater. The diluted mucus was aspirated and counted under an optical microscope to calculate the relative parasite reduction rate. The formula is as follows: Relative parasite reduction rate = [(Average number of infected scuticociliates in the control group-Average number of infected scuticociliates in the experimental group)/Average number of infected scuticociliates in the control group] × 100%.

2.7. Analysis of Immobilization Efficacy

50 μL of logarithmic-phase P. persalinus suspension was placed on a glass slide, followed by the addition of 5 μL of polyclonal serum collected on day 21 after the first immunization. After 10 min, the status of the ciliates was observed under a microscope and photographed for recording.

2.8. Determination of IgM

The polyclonal sera collected on days 7, 14, and 21 after the first immunization were analyzed using a fish serum IgM kit (JW.FI1186, Shanghai, China). This IgM ELISA kit is intended for Laboratory for Research use only and is not for use in diagnostic or therapeutic procedures. The Stop Solution changes the color from blue to yellow, and the intensity of the color is measured at 450 nm using a spectrophotometer. In order to measure the concentration of IgM in the sample, this IgM ELISA Kit (JW.FI1186, Shanghai, China) includes a set of calibration standards. The calibration standards are assayed at the same time as the samples and allow the operator to produce a standard curve of Optical Density versus IgM concentration. The concentration of IgM in the samples is then determined by comparing the O.D. of the samples to the standard curve.

2.9. Determination of Immune-Related Enzyme Activities

The activities of four immune enzymes (POD, T-SOD, ACH, and LZM) were determined according to the instructions of the kits purchased from Nanjing Jiancheng Bioengineering Institute. The catalog numbers of the kits are A084-2, A001–1, A105–2 and A050–1 (Nanjing, China), respectively, and all detection assays were strictly performed in accordance with the manufacturer’s standard operating protocols (SOPs).

2.10. Transcriptomic Analysis

On day 21 after the first immunization, 5 fish were randomly selected from the control group and experimental group 2, anesthetized, and their spleen tissues were collected. The spleen tissues were quickly frozen in liquid nitrogen and stored at −80 °C, then transported on dry ice to Beijing Novogene Technology Co., Ltd (Beijing, China). for transcriptomic sequencing. The obtained transcriptomic data were subjected to quality assessment, alignment with the reference genome, gene-level analysis, and differential-expression gene analysis, following the methods described by Wang et al. [9]. Gene Ontology (GO) enrichment analysis of differentially expressed genes was implemented by the clusterProfiler R package (Version 3.8.1), in which gene length bias was corrected. GO terms with corrected p-values less than 0.05 were considered significantly enriched by differentially expressed genes. KEGG is a database resource for understanding the high-level functions and utilities of biological systems, such as the cell, the organism, and the ecosystem, from molecular-level information, especially large-scale molecular datasets generated by genome sequencing and other high-throughput experimental technologies (http://www.genome.jp/kegg/, accessed on 8 June 2025). We used the clusterProfiler R package to test the statistical enrichment of differential expression genes in KEGG pathways.

2.11. q-PCR Validation

For validation of the transcriptomic findings, DEGs with marked differences in the spleen of membrane protein vaccine-immunized turbot were randomly chosen for q-PCR verification. Specific primers were designed via Primer Premier 5.0 and synthesized through Beijing Liuhe BGI Co., Ltd. (Beijing, China), as detailed in Table 1. β-actin served as the internal reference gene. The qRT-PCR reaction protocol was set as follows: initial denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 20 s, 60 °C for 30 s, and 72 °C for 30 s. Relative expression levels of target genes were assessed with the comparative threshold cycle (Ct) method, and q-PCR data were subjected to statistical analysis via one-way analysis of variance (ANOVA). The RNA samples used here were the leftover samples from transcriptomic sequencing. After determining and adjusting the sample concentration, reverse transcription was conducted following the protocol of the Takara RNA (Dalian, China) reverse transcription kit.

Table 1.

The specific primers of q-PCR and β-actin.

Name	Sequence (5′-3′)
LOC118291731 F	CTCTGACCTGCGTCCTCATC
LOC118291731 R	CGGAGTTTCCCACAGCTGAT
novel.21 F	CCCCAAGATCTTCACGCCTT
novel.21 R	GACACACATTTTCCGTGGGC
tmem45b F	AAAGGACATGCCCTTCCTGG
tmem45b R	TCGTCCGTTGGGTTTACTCG
tbx6 F	ATCTCTTCCCTCCTCCACCC
tbx6 R	AACGGGATGGAGAGGGATGA
LOC118284976 F	ACAACCCGTACACCGAGTTC
LOC118284976 R	GGTCGGGGTTCCAATGTGAT
LOC118309980 F	GCTTCCCTGAGCAACTACGT
LOC118309980 R	TAGCTGGAGCAGGTGTTGTG
β-actin F	AGAGGGAAATCGTGCGTGAC
β-actin R	TACCGAGGAAGGAAGGCTG

2.12. Ethics Statement

All experimental animal programs in this study were reviewed and approved by the Dalian Ocean University Laboratory Animal Ethics Committee (Approval Letter No. 51, dated 8 June 2023). These programs adhere to internationally accepted animal welfare and ethical guidelines and comply with the relevant laws, regulations, and policies governing experimental animal management in China and Liaoning Province.

3. Results

3.1. Relative Parasite Reduction Rate of the Vaccine

At 24 h and 48 h post-challenge, the count of P. persalinus in the wound mucus of fish from each group was conducted, as presented in Figure 1. At 24 h post-challenge, parasite numbers in both experimental groups were markedly lower than those in the control group. The relative parasite reduction rate reached 82.57% in experimental group 1 and 87.79% in experimental group 2 (Table 2). By 48 h post-challenge, the respective relative parasite reduction rates were 71.67% for experimental group 1 and 74.17% for experimental group 2.

Figure 1.

Number of Pseudocohnilembus persalinus infected at the wound mucus of turbot in each group at 24 h and 48 h post-challenge. Note: Purple represents the control group, Blue represents the whole-cell protein vaccine group (experimental group 1), and green represents the membrane protein vaccine group (experimental group 2). For statistical analysis, ns indicates no significant difference, *** indicates significant difference with p < 0.001.

Table 2.

Relative parasite reduction rates of the two experimental groups at 24 h and 48 h post-challenge.

Time	Groups
	Group 1	Group 2
24 h	82.57%	87.79%
48 h	71.67%	74.17%

Note: The time points in the table indicate the time post-challenge; group 1 refers to the whole-cell protein vaccine-immunized group, and group 2 refers to the membrane protein vaccine-immunized group.

3.2. Scuticociliate Immobilization Efficacy

The experimental results (Figure 2) showed that within 10 min after mixing the sera from the three groups with P. persalinus suspension, the ciliates in the control group swam normally without obvious slowing or agglutination. In contrast, the ciliates in both experimental groups stopped moving, gradually rounded up, and eventually ruptured. The intact status is indicated by black arrows, and the ruptured status is indicated by red arrows. The ciliate rupture rate was 50% in experimental group 1 (B) and 100% in experimental group 2 (C).

Figure 2.

Morphological status of scuticociliates after serum treatment. Note: (A) represents the control group (status of scuticociliates treated with serum from the control group); (B) represents experimental group 1 (status of scuticociliates treated with serum from the whole-cell protein vaccine group); (C) represents experimental group 2 (status of scuticociliates treated with serum from the membrane protein vaccine group); red arrows: the ruptured status, black arrows: the intact status.

3.3. Detection Results of IgM Levels

The ELISA results (Figure 3) showed that the serum IgM levels in all three groups of turbot decreased first and then increased from day 7 to day 21 after the first immunization. However, the IgM levels in the membrane protein vaccine group were significantly higher than those in the control group on days 14 and 21 (p < 0.05). The serum IgM level in the control group was not higher than that in the experimental groups throughout the experiment.

Figure 3.

Determination of immunoglobulin M (IgM) in turbot serum at different time points after the first immunization. Note: In statistical analysis, ns indicates no significant difference, * indicates significant difference with p < 0.05, and *** indicates significant difference with p < 0.001.

3.4. Detection Results of Serum Enzyme Activities in Immunized Turbot

As shown in Figure 4, three weeks after immunization, the activities of POD (p < 0.001), T-SOD (p < 0.01), ACH (p < 0.05), and LZM (p < 0.001) in the membrane protein vaccine group (experimental group 2) were significantly higher than those in the control group. Among these, the activities of POD (p < 0.01), T-SOD (p < 0.01), and LZM were significantly higher than those in the whole-cell protein vaccine group.

Figure 4.

Determination of the activities of four immune enzymes in turbot of each group three weeks after immunization. Note: For statistical analysis, ns indicates no significant difference, * indicates significant difference with p < 0.05, ** indicates significant difference with p < 0.01, and *** indicates significant difference with p < 0.001.

3.5. Quality Statistics of Transcriptomic Data

As shown in Table 3, a total of 150,071,158 raw reads (22.52 Gb of sequence data) were obtained from experimental group 2, and 158,235,930 raw reads (23.74 Gb of sequence data) from the control group. After removing low-quality sequences, 147,499,128 clean reads (22.13 Gb of sequence data) were successfully obtained from experimental group 2, and 155,317,166 high-quality clean reads (23.3 Gb of sequence data) from the control group. As shown in Table 3, the base error rate of these sequences was extremely low (only 0.01%), the GC content exceeded 48%, and the proportion of high-quality bases was very high (Q20 (%) > 99%, Q30 (%) > 96%). The obtained sequence data were consistent with the expected results, providing a high-quality raw-data basis for subsequent data assembly and ensuring the accuracy and reliability of subsequent analyses.

Table 3.

Statistics of transcriptomic sequences from the spleens of Scophthalmus maximus immunized with membrane protein vaccine.

Items	Groups
	Immunized			Control
Raw reads (n)	48,243,984	48,780,232	53,046,942	53,968,754	57,836,756	46,430,420
Raw bases (G)	7.24	7.32	7.96	8.1	8.68	6.96
Clean reads (n)	47,378,626	47,990,724	52,129,778	53,037,978	56,679,102	45,600,086
Clean bases (G)	7.11	7.2	7.82	7.96	8.5	6.84
Error rate (%)	0.01	0.01	0.01	0.01	0.01	0.01
Q20 (%)	99.22	99.22	99.14	99.2	99.15	99.14
Q30 (%)	96.72	96.74	96.58	96.74	96.66	96.55
GC content (%)	51.73	50.61	49.44	50.62	49.18	48.73

Notes: Raw reads: Number of original sequencing sequences, counted in groups of four lines. Clean reads: Number of sequencing sequences after filtering, counted in groups of four lines. Clean bases: Product of the number of clean reads and their length, expressed in gigabytes (G). Error rate: Calculated using the formula Qphred = −10log10(e). Q20, Q30: Percentage of bases with Phred values greater than 20 and 30, respectively. GC content: Percentage of total bases that are guanine (G) or cytosine (C).

3.6. Reference Sequence Alignment Analysis

According to the data shown in Table 4, the average proportion of total mapped reads in experimental group 2 exceeded 96.53%, the average proportion of uniquely mapped reads exceeded 91.21%, and the average proportion of multiple mapped reads was less than 5.32%. Table 5 shows the statistics of alignment of Scophthalmus maximus genomic reads to different regions of the reference genome.

Table 4.

Comparison of reads and reference genome in spleen of Scophthalmus maximus immunized with membrane protein vaccine.

Items	Groups
	Immuned			Control
Total reads	47,378,626	47,990,724	52,129,778	53,037,978	56,679,102	45,600,086
Total mapped	45,978,241 (97.04%)	46,398,912 (96.68%)	49,978,148 (95.87%)	50,940,568 (96.05%)	54,186,282 (95.6%)	43,789,034 (96.03%)
Uniquely mapped	42,787,529 (90.31%)	43,475,573 (90.59%)	48,347,483 (92.74%)	48,936,925 (92.27%)	51,903,212 (91.57%)	42,030,762 (92.17%)
Multiple mapped	3,190,712 (6.73%)	2,923,339 (6.09%)	1,630,665 (3.13%)	2,003,643 (3.78%)	2,283,070 (4.03%)	1,758,272 (3.86%)

Notes: Total reads: Number of sequencing sequences after filtering, i.e., statistical results of clean data. Total mapped: Number of sequencing sequences that can be accurately mapped to the genome. Uniquely mapped: Number of sequencing sequences with a unique alignment position on the reference sequence. Multiple mapped: Number of sequencing sequences with multiple alignment positions on the reference sequence.

Table 5.

Statistics of comparison to genomic reads of Scophthalmus maximus in different regions of reference genome.

Items	Groups
	Immuned			Control
Exon	6,462,219,429 (93.8322%)	6,369,143,517 (91.6402%)	6,636,702,877 (88.6729%)	6,825,015,520 (89.4643%)	7,113,384,558 (87.6677%)	5,936,473,335 (90.5335%)
Intron	283,556,284 (4.1173%)	398,472,511 (5.7333%)	625,917,767 (8.3629%)	608,769,949 (7.9799%)	743,496,807 (9.1631%)	396,537,733 (6.0474%)
Intergenic	141,225,426 (2.0506%)	182,544,675 (2.6265%)	221,856,037 (2.9642%)	194,971,971 (2.5558%)	257,144,291 (3.1691%)	224,197,084 (3.4191%)
sum	6,887,001,139 (100%)	6,950,160,703 (100%)	7,484,476,681 (100%)	7,453,277,440 (100%)	8,114,025,656 (100%)	6,557,208,152 (100%)

Notes: Exon: The percentage of reads compared to Exon in the genome annotation that is more complete. Intron: In the genomes with more complete annotation, the percentage of reads compared to the Intron region. Intergenic: In the genomes with more complete annotation, the percentage of reads compared to Intergenic. Sum: In species with more complete genomic annotations, the sum of reads and their percentages for the Exon, Intergenic, and Intron regions were compared.

3.7. Gene Expression-Level Analysis and Screening of Differentially Expressed Genes (DEGs)

To determine gene expression, an FPKM (Fragments Per Kilobase of transcript per Million mapped reads) value of 1 was used as the threshold. According to the data shown in Table 6, when the FPKM value was greater than 1, the number of expressed genes in experimental group 2 accounted for 53.01%, 53.68%, and 52.07% of the total number of genes, respectively, while in the control group, the number of expressed genes accounted for 52.93%, 52.40%, and 53.08% of the total, respectively. In contrast, when the FPKM value was less than 1, the number of expressed genes in experimental group 2 accounted for 46.99%, 46.32%, and 47.94% of the total, respectively, and 47.07%, 47.60%, and 46.92% in the control group. These data clearly show the gene expression profiles within different FPKM ranges, providing important references for subsequent studies.

Table 6.

Gene number tables with different levels of expression.

FPKM Interval	Groups
	Control			Immunized
0~1	12,642 (47.07%)	12,783 (47.6%)	12,600 (46.92%)	12,620 (46.99%)	12,440 (46.32%)	12,875 (47.94%)
1~3	2782 (10.36%)	2778 (10.34%)	2805 (10.44%)	2747 (10.23%)	2849 (10.61%)	2690 (10.02%)
3~15	7223 (26.89%)	7079 (26.36%)	7066 (26.31%)	6958 (25.91%)	7212 (26.85%)	7076 (26.35%)
15~60	3346 (12.46%)	3368 (12.54%)	3327 (12.39%)	3409 (12.69%)	3324 (12.38%)	3321 (12.37%)
>60	864 (3.22%)	849 (3.16%)	1059 (3.94%)	1123 (4.18%)	1032 (3.84%)	895 (3.33%)
sum	26,857 (100%)	26,857 (100%)	26,857 (100%)	26,857 (100%)	26,857 (100%)	26,857 (100%)

Note: FPKM: Fragments Per Kilobase of exon model per Million mapped fragments.

To investigate the effect of the scuticociliate membrane protein vaccine on gene expression in turbot spleen, DESeq software (Version 1.20.0) [19] was used to identify significantly DEGs with padj < 0.05 and |log2-fold change| > 1. A total of 1063 DEGs were screened, including 734 upregulated genes and 329 downregulated genes. The overall distribution of DEGs is illustrated in Figure 5.

Figure 5.

Volcano plot of differentially expressed genes in the spleen. Note: The abscissa represents the log2FoldChange value, and the ordinate represents the −log10 pvalue. The grey dashed lines indicate the threshold for screening DEGs. Each dot in the figure represents a specific gene or transcript. Red dots represent significantly upregulated genes, green dots represent significantly downregulated genes, and blue dots represent genes with no significant difference.

3.8. GO Significance Enrichment Analysis of DEGs

GO enrichment analysis annotated a total of 2912 DEGs, which were classified into three main categories: biological process (BP), cellular component (CC), and molecular function (MF). Among these, the BP category contained 1221 genes (41.93%), the CC category contained 306 genes (10.51%), and the MF category contained 1385 genes (47.56%), which was the largest proportion. These genes were further divided into 30 subcategories, as shown in Figure 6.

Figure 6.

(GO) analysis of unigenes. Unigenes were classified into three GO categories containing 30 sub-categories.

3.9. KEGG Enrichment Analysis of DEGs

Combined with KEGG analysis, the DEGs were assigned to 138 pathways. In this study, the top 20 most significantly enriched pathways were selected for analysis, as shown in Table S1 in the Supplementary Materials. The most enriched pathways were “Glycine, serine and threonine metabolism” (involving genes such as dmgdh, LOC118314208, amt, gamt, gatm, sardh, agxtb, LOC118318328, mao, agxta, gldc, si_ch211-127i16.2, gnmt, LOC118314207) and “One carbon pool by folate” (involving genes such as dmgdh, LOC118314208, mat1a, amt, ahcy, sardh, LOC118318328, aldh1l2, mthfd1b, gldc, ahcyl2b, gnmt, LOC118314207) (Figure 7).

Figure 7.

Statistics of top 20 pathways’ enrichment of differentially expressed genes based on KEGG analysis.

3.10. qPCR Validation

To confirm the expression profiles of differentially expressed genes (DEGs) identified by Illumina sequencing, qPCR was conducted to analyze the relative expression levels of six selected DEGs (LOC118291731, novel.21, tmem45b, tbx6, LOC118284976, and LOC118309980) (Figure 8). As shown in the figure, the qPCR results exhibited a good correlation with the data obtained from RNA-Seq, verifying the reliability of the transcriptomic analysis.

Figure 8.

Validation of RNA−seq data by q−PCR. The expression levels of LOC118291731, novel.21, tmem45b, tbx6, LOC118284976, and LOC118309980 were detected by RNA-seq (black columns) and qRT−PCR (gray columns).

4. Discussion

In the early stage of scuticociliatosis control in aquaculture, chemical drugs and antibiotics were the main countermeasures. For instance, Korean farmers commonly use antibiotics such as oxytetracycline and gentamycin at concentrations of 150–350 ppm, or chemical agents like formalin, hydrogen peroxide, and malachite green for bath treatment [2]. In Spain and Norway, fish farms inhibit scuticociliates in the external environment through formalin baths (60–250 ppm for 30–60 min) [20]. However, these methods have significant limitations: on one hand, formalin and malachite green are highly carcinogenic and have been banned by institutions such as the U.S. Food and Drug Administration (FDA) for use in edible fish farming [2]; on the other hand, the abuse of antibiotics not only induces drug resistance in scuticociliates but also leads to drug residues in fish tissues, posing threats to food safety and human health [21]. Meanwhile, the extensive use of chemical agents disrupts the microecological balance of aquaculture water, exerts toxic effects on non-target organisms, and is seriously inconsistent with the development needs of green aquaculture [22]. Previous studies have confirmed that fish can generate specific immune responses after scuticociliate infection. Agglutinating antibodies targeting the surface antigens of scuticociliates can be detected in the serum of surviving individuals, and these antibodies can immobilize and kill scuticociliates in vitro [5,23]. Consistent with this, the results of serum IgM detection in turbot after vaccine injection in this study indicated that the membrane protein vaccine triggered an immune response in turbot: the serum IgM level peaked one week after the second immunization, which was significantly higher than that in the control group (p < 0.001) and the whole-cell protein vaccine group (p < 0.05). In vitro experiments further demonstrated that the serum of turbot immunized with the membrane protein vaccine produced antibodies against Pseudocohnilembus persalinus, which could stop the movement of scuticociliates and cause their rupture (resulting in the leakage of cellular contents) within a short time. The insecticidal effect of the membrane protein vaccine was superior to that of the whole-cell protein vaccine.

From the perspective of the synergistic mechanism between immune substance synthesis and antioxidant defense, the significant increase in serum IgM levels and the decrease in scuticociliate density at wound sites after challenge in the vaccine-immunized group were closely associated with the activation of the “Glycine, serine and threonine metabolism” pathway. KEGG enrichment analysis in this study revealed that the glycine, serine, and threonine metabolism pathway was significantly activated in the spleen of Scophthalmus maximus following membrane protein vaccine immunization. Multiple genes in this pathway were significantly upregulated with log2-fold change (log2FC) > 5, such as gatm (6.07), agxtb (5.24), agxta (5.20), and gamt (4.15). These genes are extensively involved in glycine and serine metabolism as well as the downstream glutathione synthesis. Existing studies have confirmed that glycine metabolism is crucial for the immune system of fish. For instance, Yang et al. (2021) [24] found that after Oreochromis niloticus (Nile tilapia) was infected with Edwardsiella tarda, the levels of glycine and serine in the survival group were significantly increased, suggesting that this metabolic pathway can enhance the survival rate by improving the antioxidant capacity of immune cells. Glycine is converted into glutathione (GSH), a key intracellular antioxidant that can scavenge reactive oxygen species (ROS) induced by pathogenic infections and reduce tissue damage [25]. Meanwhile, gatm (glycine-aspartate-N-methyltransferase) and gamt (ornithine-methyltransferase) are involved in creatine synthesis; creatine not only serves as a component of the energy-buffering system but also is closely associated with T-cell metabolism [26,27]. Consistent with the experimental results, the relative parasite reduction rates of scuticociliates at the wound sites of fish in the vaccine group reached as high as 87.79% and 74.17% at 24 h and 48 h post-challenge, respectively, and the activities of antioxidant and immune-related enzymes, such as serum peroxidase (POD), superoxide dismutase (SOD), and lysozyme (LZM), were significantly enhanced (p < 0.01). These findings are closely consistent with the upregulation of this pathway, indicating that the metabolic pathway can enhance the function of immune effector cells by providing antioxidant substrates and regulating immune signaling pathways, ultimately achieving efficient clearance of parasites [28,29].

The “One carbon pool by folate” pathway is a key metabolic pathway for DNA synthesis, methylation, and cell proliferation [30]. In this study, multiple genes of this pathway, such as mat1a (5.27), LOC118314208 (6.80), gnmt (1.37), and sardh (1.05), were significantly upregulated, indicating that this pathway was strongly activated. Mat1a (S-adenosylmethionine synthetase) is the rate-limiting enzyme for the synthesis of S-adenosylmethionine (SAM), and SAM, as the main methyl donor in the body, participates in the DNA methylation process, thereby regulating the expression of immune-related genes [31]. Gnmt (glycine n-methyltransferase) belongs to the methyltransferase family and can regulate the SAM/SAH (S-adenosine homocysteine) ratio, thereby affecting the methylation potential and cell differentiation of the body [32]. Additionally, the upregulation of Sardh (succinic semialdehyde dehydrogenase) can promote the conversion of serine to one-carbon units, providing substrates for the folate cycle [33]. Folate metabolism is particularly critical for lymphocytes: Grohmann & Bronte (2010) [34] pointed out that the rapid proliferation of T and B cells depends on active one-carbon metabolism, providing raw materials for the synthesis of deoxythymidine monophosphate (dTMP) and adenosine triphosphate (ATP), and providing energy for the methylation modification process [24,35]. The serum IgM level of turbot (Scophthalmus maximus) in the vaccine group reached its peak one week after the booster immunization. This indicates that B cells have undergone extensive proliferation and differentiation and transformed into plasma cells—a phenomenon that may be closely related to the high activation of this pathway [36]. In the challenge test, the reduced parasite density at the wound sites of Scophthalmus maximus in the vaccine group might also be attributed to folate metabolism, supporting the massive proliferation of macrophages and lymphocytes, which enhances pathogen clearance capacity [37,38].

More importantly, the “Glycine, serine and threonine metabolism” and “One carbon pool by folate” pathways are highly coordinated. Serine serves as the primary donor of one-carbon units for the folate pathway, and it is catalyzed by SHMT to convert into 5,10-methylene-tetrahydrofolate (CH₂-THF), supporting dTMP synthesis and DNA replication [39,40]. In this study, the simultaneous upregulation of mat1a and gnmt suggests functional coupling between the two pathways, effectively ensuring immune cell proliferation and antigen response. This metabolic coordination lays the foundation for the establishment of immune memory in fish upon vaccine stimulation: on the one hand, it supports immune cell expansion by enhancing their metabolism; on the other hand, it provides antioxidant defense to avoid excessive inflammatory damage, ensuring the sustainability and homeostasis of the immune response [41,42].

5. Conclusions

In this study, a membrane protein vaccine was successfully developed using Pseudocohnilembus persalinus as the antigen source, and its immune protective effect and molecular mechanism against scuticociliatosis were systematically evaluated. The results showed that the membrane protein vaccine could induce a strong and specific immune response in turbot. The membrane protein vaccine developed in this study has an excellent immune protective effect against scuticociliatosis in turbot, and its protective mechanisms involve the coordinated activation of multiple metabolic and immune pathways. Meanwhile, the genes in the transcriptome data await further in-depth exploration, which provides data support for the subsequent advanced development of relevant vaccines. This research not only provides a new and effective vaccine candidate for the green prevention and control of turbot scuticociliatosis but also offers a valuable theoretical basis and technical support for the development of subunit vaccines for fish parasites.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/vaccines14020142/s1, Table S1: Differentially expressed genes and differential multiplicity of the top 20 pathways.

Author Contributions

Conceptualization, R.L.; Methodology, R.L.; Investigation, Q.S., B.W., Y.A., X.M. and X.W.; Data curation, Q.S.; Writing—original draft, Q.S.; Writing—review and editing, R.L.; Project administration, R.L.; Funding acquisition, R.L. All authors have read and agreed to the published version of the manuscript.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This work was supported by National Key Research and Development Program of China [2023YFC2812102], Ministry of Agriculture Modern Agriculture Industry Technology System Special Fund [CARS-47].