Skip to main content
Toxics logoLink to Toxics
. 2026 Feb 18;14(2):182. doi: 10.3390/toxics14020182

Cigarette Smoke Extract Combined with LPS Upregulates PITPβ Expression in Chronic Pulmonary Inflammation and May Be Related to the EGFR/ERK Signaling Pathway

Yan Sun 1, Haojie Li 1, Xueqing Zhu 1, Jue Song 1,*
Editor: Alexander N Larcombe1
PMCID: PMC12945249  PMID: 41745856

Abstract

Dysregulated lipid metabolism is increasingly implicated in the pathogenesis of chronic obstructive pulmonary disease (COPD), yet the role of lipid transporters in cigarette smoke (CS)-induced chronic pulmonary inflammation remains unclear. Phosphatidylinositol transfer protein β (PITPβ) is a key regulator of phospholipid transport and phosphatidylinositol (PI) homeostasis. This study aims to investigate the expression of PITPβ in a COPD model induced by cigarette smoke extract (CSE) and lipopolysaccharide (LPS) and to elucidate whether its upregulation is regulated by the epidermal growth factor receptor/extracellular signal-regulated kinase (EGFR/ERK) signaling pathway. This study established an in vivo model through combined CS and LPS exposure and an in vitro model through combined CSE and LPS treatment. In the rat model, significant pathological changes characteristic of COPD were observed, accompanied by marked upregulation of PITPβ, tumor necrosis factor-α (TNF-α), and interleukin-6 (IL-6) expression. In human alveolar epithelial A549 cells, combined CSE and LPS treatment not only upregulated PITPβ, TNF-α, and IL-6 expression but also enhanced the phosphorylation levels of EGFR and ERK. Inhibition or silencing of ERK reduces PITPβ expression and downregulates TNF-α and IL-6 levels, whereas overexpression of ERK produces the opposite effect. Silencing EGFR reduces ERK phosphorylation while simultaneously inhibiting PITPβ, TNF-α, and IL-6 expression. Furthermore, combining EGFR silencing with ERK inhibition further decreases PITPβ expression. These findings indicate that CSE combined with LPS induces PITPβ upregulation in chronic pulmonary inflammation, with the EGFR/ERK signaling pathway at least partially mediating this process. This suggests that PITPβ may serve as a potential therapeutic target for COPD.

Keywords: chronic obstructive pulmonary disease, chronic pulmonary inflammation, PITPβ, ERK, EGFR, cigarette smoke extract

1. Introduction

Chronic obstructive pulmonary disease (COPD) is a clinically heterogeneous disorder characterized by persistent respiratory symptoms and irreversible airflow limitation [1]. Both the initiation and progression of COPD are driven largely by long-term contact with harmful airborne agents, most notably cigarette smoke (CS) and other environmental pollutants, while genetic predisposition, early-life influences, and socioeconomic factors also contribute [2]. COPD has become a major global health issue, causing approximately 3.2 million deaths annually [3,4,5]. Although existing treatments like bronchodilators and inhaled corticosteroids alleviate symptoms and partially slow disease progression, the molecular mechanisms underlying chronic lung inflammation remain incompletely understood. Therefore, identifying novel molecular targets capable of effectively regulating chronic pulmonary inflammatory responses holds significant importance.

A hallmark of COPD is chronic pulmonary inflammation in the lungs, which is frequently associated with airway remodeling, alveolar structural destruction, and narrowing of the small airways. Research indicates that CS not only induces inflammatory cell infiltration and the release of inflammatory mediators [6], but also directly interferes with the synthesis, secretion, and metabolism of pulmonary surfactant, impairing the function of type II alveolar epithelial cells [7,8]. Phospholipids are the primary components of pulmonary surfactant, including phosphatidylcholine (PC), phosphatidylglycerol (PG), and phosphatidylinositol (PI). These phospholipids are crucial for maintaining alveolar surface tension, preserving alveolar structural integrity, and ensuring normal pulmonary function [9,10,11]. Consequently, abnormalities in phospholipid metabolism and transport may hold significant pathological relevance in chronic pulmonary inflammatory responses.

Phosphatidylinositol transfer protein (PITP) is a key member of the phospholipid transfer protein family, widely distributed throughout mammalian organisms [12,13]. Among these, phosphatidylinositol transfer protein α/β (PITPα/β) specifically binds and transports PI and PC, facilitating lipid transfer between different membrane compartments. It is essential for preserving intracellular lipid balance and for supporting lipid-related signaling pathways [14,15]. PI serves not only as a key component of the cell membrane but also as a precursor for multiple signaling lipids, including phosphatidylinositol bisphosphate (PIP2) and phosphatidylinositol trisphosphate (PIP3). Its intracellular transport relies on PITPβ-mediated processes [16]. Previous studies suggest that PITPβ-mediated PI transport may influence multiple inflammation-related signaling pathways [17,18], indicating its potential significance in COPD. However, the upstream regulatory mechanisms of PITPβ in chronic pulmonary inflammatory responses remain unclear.

A transmembrane receptor tyrosine kinase called the epidermal growth factor receptor (EGFR) shows aberrant activation in a number of lung conditions, including COPD [19]. CS stimulation induces EGFR phosphorylation and activates its downstream signaling molecule, extracellular signal-regulated kinase (ERK) [20]. ERK is a key component of the mitogen-activated protein kinase (MAPK) pathway and regulates the transcription of numerous inflammation-associated genes, thereby contributing importantly to chronic inflammatory lung disorders, including COPD [21]. In the chronic inflammatory microenvironment, sustained activation of the EGFR/ERK pathway not only influences inflammatory responses but may also disrupt intracellular lipid homeostasis by interfering with the function of lipid metabolism-related proteins [22,23,24,25,26]. Previous studies have demonstrated that the intracellular localization and transport of PITPβ can be regulated by the EGFR/Ras/MAPK signaling cascade [27,28].

Based on the significant role of the EGFR/ERK signaling pathway in COPD and the crucial function of PITPβ in PI transport and lipid homeostasis maintenance, we speculate that in the COPD model induced by cigarette smoke extract (CSE) combined with lipopolysaccharide (LPS), the expression changes in PITPβ may be regulated by the EGFR/ERK signaling pathway, thereby altering the transport and distribution of PI, and thus participating in the chronic pulmonary inflammatory response process. This study may provide potential directions for elucidating new molecular mechanisms of COPD and searching for potential therapeutic targets.

2. Materials and Methods

2.1. Chemicals

Monoclonal mouse anti-IL-6 antibody (66146-1-Ig), polyclonal rabbit anti-PITPNB antibody (13110-1-AP), and monoclonal mouse anti-TNF-alpha antibody (60291-1-Ig) were purchased from Proteintech (Wuhan, China). Polyclonal rabbit anti-ERK (WL01864) and anti-EGFR antibodies (WL0682a) were purchased from Wanleibio (Shenyang, China). Monoclonal rabbit anti-β-actin (R380624), anti-phospho-EGFR (R26283), and anti-phospho-ERK antibodies (R22917) were purchased from Zenbio (Chengdu, China). SDS-PAGE kits (G2003-50T) were purchased from Servicebio (Wuhan, China). Huangshan cigarettes (31J261C) were purchased from Anhui China Tobacco Industrial Co., Ltd. (Hefei, China). U0126 (S1901), BCA assay kit (P0010), and 4% paraformaldehyde fixative (P0099) were purchased from Beyotime (Shanghai, China). LPS (L2880) was purchased from Sigma (Shanghai, China). BSA (bovine serum albumin; BS114-25) was purchased from Biosharp (Beijing, China). Cell counting kit-8 (CCK8) (C0005) was purchased from TargetMol (Shanghai, China).

2.2. Preparation of Rat Models

The experiment employed male SPF-grade Sprague–Dawley rats (250 ± 10 g). Rats were kept under a 12 h light/dark cycle with free access to food and water, and the animal room was maintained at 24 ± 2 °C with 50 ± 2% relative humidity. A total of 16 rats were randomly assigned to two groups (n = 8 per group), designated as the control group and the model group. The modeling period lasted 21 days. During the modeling period, rats were exposed to CS and LPS stimulation. In the control group, rats were exposed to fresh air and intratracheally administered 200 μL of 0.9% saline during the 3-week modeling phase. During the modeling period, 10 cigarettes were placed in a cigarette smoke generator each day, and animals in the model group were exposed to cigarette smoke for 30 min per day for 21 consecutive days. In addition, on days 1 and 14, animals in the model group received intratracheal instillation of LPS (200 μL of 1 mg/mL LPS dissolved in 0.9% saline). On day 22, the rats were euthanized, and lung tissue was taken for additional experiments.

2.3. Histopathology

After fixation of rat lung tissue specimens in 4% paraformaldehyde for 24 h, the specimens were sequentially dehydrated in graded ethanol, cleared with xylene, and embedded in paraffin. Samples were then paraffin-embedded and sectioned at a thickness of 4–5 μm. Sections were mounted onto glass slides, deparaffinized and rehydrated, and stained with hematoxylin and eosin according to standard protocols. After staining, sections were dehydrated, cleared in xylene, and coverslipped with a neutral mounting medium. Lung injury was evaluated by microscopic examination.

2.4. Preparation of CSE

In the preliminary phase of this study, an A549 cell inflammatory model was established using CSE combined with LPS, based on a literature review and experimental work [29,30]. Six cigarettes were taken and lit, and the resulting smoke was pumped through a vacuum pump into 20 mL of serum-free medium until completely dissolved. The pH was adjusted to approximately 7.3 with sodium hydroxide. CSE prepared by bubbling smoke from six cigarettes into 20 mL of culture medium was defined as 100% CSE. The absorbance of the CSE was measured at 320 nm using a microplate reader (SM-iD-3, BioTek, Winooski, VT, USA), yielding an optical density (OD) of 0.76 ± 0.05. All CSE solutions were prepared fresh and used immediately.

2.5. Cell Culture

A549 human alveolar epithelial cells were obtained from the School of Pharmaceutical Sciences, Anhui Medical University. Cells were cultured in DMEM (C3113-0500, VivaCell, Shanghai, China) supplemented with 10% fetal bovine serum (FBS08-A, Bio-Channel, Nanjing, China) and 1% penicillin–streptomycin (C0222, Beyotime, Shanghai, China). Cells were then maintained at 37 °C in a humidified incubator with 5% CO2 and 95% air until they reached the required confluence for CCK-8, Western blot, RT-qPCR, and immunofluorescence analyses.

2.6. CCK8 Cell Viability Assay

Effect of different concentrations of CSE and U0126 on A549 cell viability based on the CCK8 assay. U0126, a selective MEK inhibitor, was used to block ERK activation (phosphorylation) [31] to investigate the role of the ERK signaling pathway in the cellular inflammatory response induced by combined CSE and LPS stimulation. Cells were seeded into 96-well plates with 100 μL of culture medium containing 5 × 103 cells per well and incubated at 37 °C with 5% CO2 for 24 h, reaching approximately 50–60% confluence. Subsequently, CSE at concentrations of 0.25%, 0.5%, 1%, 2%, 4%, 6%, 8%, and 10%, as well as LPS (10 μg/mL), were added to each well. To determine a safe and effective concentration of U0126, U0126 at 10 μM, 20 μM, and 30 μM was added to cells in a separate 96-well plate. Then, 24 h later, 10 μL of CCK8 reagent was added to each well and incubated for 2 h in an incubator. The OD at 450 nm of each well was measured using a microplate reader (SM-iD-3, BioTek, USA) to evaluate cell viability.

2.7. Cell Model

Based on the CCK8 results, cells seeded in 6-well plates were treated with 0–2% CSE and 10 μg/mL LPS for subsequent experiments. The LPS concentration (10 μg/mL) was selected based on our previous study using a CSE + LPS inflammatory model [29], which has been validated to induce pulmonary inflammatory responses; therefore, it was adopted here to maintain experimental consistency and comparability. After 24 h, cells were harvested for Western blot, RT-qPCR, and immunofluorescence assays to analyze changes in PITPβ activity expression.

2.8. Western Blot Analysis

Protein levels were first quantified using the BCA method to ensure equal sample loading. Equivalent amounts of protein were then resolved by electrophoresis on a 10% polyacrylamide gel containing sodium dodecyl sulfate, followed by electrotransfer onto polyvinylidene difluoride membranes. After transfer, membranes were incubated in a rapid blocking solution for 25 min at room temperature. The membranes were then incubated overnight at 4 °C with primary antibodies (EGFR (1:1000), P-EGFR (1:1000), ERK (1:1000), P-ERK (1:1000), PITPβ (1:1000), β-actin (1:5000), TNF-α (1:1000), and IL-6 (1:1000)). After washing, the membranes were incubated for 1 h at room temperature with an HRP-conjugated secondary antibody (1:5000). Immunoreactive signals were detected using an enhanced chemiluminescence imaging system (Bio-Rad, Hercules, CA, USA), and densitometric quantification of protein bands was performed with ImageJ 1.54d software.

2.9. Real-Time Quantitative PCR (RT-qPCR)

Total RNA was isolated from tissue and cell samples with Trizol reagent, followed by reverse transcription into cDNA, which was maintained at −20 °C until further analysis. RT-qPCR was carried out with SYBR Green Premix Pro TaqHs (AG11701, Accurate, Changsha, China), and relative mRNA expression was calculated using the 2−ΔΔCT method. Sangon Biotech supplied all of the primer sequences used in this investigation; specifics are given in Table 1.

Table 1.

The sequences of primers used in this research.

Gene Species Forward (5′-3′) Reverse (5′-3′)
ACTB Human GCTATCCAGGCTGTGCTATC TGTCACGCACGATTTCC
PITP NB Human GGGTTCCGGGAAGATGGTG GCTGCCCAACCTGATACTCC
TNF - α Human GCCCTGGTATGAGCCCATCT AGTAGACCTGCCCAGACTCG
IL - 6 Human AGCCCACCGGGAACGAAA CCGAAGGCGCTTGTGGAG
EGFR Human CCCACTCATGCTCTACAACCC TCGCACTTCTTACACTTGCGG
MAPK3 Human CTACACGCAGTTGCAGTACAT CAGCAGGATCTGGATCTCCC
MAPK1 Human TACACCAACCTCTCGTACATCG CATGTCTGAAGCGCAGTAAGATT
Actb Rat GAGCGCAAGTACTCTGTGTG CCTGCTTGCTGATCCACATC
P itbnb Rat TCAAGTTCAAGTGGTGGGGG AACCCTTCTTACGCATTGTTTCT
T nf- α Rat TGGGCTCCCTCTCATCAGTTCC GCTCCTCCGCTTGGTGGTTTG
I l- 6 Rat CCAGTTGCCTTCTTGGGACT TGCCATTGCACAACTCTTTTC

2.10. Immunofluorescence

A549 cells were seeded in confocal microplates for culture. Cells were initially preserved by exposure to a 4% paraformaldehyde solution for 15 min under ambient temperature conditions. After fixation, residual fixative was removed by rinsing the samples three times with PBS. A 10% BSA solution was added for blocking at room temperature for 20 min to reduce non-specific binding. Primary antibody (PITPβ) was applied to the confocal microplates and incubated overnight at 4 °C (1:200). The next day, after three washes with PBS, the corresponding fluorescent secondary antibody (1:100) was added and incubated for 1 h at room temperature in the dark. Finally, DAPI was added for 5 min. Images were acquired using a laser scanning confocal microscope (LSM-800, Zeiss, Oberkochen, Germany).

2.11. Statistical Analysis

Statistical analyses were conducted in GraphPad Prism 9.5. Prior to selecting the appropriate statistical tests, data normality was evaluated using the Shapiro–Wilk test implemented in Prism 9.5. Two-group comparisons were analyzed with a t-test for normally distributed data, whereas the Mann–Whitney U test was used when normality was not satisfied. When normality was satisfied, differences among more than two groups were evaluated using one-way ANOVA; otherwise, the Kruskal–Wallis test was applied. Data with a normal distribution are reported as mean ± SD. Differences were considered statistically significant when p < 0.05.

3. Results

3.1. Pathological Changes in Lung Tissue of COPD Rats Induced by Combined CS and LPS

The rat COPD modeling method is shown in Figure 1A. Histological section analysis was performed on lung tissue samples from each group. Relative to the normal group, the model group showed marked lung injury, as evidenced by alveolar disruption and an increased number of cup-shaped cells in the bronchioles (Figure 1B,D). Further quantitative analysis revealed a significantly increased mean linear intercept and small airway wall thickness in the model group (Figure 1C,E; p < 0.01, p < 0.001). These results indicate that CS plus LPS induces lung histopathology in rats, which is consistent with the characteristic pathological features of COPD.

Figure 1.

Figure 1

Schematic diagram of SD rat modeling and histological section analysis of lung tissue sections. (A) Schematic diagram of SD rat modeling. (B,D) H&E staining of SD rat lung tissues; blank areas represent alveoli (scale bar = 50 μm). (C) Mean alveolar diameters in different groups of lung tissues were measured and analyzed (n = 5). (E) Mean small airway wall thickness in different groups was measured and analyzed (n = 5). Results are shown as mean ± SD; ** p < 0.01, *** p < 0.001 compared with control group.

3.2. Upregulation of Phospholipid Transporter PITPβ Expression in a Rat COPD Model Induced by CS Combined with LPS

PITPβ is a crucial phospholipid transporter closely associated with the transport processes of PC and PI, which exhibit significant alterations in phospholipid metabolomics studies. In the rat COPD model established by CS combined with LPS, Western blot and RT-qPCR results showed that both the protein expression and mRNA levels of PITPβ were significantly upregulated (Figure 2A,B; p < 0.01). During inflammatory states, phospholipid transporter PITPβ may participate in phospholipid transmembrane transport through upregulation of its expression and contribute to the regulation of the inflammatory microenvironment by mechanisms such as influencing cell membrane permeability.

Figure 2.

Figure 2

Expression of phosphatidylinositol transfer protein β (PITPβ) and inflammatory factors in lung tissues of rats from different groups. (A) Protein levels of PITPβ, tumor necrosis factor-α (TNF-α), and interleukin-6 (IL-6) were determined by Western blot (n = 6). (B) mRNA levels of Pitpnb, Tnf-α, and IL-6 were quantified by Real-time quantitative PCR (RT-qPCR) (n = 6). Results are shown as mean ± SD; ** p < 0.01, *** p < 0.001 compared with the control group.

3.3. Effects of CSE Combined with LPS on A549 Cell Viability

A CCK8 assay was used to assess the effects of different concentrations of CSE on A549 cell viability. Treatment with 4% CSE led to a significant decline in cell viability, with an inhibition rate of 57.9% (Figure 3A; p < 0.001), indicating excessive cytotoxicity at this concentration and rendering it unsuitable for subsequent experiments. Therefore, a 0–2% CSE gradient plus 10 μg/mL LPS was selected as the modeling condition for subsequent studies.

Figure 3.

Figure 3

Effects of varying cigarette smoke extract (CSE) concentrations with lipopolysaccharide (LPS) co-treatment on PITPβ, extracellular signal-regulated kinase (ERK), epidermal growth factor receptor (EGFR), and inflammatory markers in A549 cells. (A) Cell viability assessed across the CSE dose range; a significant reduction was observed when CSE exceeded 4% (n = 6). (B,C) Protein levels of PITPβ, P-ERK, P-EGFR, TNF-α, and IL-6 were determined by Western blot (n = 3). (D) mRNA levels of PITPNB, mitogen-activated protein kinase 3 (MAPK3), mitogen-activated protein kinase 1 (MAPK1), EGFR, TNF-α, and IL-6 were quantified by RT-qPCR (n = 3). Results are shown as mean ± SD; ns p > 0.05 (ns = not significant), * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control group.

3.4. Upregulation of PITPβ Expression in A549 Cells Induced by Different Concentrations of CSE Combined with LPS

An inflammatory model in A549 cells was established using the aforementioned screened CSE concentration gradient plus LPS (10 μg/mL). Western blot and RT-qPCR were used to detect changes in PITPβ expression at the protein and mRNA levels while simultaneously analyzing the expression of pathway factors such as ERK and EGFR. The model group displayed significantly elevated protein levels of PITPβ, tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), phosphorylated ERK (P-ERK), and phosphorylated EGFR (P-EGFR), consistent with RT-qPCR findings (Figure 3B–D). Further analysis revealed that within the 0–2% CSE concentration range, PITPβ expression exhibited an upward trend with increasing CSE concentration, suggesting a positive correlation between its expression level and the intensity of smoke stimulation. Therefore, 2% CSE was selected as the stimulation concentration for subsequent experiments.

3.5. Inhibition of the ERK Signaling Pathway Reduces PITPβ Expression In Vitro

To investigate the involvement of ERK signaling in the regulation of PITPβ under inflammatory conditions, cells were treated with the ERK inhibitor U0126 [31]. Based on the CCK8 results (Figure 4A), we selected 10 μM U0126 for subsequent experiments. Phosphorylated ERK (P-ERK) levels were considerably higher in the model group than in the control group according to Western blot analysis (Figure 4B,C; p < 0.01). Treatment with U0126 markedly reduced P-ERK levels, accompanied by significant decreases in the protein expression of PITPβ, TNF-α, and IL-6 (Figure 4B,C; p < 0.001, p < 0.01). Consistently, RT-qPCR showed that U0126 treatment significantly reduced the mRNA expression of PITPNB, TNF-α, and IL-6 compared with the model group (Figure 4D; p < 0.001, p < 0.01).

Figure 4.

Figure 4

The effect of U0126 on the expression of PITPβ in the chronic obstructive pulmonary disease (COPD) model of A549 cells. (A) CCK8 assay to evaluate the effects of different concentrations of U0126 on cell viability (n = 6). (B,C) Protein levels of PITPβ, P-ERK, TNF-α, and IL-6 were determined by Western blot (n = 3). (D) mRNA levels of PITPNB, MAPK1, MAPK3, TNF-α, and IL-6 were quantified by RT-qPCR (n = 3). Results are shown as mean ± SD; ns p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control group, and ## p < 0.01, ### p < 0.001 compared with the model group.

3.6. Silencing ERK Downregulates PITPβ Expression In Vitro

To further determine the regulatory role of the ERK signaling pathway in PITPβ expression, an ERK silencing experiment was conducted in A549 cells stimulated with CSE combined with LPS. Western blot analysis revealed that the ERK small interfering RNA (siRNA) group effectively reduced ERK phosphorylation levels compared to the model group (Figure 5A,B; p < 0.001). Concurrently, protein expression of PITPβ, TNF-α, and IL-6 was significantly downregulated relative to the model group (Figure 5A,B; p < 0.01, p < 0.05). RT-qPCR results further confirmed that ERK silencing markedly reduced mRNA expression levels of PITPNB, IL-6, and TNF-α (Figure 5C; p < 0.001). Immunofluorescence results indicated that ERK silencing reduced the fluorescence intensity of PITPβ in A549 cells (Figure 5D,E; p < 0.001).

Figure 5.

Figure 5

Expression of PITPβ in A549 cells transfected with ERK small interfering RNA (siRNA). (A,B) Protein levels of PITPβ, P-ERK, TNF-α, and IL-6 were determined by Western blot (n = 3). (C) mRNA levels of PITPNB, MAPK1, MAPK3, TNF-α, and IL-6 were quantified by RT-qPCR (n = 3). (D,E) Immunofluorescence analysis of PITPβ in A549 cells (scale bar = 200 μm) (n = 3). Results are shown as mean ± SD; * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control group, and ns p > 0.05, # p < 0.05, ## p < 0.01, ### p < 0.001 compared with the model group.

3.7. Overexpression of ERK Upregulates PITPβ Expression In Vitro

To further confirm the regulatory role of the ERK signaling pathway in PITPβ expression, an ERK overexpression experiment was conducted in A549 cells stimulated with CSE combined with LPS. Western blot analysis revealed that the ERK-OE group exhibited significantly elevated levels of ERK phosphorylation compared to the model group (Figure 6A,B; p < 0.01). Concurrently, the protein expression of PITPβ, IL-6, and TNF-α was significantly upregulated compared to the model group (Figure 6A,B; p < 0.01, p < 0.05). RT-qPCR results further confirmed that ERK overexpression significantly reduced mRNA expression levels of PITPNB, TNF-α, and IL-6 (Figure 6C; p < 0.001, p < 0.05). Immunofluorescence results indicated that ERK overexpression increased the fluorescence intensity of PITPβ in A549 cells (Figure 6D,E; p < 0.001).

Figure 6.

Figure 6

Expression of PITPβ in A549 cells transfected with an ERK overexpression plasmid. (A,B) Protein levels of PITPβ, P-ERK, TNF-α, and IL-6 were determined by Western blot (n = 3). (C) mRNA levels of PITPNB, MAPK1, MAPK3, TNF-α, and IL-6 were quantified by RT-qPCR (n = 3). (D,E) Immunofluorescence analysis of PITPβ in A549 cells (scale bar = 200 μm) (n = 3). Results are shown as mean ± SD; ns p > 0.05, ** p < 0.01, *** p < 0.001 compared with the control group, and ns p > 0.05, # p < 0.05, ## p < 0.01, ### p < 0.001 compared with the model group.

3.8. Silencing EGFR Downregulates PITPβ Expression and ERK Phosphorylation In Vitro

To investigate the regulatory role of EGFR on PITPβ expression, EGFR silencing experiments were conducted in A549 cells stimulated with CSE combined with LPS. Western blot analysis (Figure 7A,B) revealed that compared with the model group, EGFR silencing significantly reduced PITPβ protein expression and ERK phosphorylation (p < 0.01, p < 0.001) while simultaneously downregulating TNF-α and IL-6 expression (p < 0.01, p < 0.001). RT-qPCR results were consistent, showing significant downregulation of PITPNB, TNF-α, and IL-6 mRNA expression (Figure 7C; p < 0.001, p < 0.01). Immunofluorescence further revealed markedly reduced PITPβ fluorescence intensity (Figure 7D,E; p < 0.001). These findings indicate that EGFR silencing suppresses ERK signaling pathway phosphorylation and PITPβ expression.

Figure 7.

Figure 7

Expression of PITPβ and ERK in A549 cells transfected with EGFR siRNA. (A,B) Protein levels of PITPβ, P-ERK, P-EGFR, TNF-α, and IL-6 were determined by Western blot (n = 3). (C) mRNA levels of PITPNB, MAPK1, MAPK3, EGFR, TNF-α, and IL-6 were quantified by RT-qPCR (n = 3). (D,E) Immunofluorescence analysis of PITPβ in A549 cells (scale bar = 200 μm) (n = 3). Results are shown as mean ± SD; ** p < 0.01, *** p < 0.001 compared with the control group, and ns p > 0.05, ## p < 0.01, ### p < 0.001 compared with the model group.

3.9. Silencing EGFR Downregulates PITPβ Expression via the ERK Signaling Pathway In Vitro

To further determine whether EGFR regulates PITPβ via the ERK pathway, we combined EGFR silencing with the ERK inhibitor U0126. Results showed that PITPβ protein and ERK phosphorylation levels were further reduced, while TNF-α and IL-6 were further downregulated (Figure 8A,B; p < 0.01). RT-qPCR results similarly demonstrated significant downregulation of PITPNB, TNF-α, and IL-6 mRNA expression (Figure 8C; p < 0.01, p < 0.01). Immunofluorescence revealed further diminished PITPβ intensity (Figure 8D,E; p < 0.001). U0126 treatment did not alter EGFR phosphorylation levels, suggesting that EGFR regulates PITPβ and inflammatory responses via ERK signaling.

Figure 8.

Figure 8

Expression of PITPβ and ERK in A549 cells co-treated with EGFR siRNA and U0126. (A,B) Protein levels of PITPβ, P-ERK, P-EGFR, TNF-α, and IL-6 were determined by Western blot (n = 3). (C) mRNA levels of PITPNB, MAPK1, MAPK3, EGFR, TNF-α, and IL-6 were quantified by RT-qPCR (n = 3). (D,E) Immunofluorescence analysis of PITPβ in A549 cells (scale bar = 200 μm) (n = 3). Results are shown as mean ± SD; ** p < 0.01, *** p < 0.001 compared with the control group, ## p < 0.01, ### p < 0.001 compared with the model group, and ns p > 0.05, & p < 0.05, && p < 0.01, &&& p < 0.001 compared with the EGFR siRNA group.

4. Discussion

COPD is a prevalent chronic respiratory disease defined by sustained airflow limitation and is strongly linked to ongoing lung inflammation. As a prototypical chronic inflammatory pulmonary disorder, it imposes a substantial global public health burden, and effective treatment remains a major clinical challenge [32]. Extensive epidemiological and experimental studies indicate that smoking is the primary risk factor for COPD [33], yet the molecular mechanisms by which it drives chronic inflammation remain incompletely understood. Therefore, identifying novel molecular targets capable of effectively regulating chronic pulmonary inflammatory responses holds significant scientific and clinical importance.

This study employed a combined CS and LPS approach to establish an in vivo rat COPD model, alongside a combined CSE and LPS approach to construct an in vitro cellular model, thereby simulating the pulmonary inflammatory environment resulting from the combined effects of smoking and infection [34,35]. Both CS and LPS are key pathogenic molecules capable of inducing inflammation and rapidly replicating the pathological changes and inflammatory responses in respiratory tract injury similar to those seen in COPD [36,37]. At the cellular level, the human alveolar epithelial cell line A549 is widely used in studies of COPD-related inflammation, injury, and repair mechanisms due to its similarity to type II alveolar epithelial cells [38]. At the animal level, SD rats are sensitive to cigarette smoke exposure and effectively reproduce the pathophysiological characteristics of human COPD, making them an ideal animal model for studying this disease [39]. Lung histopathology revealed significantly increased alveolar diameters and bronchial wall thickness in the model group. Western blot and RT-qPCR analyses demonstrated upregulation of inflammatory factor expression. These findings confirm severe lung tissue damage consistent with a chronic pulmonary inflammation model, establishing a reliable foundation for investigating COPD-related molecular mechanisms in this study.

PITPβ is a pivotal regulator linking cellular lipid metabolism with phosphoinositide signaling [40]. Acting as a modulatory factor, it contributes to cell proliferation, membrane trafficking, and signal transduction via protein–protein and protein–lipid interactions [41]. Studies indicate that PITPα/β functions as phospholipid transporters involved in regulating proliferation, inflammation, and apoptosis in tumors and neurological disorders [42,43,44]. Research demonstrates that CS induces lipid accumulation or alterations, which compromise the integrity of various cellular and organelle membranes. These changes potentially trigger chronic inflammation, contributing to the onset or exacerbation of COPD [45,46]. Both biochemical reactions occur during lipid metabolism, providing a foundation for investigating the correlation between smoking-induced lung diseases and PITPβ. In this study, we show for the first time that PITPβ is markedly increased at both the protein and mRNA levels in COPD models in vivo and in vitro, suggesting its potential involvement in the pathological process of COPD-related chronic inflammation.

The MAPK signaling pathway is one of the core pathways regulating cellular inflammation and stress responses, and its abnormal activation is closely linked to the development and progression of COPD [47]. As a key member of the MAPK family, abnormal activation of ERK can phosphorylate nuclear transcription factors, including activator protein-1 and nuclear factor κB, promoting the transcriptional expression of inflammatory cytokines such as TNF-α and IL-6, thereby exacerbating pulmonary inflammation [48]. Furthermore, studies suggest ERK signaling may influence lipid transporter function by promoting phospholipid efflux [24], indicating potential involvement in lipid metabolism-related inflammatory regulation. Accordingly, this study examined the involvement of ERK signaling in chronic inflammation triggered by CSE plus LPS. Our results show that co-stimulation with CSE and LPS activates the ERK pathway. However, treatment with the inhibitor U0126 or ERK silencing downregulates the expression of PITPβ and inflammatory mediators TNF-α and IL-6, thereby alleviating inflammation. Conversely, ERK overexpression exacerbates this phenomenon. The consistent positive and negative results indicate that in CSE plus LPS–induced chronic lung inflammation, alterations in PITPβ expression may be associated with ERK signaling.

EGFR is widely expressed in airway and alveolar epithelial cells, participating in the regulation of epithelial cell proliferation, migration, differentiation, and inflammatory responses [49,50]. Studies suggest that EGFR may influence the localization and function of PITPβ in organelles such as the Golgi apparatus, and EGFR serves as a classic upstream activator of ERK. For instance, the EGFR inhibitor gefitinib suppresses tumor growth by interfering with multiple signaling pathways, including STAT/AKT/ERK [51]; the natural product luteolin alleviates inflammatory damage by inhibiting the EGFR/ERK pathway [52]. Consistent with these findings, our study demonstrated that EGFR silencing suppressed ERK phosphorylation and downregulated PITPβ and inflammatory factor expression. Further combined intervention experiments demonstrated that co-treatment with the ERK inhibitor U0126 on top of EGFR silencing further reduced PITPβ and inflammatory factor expression levels without affecting EGFR’s own phosphorylation. Therefore, we suggest that, in CSE plus LPS-induced chronic lung inflammation, PITPβ expression changes may be linked to EGFR-mediated ERK signaling.

In summary, this study first reveals that phospholipid transfer protein PITPβ expression is upregulated in both in vivo and in vitro models of COPD, and this process may be associated with the EGFR-mediated ERK signaling pathway. Inhibiting this pathway downregulates PITPβ expression, thereby modulating lipid metabolism to alleviate inflammatory responses. This suggests that PITPβ may serve as a potential anti-inflammatory therapeutic target for COPD. However, this paper only hypothesizes this mechanism based on model studies. Although we selected the combined CSE and LPS model as the primary stimulation condition because it produces a robust and reproducible inflammatory phenotype and is relevant to COPD, several limitations should be acknowledged. First, this study did not systematically delineate the respective contributions of CSE and LPS to changes in PITPβ expression, the EGFR/ERK signaling pathway, and downstream inflammatory mediators. Second, the in vivo experiments did not directly establish a mechanistic link between PITPβ and the EGFR/ERK pathway. Therefore, future studies will evaluate the independent effects of CSE and LPS and will further investigate the regulatory relationship between PITPβ and EGFR/ERK in COPD by constructing whole-animal knockout models. This is of great significance for identifying therapeutic targets for this disease and warrants further exploration.

5. Conclusions

In summary, this study demonstrates that PITPβ expression is significantly upregulated in both in vivo COPD models induced by CS combined with LPS and in vitro COPD models induced by CSE combined with LPS. This process may be partially regulated by the EGFR/ERK signaling pathway. Silencing EGFR downregulates PITPβ expression by inhibiting the ERK pathway, thereby reducing inflammation. This discovery facilitates further investigation into the alterations of PITPβ in lipid metabolism and its regulatory mechanisms within the chronic pulmonary inflammatory microenvironment and holds promise as a potential therapeutic target for COPD.

Abbreviations

COPD Chronic obstructive pulmonary disease
CSE Cigarette smoke extract
CS Cigarette smoke
LPS Lipopolysaccharide
PITPβ Phosphatidylinositol transfer protein β
ERK Extracellular signal-regulated kinase
EGFR Epidermal growth factor receptor
PI Phosphatidylinositol
PC Phosphatidylcholine
PG Phosphatidylglycerol

Author Contributions

Conceptualization, Y.S. and J.S.; Writing—review and editing, Y.S. and J.S.; Project administration, Y.S. and J.S.; Data curation, Y.S., H.L. and X.Z.; Formal analysis, H.L. and X.Z.; Funding acquisition, J.S. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

The animal study protocol was approved by the Animal Ethics Committee of Anhui Medical University (protocol code: LLSC-20251027; date of approval: 1 March 2025).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This research was funded by the Anhui Provincial Natural Science Research Program for Higher Education Institutions (2024AH050659).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Xu J., Zeng Q., Li S., Su Q., Fan H. Inflammation mechanism and research progress of COPD. Front. Immunol. 2024;15:1404615. doi: 10.3389/fimmu.2024.1404615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Christenson S.A., Smith B.M., Bafadhel M., Putcha N. Chronic obstructive pulmonary disease. Lancet. 2022;399:2227–2242. doi: 10.1016/S0140-6736(22)00470-6. [DOI] [PubMed] [Google Scholar]
  • 3.Boers E., Barrett M., Su J.G., Benjafield A.V., Sinha S., Kaye L., Zar H.J., Vuong V., Tellez D., Gondalia R., et al. Global Burden of Chronic Obstructive Pulmonary Disease Through 2050. JAMA Netw. Open. 2023;6:e2346598. doi: 10.1001/jamanetworkopen.2023.46598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Upadhyay P., Wu C., Pham A., Zeki A.A., Royer C.M., Kodavanti U.P., Takeuchi M., Bayram H., Pinkerton K.E. Animal models and mechanisms of tobacco smoke-induced chronic obstructive pulmonary disease (COPD) J. Toxicol. Env. Health B Crit. Rev. 2023;26:275–305. doi: 10.1080/10937404.2023.2208886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Chen S., Kuhn M., Prettner K., Yu F., Yang T., Bärnighausen T., Bloom D.E., Wang C. The global economic burden of chronic obstructive pulmonary disease for 204 countries and territories in 2020–50: A health-augmented macroeconomic modelling study. Lancet Glob. Health. 2023;11:e1183–e1193. doi: 10.1016/S2214-109X(23)00217-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Barnes P.J. Inflammatory mechanisms in patients with chronic obstructive pulmonary disease. J. Allergy. Clin. Immunol. 2016;138:16–27. doi: 10.1016/j.jaci.2016.05.011. [DOI] [PubMed] [Google Scholar]
  • 7.Griese M. Pulmonary surfactant in health and human lung diseases: State of the art. Eur. Respir. J. 1999;13:1455–1476. doi: 10.1183/09031936.99.13614779. [DOI] [PubMed] [Google Scholar]
  • 8.Agudelo C.W., Kumley B.K., Area-Gomez E., Xu Y., Dabo A.J., Geraghty P., Campos M., Foronjy R., Garcia-Arcos I. Decreased surfactant lipids correlate with lung function in chronic obstructive pulmonary disease (COPD) PLoS ONE. 2020;15:e0228279. doi: 10.1371/journal.pone.0228279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Numata M., Voelker D.R. Anti-inflammatory and anti-viral actions of anionic pulmonary surfactant phospholipids. Biochim. Biophys. Acta Mol. Cell Biol. Lipids. 2022;1867:159139. doi: 10.1016/j.bbalip.2022.159139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Burgy O., Loriod S., Beltramo G., Bonniaud P. Extracellular Lipids in the Lung and Their Role in Pulmonary Fibrosis. Cells. 2022;11:1209. doi: 10.3390/cells11071209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Agudelo C.W., Samaha G., Garcia-Arcos I. Alveolar lipids in pulmonary disease. A review. Lipids Health Dis. 2020;19:122. doi: 10.1186/s12944-020-01278-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hsuan J., Cockcroft S. The PITP family of phosphatidylinositol transfer proteins. Genome Biol. 2001;2:reviews3011.1. doi: 10.1186/gb-2001-2-9-reviews3011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Cockcroft S., Carvou N. Biochemical and biological functions of class I phosphatidylinositol transfer proteins. Biochim Biophys Acta. 2007;1771:677–691. doi: 10.1016/j.bbalip.2007.03.009. [DOI] [PubMed] [Google Scholar]
  • 14.Ile K.E., Schaaf G., Bankaitis V.A. Phosphatidylinositol transfer proteins and cellular nanoreactors for lipid signaling. Nat. Chem. Biol. 2006;2:576–583. doi: 10.1038/nchembio835. [DOI] [PubMed] [Google Scholar]
  • 15.Lipp N., Ikhlef S., Milanini J., Drin G. Lipid Exchangers: Cellular Functions and Mechanistic Links with Phosphoinositide Metabolism. Front. Cell Dev. Biol. 2020;8:663. doi: 10.3389/fcell.2020.00663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ashlin T.G., Blunsom N.J., Cockcroft S. Courier service for phosphatidylinositol: PITPs deliver on demand. Biochim. Biophys. Acta Mol. Cell Biol. Lipids. 2021;1866:158985. doi: 10.1016/j.bbalip.2021.158985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lesko J., Triebl A., Stacher-Priehse E., Fink-Neuböck N., Lindenmann J., Smolle-Jüttner F., Köfeler H.C., Hrzenjak A., Olschewski H., Leithner K. Phospholipid dynamics in ex vivo lung cancer and normal lung explants. Exp. Mol. Med. 2021;53:81–90. doi: 10.1038/s12276-020-00547-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Yalcin A., Clem B., Makoni S., Clem A., Nelson K., Thornburg J., Siow D., Lane A.N., Brock S.E., Goswami U., et al. Selective inhibition of choline kinase simultaneously attenuates MAPK and PI3K/AKT signaling. Oncogene. 2010;29:139–149. doi: 10.1038/onc.2009.317. [DOI] [PubMed] [Google Scholar]
  • 19.Sabbah D.A., Hajjo R., Sweidan K. Review on Epidermal Growth Factor Receptor (EGFR) Structure, Signaling Pathways, Interactions, and Recent Updates of EGFR Inhibitors. Curr. Top. Med. Chem. 2020;20:815–834. doi: 10.2174/1568026620666200303123102. [DOI] [PubMed] [Google Scholar]
  • 20.Goldkorn T., Filosto S. Lung injury and cancer: Mechanistic insights into ceramide and EGFR signaling under cigarette smoke. Am. J. Respir. Cell Mol. Biol. 2010;43:259–268. doi: 10.1165/rcmb.2010-0220RT. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Mercer B.A., D’Armiento J.M. Emerging role of MAP kinase pathways as therapeutic targets in COPD. Int. J. Chronic Obstr. Pulm. Dis. 2006;1:137–150. doi: 10.2147/copd.2006.1.2.137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Pan Z., Wang K., Wang X., Jia Z., Yang Y., Duan Y., Huang L., Wu Z., Zhang J., Ding X. Cholesterol promotes EGFR-TKIs resistance in NSCLC by inducing EGFR/Src/Erk/SP1 signaling-mediated ERRα re-expression. Mol. Cancer. 2022;21:77. doi: 10.1186/s12943-022-01547-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.El-Hashim A.Z., Khajah M.A., Renno W.M., Babyson R.S., Uddin M., Benter I.F., Ezeamuzie C., Akhtar S. Src-dependent EGFR transactivation regulates lung inflammation via downstream signaling involving ERK1/2, PI3Kδ/Akt and NFκB induction in a murine asthma model. Sci. Rep. 2017;7:9919. doi: 10.1038/s41598-017-09349-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Agassandian M., Miakotina O.L., Andrews M., Mathur S.N., Mallampalli R.K. Pseudomonas aeruginosa and sPLA2 IB stimulate ABCA1-mediated phospholipid efflux via ERK-activation of PPARalpha-RXR. Biochem. J. 2007;403:409–420. doi: 10.1042/BJ20061364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Gu W., Song L., Li X., Wang D., Guo X., Xu W. Mesenchymal stem cells alleviate airway inflammation and emphysema in COPD through down-regulation of cyclooxygenase-2 via p38 and ERK MAPK pathways. Sci. Rep. 2015;5:8733. doi: 10.1038/srep08733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kunzelmann-Marche C., Freyssinet J., Martínez M.C. Loss of plasma membrane phospholipid asymmetry requires raft integrity. Role of transient receptor potential channels and ERK pathway. J. Biol. Chem. 2002;277:19876–19881. doi: 10.1074/jbc.M200324200. [DOI] [PubMed] [Google Scholar]
  • 27.Kauffmann-Zeh A., Thomas G.M., Ball A., Prosser S., Cunningham E., Cockcroft S., Hsuan J.J. Requirement for phosphatidylinositol transfer protein in epidermal growth factor signaling. Science. 1995;268:1188–1190. doi: 10.1126/science.7761838. [DOI] [PubMed] [Google Scholar]
  • 28.Larijani B., Allen-Baume V., Morgan C.P., Li M., Cockcroft S. EGF regulation of PITP dynamics is blocked by inhibitors of phospholipase C and of the Ras-MAP kinase pathway. Curr. Biol. 2003;13:78–84. doi: 10.1016/S0960-9822(02)01395-7. [DOI] [PubMed] [Google Scholar]
  • 29.Fang X., Wang Z., Qi C., Zhou J., Zhang S., Song J. The changes of MRP2 expression in three kinds of pulmonary inflammation models: The downregulation occurred in cigarette smoke extract (CSE) stimulation group and CSE plus LPS stimulation group, unchanged in LPS stimulation group. Toxicol. Mech. Methods. 2021;31:413–424. doi: 10.1080/15376516.2021.1903638. [DOI] [PubMed] [Google Scholar]
  • 30.Qi C., Zhou J., Wang Z., Fang X., Li D., Jin Y., Song J. Cigarette smoke extract combined with lipopolysaccharide reduces OCTN1/2 expression in human alveolar epithelial cells in vitro and rat lung in vivo under inflammatory conditions. Int. Immunopharmacol. 2020;87:106812. doi: 10.1016/j.intimp.2020.106812. [DOI] [PubMed] [Google Scholar]
  • 31.Zhai H., Pan T., Yang H., Wang H., Wang Y. Cadmium induces A549 cell migration and invasion by activating ERK. Exp. Ther. Med. 2019;18:1793–1799. doi: 10.3892/etm.2019.7750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.de Oca M.M., Perez-Padilla R., Celli B., Aaron S.D., Wehrmeister F.C., Amaral A.F.S., Mannino D., Zheng J., Salvi S., Obaseki D., et al. The global burden of COPD: Epidemiology and effect of prevention strategies. Lancet Resp. Med. 2025;13:709–724. doi: 10.1016/S2213-2600(24)00339-4. [DOI] [PubMed] [Google Scholar]
  • 33.Lareau S.C., Fahy B., Meek P., Wang A. Chronic Obstructive Pulmonary Disease (COPD) Am. J. Respir. Crit. Care Med. 2019;199:P1–P2. doi: 10.1164/rccm.1991P1. [DOI] [PubMed] [Google Scholar]
  • 34.Hardaker E.L., Freeman M.S., Dale N., Bahra P., Raza F., Banner K.H., Poll C. Exposing rodents to a combination of tobacco smoke and lipopolysaccharide results in an exaggerated inflammatory response in the lung. Br. J. Pharmacol. 2010;160:1985–1996. doi: 10.1111/j.1476-5381.2010.00857.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zhou Y., Tan X., Kuang W., Liu L., Wan L. Erythromycin ameliorates cigarette-smoke-induced emphysema and inflammation in rats. Transl. Res. 2012;159:464–472. doi: 10.1016/j.trsl.2011.09.007. [DOI] [PubMed] [Google Scholar]
  • 36.Li D., Sun D., Yuan L., Liu C., Chen L., Xu G., Shu J., Guan R., Xu J., Li Y., et al. Sodium tanshinone IIA sulfonate protects against acute exacerbation of cigarette smoke-induced chronic obstructive pulmonary disease in mice. Int. Immunopharmacol. 2020;81:106261. doi: 10.1016/j.intimp.2020.106261. [DOI] [PubMed] [Google Scholar]
  • 37.Yang Y., Di T., Zhang Z., Liu J., Fu C., Wu Y., Bian T. Dynamic evolution of emphysema and airway remodeling in two mouse models of COPD. BMC Pulm. Med. 2021;21:134. doi: 10.1186/s12890-021-01456-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Siriphorn S.V., Thorsuwan S., Thongam J., Ruangklai S., Hussarin P., Rungruang T., Srisuma S. Alterations in Adiponectin Expression in Models of Cigarette Smoke Extract-Induced Mouse Pulmonary Emphysema and Alveolar Epithelial Cell Injury. COPD J. Chronic Obstr. Pulm. Dis. 2025;22:2477235. doi: 10.1080/15412555.2025.2477235. [DOI] [PubMed] [Google Scholar]
  • 39.Possebon L., de Souza Lima Lebron I., Furlan Da Silva L., Tagliaferri Paletta J., Glad B.G., Sant’Ana M., Iyomasa-Pilon M.M., Ribeiro Souza H., de Souza Costa S., Pereira Da Silva Rodriguesa G., et al. Anti-inflammatory actions of herbal medicines in a model of chronic obstructive pulmonary disease induced by cigarette smoke. Biomed. Pharmacother. 2018;99:591–597. doi: 10.1016/j.biopha.2018.01.106. [DOI] [PubMed] [Google Scholar]
  • 40.Hirsch E., Gulluni F., Martini M. Phosphoinositides in cell proliferation and metabolism. Adv. Biol. Regul. 2020;75:100693. doi: 10.1016/j.jbior.2020.100693. [DOI] [PubMed] [Google Scholar]
  • 41.Cockcroft S., Garner K. Potential role for phosphatidylinositol transfer protein (PITP) family in lipid transfer during phospholipase C signalling. Adv. Biol. Regul. 2013;53:280–291. doi: 10.1016/j.jbior.2013.07.007. [DOI] [PubMed] [Google Scholar]
  • 42.Vieira N.M., Spinazzola J.M., Alexander M.S., Moreira Y.B., Kawahara G., Gibbs D.E., Mead L.C., Verjovski-Almeida S., Zatz M., Kunkel L.M. Repression of phosphatidylinositol transfer protein α ameliorates the pathology of Duchenne muscular dystrophy. Proc. Natl. Acad. Sci. USA. 2017;114:6080–6085. doi: 10.1073/pnas.1703556114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Alb J.G.J., Cortese J.D., Phillips S.E., Albin R.L., Nagy T.R., Hamilton B.A., Bankaitis V.A. Mice lacking phosphatidylinositol transfer protein-alpha exhibit spinocerebellar degeneration, intestinal and hepatic steatosis, and hypoglycemia. J. Biol. Chem. 2003;278:33501–33518. doi: 10.1074/jbc.M303591200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Yang H., Zhang X., Wang C., Zhang H., Yi J., Wang K., Hou Y., Ji P., Jin X., Li C., et al. Microcolin H, a novel autophagy inducer, exerts potent antitumour activity by targeting PITPα/β. Signal Transduct. Target. Ther. 2023;8:428. doi: 10.1038/s41392-023-01667-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Luchese C., Stangherlin E.C., Gay B.M., Nogueira C.W. Antioxidant effect of diphenyl diselenide on oxidative damage induced by smoke in rats: Involvement of glutathione. Ecotoxicol. Environ. Saf. 2009;72:248–254. doi: 10.1016/j.ecoenv.2008.06.003. [DOI] [PubMed] [Google Scholar]
  • 46.Telenga E.D., Hoffmann R.F., Ruben T., Hoonhorst S.J.M., Willemse B.W.M., van Oosterhout A.J.M., Heijink I.H., van den Berge M., Jorge L., Sandra P., et al. Untargeted lipidomic analysis in chronic obstructive pulmonary disease. Uncovering sphingolipids. Am. J. Respir. Crit. Care Med. 2014;190:155–164. doi: 10.1164/rccm.201312-2210OC. [DOI] [PubMed] [Google Scholar]
  • 47.Feng Y., Qin P., Wang R., Mi Y., Li Y., Feng J., Shen W., Dong H., Duo J., Ma L., et al. Effects of Tibetan medicine Longdan zhike tablet on chronic obstructive pulmonary disease through MAPK pathway. J. Ethnopharmacol. 2024;328:118082. doi: 10.1016/j.jep.2024.118082. [DOI] [PubMed] [Google Scholar]
  • 48.Liu D., Xu W., Tang Y., Cao J., Chen R., Wu D., Chen H., Su B., Xu J. Nebulization of risedronate alleviates airway obstruction and inflammation of chronic obstructive pulmonary diseases via suppressing prenylation-dependent RAS/ERK/NF-κB and RhoA/ROCK1/MLCP signaling. Respir. Res. 2022;23:380. doi: 10.1186/s12931-022-02274-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Inoue H., Akimoto K., Homma T., Tanaka A., Sagara H. Airway Epithelial Dysfunction in Asthma: Relevant to Epidermal Growth Factor Receptors and Airway Epithelial Cells. J. Clin. Med. 2020;9:3698. doi: 10.3390/jcm9113698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Burgess A.W. Regulation of Signaling from the Epidermal Growth Factor Family. J. Phys. Chem. B. 2022;126:7475–7485. doi: 10.1021/acs.jpcb.2c04156. [DOI] [PubMed] [Google Scholar]
  • 51.Mhone T.G., Chen M., Kuo C., Shih T., Yeh C., Wang T., Chen R., Chang Y., Kuo W., Huang C. Daidzein Synergizes with Gefitinib to Induce ROS/JNK/c-Jun Activation and Inhibit EGFR-STAT/AKT/ERK Pathways to enhance Lung Adenocarcinoma cells chemosensitivity. Int. J. Biol. Sci. 2022;18:3636–3652. doi: 10.7150/ijbs.71870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Gu M., Pang Z. Luteolin inhibits inflammation and M1 macrophage polarization in the treatment of Pseudomonas aeruginosa-induced acute pneumonia through suppressing EGFR/PI3K/AKT/NF-κB and EGFR/ERK/AP-1 signaling pathways. Phytomedicine. 2025;141:156663. doi: 10.1016/j.phymed.2025.156663. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.


Articles from Toxics are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES