Simple Summary
Animal health and milk quality are both adversely affected by mastitis, a frequently occurring udder condition in dairy cattle. This study focused on the bovine C4BPA gene to explore whether it could be a key to combating mastitis. We found that deactivating C4BPA in bovine mammary epithelial cells reduces inflammatory factor levels. Additionally, deactivating this gene alters mitochondrial structure and morphology and increases the levels of reactive oxygen species. These changes trigger a cellular process called mitophagy, which results in the clearance of damaged mitochondria. Most importantly, we found that this clearance process helps alleviate inflammation. In short, our research demonstrates that the C4BPA gene regulates both mitophagy and inflammation. Leveraging this mechanistic understanding, the present work proposes novel molecular targets for the prediction of bovine mastitis.
Keywords: C4BPA, mitophagy, NF-κB, inflammatory response
Abstract
Mastitis is a prevalent disease in the dairy cattle industry and has adverse effects on dairy cows’ health and milk quality. Importantly, mastitis is associated with the inflammatory response and mitophagy. As a complement-regulatory factor, C4b-binding protein alpha (C4BPA) has been shown to modulate inflammatory factors. This study further investigates its role and mechanisms in regulating mitophagy and inflammatory responses. Following C4BPA knockout, bovine mammary epithelial cells (BMECs) exhibited reduced expression of TLR4 and key pro-inflammatory cytokines, namely the tumour necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6). Electron microscopy revealed a marked increase in mitochondrial membrane rupture, as well as cristae disorder and damage and increased reactive oxygen species (ROS) levels. Moreover, Pink1 and Parkin protein levels were increased, as was LC3B lipidation (LC3B-II), whereas p62 protein expression was significantly downregulated. Immunofluorescence indicated substantially increased LC3 colocalization with mitochondria, suggesting that C4BPA gene knockout activated Pink1/Parkin-mediated mitophagy. The fact that C4BPA knockout decreased the levels of p-IκB and p-p65 while increasing those of IκBα and p65 therefore indicates its regulatory role in the NF-κB-mediated inflammatory response. Together, these findings reveal that C4BPA deficiency in BMECs not only activates Pink1/Parkin-mediated mitophagy but also suppresses the NF-κB-mediated inflammatory response. This study provides novel potential molecular targets for predicting mastitis in dairy cattle.
1. Introduction
The complement system, as a core innate immune component for host defence and clearance of immune complexes, executes important biological functions to resist bovine mastitis [1,2]. To maintain the delicate balance of immunity and tolerance and prevent excessive activation of the complement system, complement inhibitors are essential [3]. C4b-binding protein (C4BP) is a complement-regulatory factor and major liquid-phase inhibitor [4]. It is composed of two different polypeptides—a 70 kDa α chain and a 45 kDa β chain—which, respectively, enable it to bind and inactivate vitamin K-dependent protein S [5]. C4b-binding protein alpha (C4BPA) also functions as an atypical regulator of NF-κB-dependent cell death [6].
Mastitis, a relatively common disease in dairy farming, refers to an infection of the udder and is primarily attributed to pathogenic bacteria or environmental factors [7]. This disease not only severely affects dairy cows’ productivity, health, and welfare, but also places a considerable financial burden on dairy production [8]. Mastitis in dairy cows is classically characterized by udder redness, swelling, heat, and pain. In addition, mastitis reduces the quality of milk, resulting in decreases in its protein and fat contents [9,10,11,12,13]. In severe cases, affected cows may even lose their lactation capacity [14]. Treating mastitis also incurs the costs of medicine and veterinary treatment. Consequently, extensive research has been focused on enhancing mastitis resistance through breeding.
Mastitis is accompanied by an inflammatory response in mammary gland tissue [15]. Research indicates that the mastitis-induced inflammatory response is characterized via inflammatory cytokine secretion—namely tumour necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6)—and reactive oxygen species (ROS) [16]. Bovine mammary epithelial cells (BMECs) are characterized by their dual capacity for milk secretion and for providing the initial defence against pathogens [17]. The process of milk secretion is fuelled by mitochondria through the production of copious ATP. Mitochondria are important organelles for maintaining cellular homeostasis and very important for regulating endogenous cellular inflammation [18,19]. Mitochondrial dysfunction and the inflammatory response are closely correlated [20]. Mitophagy is essential for controlling the quantity of mitochondria within cells and maintaining their normal function and structure, thereby ensuring cellular and organismal homeostasis [21]. Moreover, mitophagy is associated with mastitis. Li et al. [22] reported that Lactobacillus rhamnosus GR-1 prevented Escherichia coli-induced inflammation in bovine mastitis through Pink1-/Parkin-mediated mitophagy.
Our previous studies revealed that the key parameters including inflammatory factor expression and NF-κB pathway activity were altered by transfection of C4BPA interference or overexpression vectors into BMECs [23]. While interference with C4BPA expression shows potential in suppressing the inflammatory response, the underlying mechanisms of this phenomenon require further investigation.
Therefore, to investigate how C4BPA deficiency affects the cellular inflammatory response, in this study, we utilized a C4BPA knockout cell line. This study may provide novel potential molecular targets for predicting bovine mastitis.
2. Materials and Methods
2.1. Cell Culture
Bovine mammary epithelial cells (BMECs) and the C4BPA knockout line, were provided by the Laboratory of Animal Molecular Genetics at Guangdong Ocean University’s College of Coastal Agricultural Sciences. The C4BPA knockout cell line was constructed by designing sgRNAs targeting the bovine C4BPA gene using an online tool, followed by cloning them into an EGFP-puro plasmid, enriching positive cells via transfection and fluorescence-activated cell sorting (FACS), and finally confirming the knockout through DNA extraction and verification [24]. The wild-type (WT) control consisted of BMECs. All the cells were maintained in DMEM/F-12 medium (HyClone, Logan, UT, USA) supplemented with 10% foetal bovine serum (FBS) (Zeta Life, Menlo Park, CA, USA) in an incubator (37 °C, 5% CO2). Prior to various experiments, the two cell types were prepared by culturing for 24 h. The ethical guidelines of Guangdong Ocean University governed all procedures in this study.
2.2. RNA Isolation and qPCR
Total RNA extraction from bovine mammary epithelial cells was performed with the MolPure TRIeasy Plus Total RNA Kit (Yeasen, Shanghai, China). All steps were carried out as directed by the manufacturer. Reverse transcription was carried out to synthesize cDNA from total RNA, employing HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme, Nanjing, China). Quantitative PCR analysis was carried out using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) on a QuantStudio 1 system (Thermo Fisher Scientific, Waltham, MA, USA), following the recommended protocols. Following normalization to β-actin (internal control), relative gene expression was analyzed by the 2−ΔΔCt method. Furthermore, the qPCR primer sequences designed and used in this study are summarized in Table 1.
Table 1.
RT–qPCR primer sequences.
| Gene | Sequence Number | Primer Sequence (from 5′ to 3′) | Product Length /bp |
Annealing Temperature/°C |
|---|---|---|---|---|
| TLR4 | NM_174198.6 | F: CCTGAGAACCGAGAGTTGGG R: GGGGATGTTGTCGGGGATTT |
100 | 60 |
| TNF-α | XM_005223596.4 | F: ACGGGCTTTACCTCATCTACTC R: TGGCAGACAGGATGTTGACC |
135 | 60 |
| IL-1β | NM_174093.1 | F: GATGGCTTACTACAGTGACGA R: AGATGAATGAAAGGATGCTC |
116 | 60 |
| IL-6 | NM_173923.2 | F: GATGCTTCCAATCTGGGTTCA R: TCCTGATTTCCCTCATACTCG |
106 | 60 |
| β-actin | NM_173979.3 | F: AGAGCAAGAGAGGCATCC R: TCGTTGTAGAAGGTGTGGT |
103 | 60 |
2.3. ELISA
Expressions of the proteins IL-1β, IL-6, TNF-α and TLR4 of two groups were detected using ELISA kits (MEIMIAN, Yancheng, China). After a fivefold dilution, 100 μL of HRB detection antibody was added, followed by incubation at 37 °C according to the manual. Following five wash cycles, Substrates A and B were added to the wells. After incubation, the stop solution was added and absorbance readings were taken.
2.4. Antibodies and Western Blotting
Protein was extracted using ice-cold RIPA lysis buffer (Beyotime, Shanghai, China) supplemented with 1% inhibitor (Beyotime, Shanghai, China). Measurement of protein concentration was performed with the BCA protein assay kit (Takara, Shiga, Japan). Protein denaturation was achieved by incubation with SDS–PAGE sample loading buffer (5×) (Beyotime, Shanghai, China). After SDS-PAGE, proteins were electrophoretically transferred to PVDF membranes (Millipore, Billerica, MA, USA). After blocking, the membranes were incubated with antibodies. Following another three washes, the chemiluminescence signals were detected in a chemiluminescence system (Bio-Rad, Marnes-la-Coquette, France) and analysed with ImageJ 1.51j8 software (National Institutes of Health, Bethesda, MD, USA). Information on the antibodies used in this experiment is presented in Table 2.
Table 2.
Information on antibodies used for Western blotting.
| Antibody | Catalogue Number | Manufacturer |
|---|---|---|
| Pink1 | bs-22173R | Bioss (Beijing, China) |
| P-p65 | 3033T | Cell Signaling Technology, Inc. (Danvers, MA, USA) |
| Parkin | T56641 | Abmart (Shanghai, China) |
| IκBα | 10268-1-AP | Proteintech Group, Inc. (Wuhan, China) |
| P62 | bs-55207R | Bioss (Beijing, China) |
| LC3B | T55992 | Abmart (Shanghai, China) |
| p65 | 10745-1-AP | Proteintech Group, Inc. (Wuhan, China) |
| P-IκBα | bs-2513R | Bioss (Beijing, China) |
| β-actin | AP0060 | Bioworld Biotech Co., Ltd. (Nanjing, China) |
2.5. Reactive Oxygen Species Detection (ROS)
The intracellular ROS levels of each group of cells were detected using an ROS detection kit (Beyotime, Shanghai, China). The cells were digested with trypsin (HyClone, Logan, UT, USA) and collected. At 37 °C, cells in both groups were incubated with 10 µM DCFH-DA for probe loading. ROS were detected on a flow cytometer (BECKMAN COULTER, Shanghai, China) using the FITC-A channel.
2.6. Transmission Electron Microscopy (TEM)
After the cells of the two groups were centrifuged and collected, they were resuspended and homogenously fixed in electron microscopy fixative (PINUOFEI BIOLOGICAL, Wuhan, China) at 4 °C. Then, they were washed by homogenous mixing with phosphate buffer PB, and a 1% agarose solution was prepared for pre-embedding. The samples were subsequently fixed with 1% osmium tetroxide in the dark at room temperature for 2 h, followed by gradient ethanol dehydration. Acetone and 812 embedding agent (SPI Supplies, West Chester, PA, USA) were used in proportion for infiltration, embedding, and resin polymerization. After being sectioned into ultrathin slices with an ultrathin microtome, collected on 150-mesh copper grids, stained, and observed under a transmission electron microscope (Hitachi, Tokyo Metropolis, Japan), after which images were collected for analysis.
2.7. Immunofluorescence
For permeabilization, both groups of log-phase cells, placed in 12-well plates, were treated with a permeabilization solution and incubated at room temperature. After washing with PBS, antibody incubation was performed following the same protocol as for Western blotting. Finally, they were counterstained with DAP (Pinuofei, Wuhan, China) for nuclear visualization. An inverted optical microscope (Nikon, Tokyo, Japan) and a confocal microscope (Nexcope, Ningbo, China) were used to acquire images. Antibody information is listed in Table 3.
Table 3.
Information on antibodies used for immunofluorescence.
| Antibody | Catalogue Number | Manufacturer |
|---|---|---|
| LC3 | 14600-1-AP | Proteintech Group, Inc. (Wuhan, China) |
| TOM20 | F0513 | Selleck (Houston, TX, USA) |
| C4BPA | BS-15185R | Bioss (Beijing, China) |
2.8. Statistical Analysis
Values were expressed as mean ± SD. Each experiment was performed in triplicate. The experimental data were analysed and plotted using GraphPad Prism software 8 (Version X, La Jolla, CA, USA). Student’s t-test was used for comparisons between two groups, and a p value < 0.05 indicated a significant difference.
3. Results
3.1. Validation of C4BPA Knockout Cell Lines
To validate the efficiency of the C4BPA gene knockout in the BMEC lines, we conducted immunofluorescence staining experiments on the WT and KO cells. In the WT group (Figure 1), C4BPA (labelled in red) exhibited a distinct distribution pattern. However, in the KO group, only weak red fluorescence was detected, indicating that the knockout in the KO group was highly effective.
Figure 1.
Immunofluorescence staining was used to detect the expression of the C4BPA gene in WT and KO cells. Red fluorescence represents the C4BPA protein. Blue fluorescence represents the nucleus. Scale bar: 200 µm.
3.2. Effects of the C4BPA Gene on the Expression of Inflammatory Cytokines in BMECs
The inflammatory role of the C4BPA gene was assessed by measuring the mRNA and protein expressions of TLR4 and relevant inflammatory factors. Compared with the WT group, the KO group displayed significant reductions in the mRNA expressions of TLR4 and inflammatory factors (Figure 2A–D) (p < 0.05). The ELISA results exhibited the same trend for TLR4 and inflammatory factors expressions after C4BPA gene knockout in BMECs (Figure 2E–H) (p < 0.05). Our data demonstrate that knockout of the C4BPA gene inhibits the inflammatory response in BMECs.
Figure 2.
C4BPA knockout reduced the inflammatory factors. (A–D) TLR4, TNF-α, IL-1β, and IL-6 mRNA expression levels in WT and KO cells, determined by RT–qPCR. (E–H) Protein levels of TLR4, TNF-α, IL-1β, and IL-6 in WT and KO cells, measured by ELISA. All data are presented as means ± SDs. * p < 0.05 or ** p < 0.01 compared with the WT.
3.3. Effects of C4BPA on Mitochondrial Morphology in BMECs
To explore the subcellular localization of C4BPA and determine whether its knockout affects the mitochondrial morphology, we performed immunofluorescence staining and TEM on both groups of cells. As shown in Figure 3A, C4BPA partially colocalized with the mitochondria, as demonstrated by the overlapping yellow–green signals. A quantitative analysis of the fluorescence intensity along a specific line (intensity–distance profile) showed that in the wild-type cells, the intensity profiles of C4BPA and TOM20 displayed overlapping peaks in specific regions; conversely, in the KO cells, such overlap was not observed, further validating the above findings. Collectively, these results suggest the presence of a potential interaction or spatial proximity between C4BPA and mitochondria.
Figure 3.
C4BPA gene knockout caused morphological and structural damage to mitochondria. (A) Immunofluorescence colocalization analysis of C4BPA protein and mitochondria. C4BPA is shown in green, and the mitochondrial marker TOM20 is in red. Nuclei are indicated in blue. Scale bar: 10 µm. (B) Transmission electron microscopy images of the WT and KO groups. N: nuclei; Nu: nucleoli; M: mitochondria; ALs: autolysosomes. Scale bars: 2 µm and 500 nm. All data are presented as means ± SDs. * p < 0.05 compared with WT. (C) ROS levels in WT and KO cells, determined by flow cytometry (the original pictures can be found in Supplementary Materials).
Our microscopy observations (Figure 3B) also revealed that both the WT and KO cells predominantly exhibited a cobblestone-like morphology, with a moderate number of organelles. The nuclei (N) were all elliptical, the nucleoli (Nu) were not distinct, and some parts of the nuclear surface showed slight invagination. The nuclear membranes were intact but somewhat blurred in certain areas, and no obvious widening of the perinuclear space was observed. However, more autolysosomes (ALs) were observed in the cytoplasm in the KO group than in the WT group. Moreover, in the KO cells, some mitochondrial (M) matrices were pale and indistinct, with extensive dissolution. The cristae exhibited fractures and were present in lower numbers. In some instances of severe damage, the organellar membrane structures were disrupted, and some organelles were conspicuously swollen.
On the basis of the above findings, we examined the ROS levels in both cell groups (Figure 3C) and found that the intracellular ROS levels were significantly increased following C4BPA knockout. Consequently, the altered mitochondrial structure and morphology induced by C4BPA knockout led to the generation of intracellular ROS.
3.4. Effects of the C4BPA Gene on Mitophagy in BMECs
Western blot analysis revealed that C4BPA knockout significantly altered the expression of mitophagy markers (Figure 4A,B). Specifically, it was associated with upregulation of Pink1 and Parkin, downregulation of P62, and an increased LC3B-II/LC3B-I ratio. In addition, immunofluorescence analysis (Figure 4C) revealed that the yellow fluorescence signal of LC3 and TOM20 colocalization was significantly enhanced after C4BPA gene knockout. These findings suggest that C4BPA gene knockout effectively promotes mitophagy.
Figure 4.
C4BPA gene knockout promotes mitophagy. (A) Western blot images of Pink1, Parkin, P62, and LC3B in WT and KO cells, as well as greyscale values (the original western blot pictures can be found in Figure S1). (B) Quantification of Pink1, Parkin, P62, and LC3B II/LC3B I protein levels from Western blot greyscale values. (C) Immunofluorescence of LC3 and TOM20 in WT and KO cells. Green fluorescence represents the LC3 protein, and red fluorescence represents the TOM20 protein. Scale bar: 10 µm. All data are presented as means ± SDs. ** p < 0.01 compared with the WT.
3.5. Effects of C4BPA on the NF-κB Signalling Pathway in BMECs
Given the crucial role of NF-κB signalling in the inflammatory response, to further explore the regulatory impact of the C4BPA gene on inflammatory factors, we detected the protein expression related to the NF-κB signalling pathway. The results revealed that IκBα and p65 significantly increased after C4BPA gene knockout, whereas those of P-IκBα and P-p65 decreased (Figure 5A). In addition, the P-IκBα/IκBα, and P-p65/p65 also decreased significantly (Figure 5B). These findings suggest that C4BPA gene knockout can effectively inhibit the activation of the NF-κB signalling pathway.
Figure 5.
C4BPA gene knockout inhibited the activity of the NF-κB signalling pathway. (A) Western blot (WB) images of P-p65, p65, P-IκBα, and IκBα (the original western blot pictures can be found in Figure S2). (B) Quantification of P-p65/p65 and P-IκBα/IκBα levels from Western blot greyscale values. All data are presented as means ± SDs. * p < 0.05 or ** p < 0.01 compared with the WT.
4. Discussion
Mastitis is a common disease in dairy cows that severely affects their health and production performance [25]. Dairy cows with mastitis usually exhibit mammary gland inflammation. In our previous study, transfection of C4BPA interference or overexpression vectors altered inflammatory cytokine levels in BMECs. Therefore, we speculated that C4BPA is involved in the inflammatory response in BMECs. Our current findings reveal that C4BPA deficiency in BMECs not only promotes mitophagy by activating the Pink1/Parkin pathway but also alleviates the inflammatory response by suppressing the NF-κB pathway, thereby leading to reduced levels of inflammatory cytokines.
The inflammatory response serves as an organismal defence mechanism in response to external stimuli [26]. Mastitis causes the release of various cytokines, such as TNF-α, IL-1β, and IL-6, in mammary gland tissue, promoting the development of the inflammatory response [27]. Zhao et al. [28] reported that dairy cows with subclinical mastitis (SCM) exhibited significantly increased serum levels of inflammatory cytokine, and TNF-α; conversely, these levels decreased significantly following treatment with Gongying San (GYS), indicating an anti-inflammatory effect. Therefore, a decrease in inflammatory factors reflects the inhibition of the inflammatory response. Building on previous studies, in this study, we examined the TLR4 and the inflammatory factors expression levels in C4BPA gene knockout cell lines. The results showed that compared with normal BMECs, the expressions of TLR4 and the inflammatory factors were greatly reduced after knockout of the C4BPA gene. This suggests that knocking out the C4BPA gene can effectively suppress the inflammatory response in BMECs.
Mitochondria serve as the central hubs of cellular energy metabolism and are closely associated with intracellular homeostasis [29]. Previous studies have indicated that the C4BPA gene plays a significant role in lipid and glucose metabolism in BMECs. To further investigate the pathway through which C4BPA knockout suppresses the inflammatory response, we employed immunofluorescence and observed colocalization between C4BPA and mitochondria. In addition, electron microscopy revealed an increase in autolysosomes within BMECs following C4BPA gene knockout. Mitophagy is an important lysosomal degradation pathway that removes damaged or unnecessary mitochondria to maintain cellular and organismal homeostasis [30]. The mitochondrial respiratory chain are the major sources of ROS production, but excessive ROS can cause mitochondrial structural damage and functional loss [31,32]. Duan et al. [33] reported that microcystin-LR (MC-LR) exposure caused ATP depletion, ROS accumulation, impaired oxidative phosphorylation, and mitophagy activation in stromal vascular fraction (SVF) cells. In our study, a flow cytometry analysis revealed an increase in ROS levels within BMECs following C4BPA gene deletion. This suggests that the absence of the C4BPA gene triggered mitophagy.
The regulation of Pink1-/Parkin-mediated mitophagy has been widely studied [34]. When mitochondria are damaged, Pink1 and Parkin in the cytoplasm ubiquitinate and bind to the outer membrane of the damaged mitochondria and then to LC3-II on the phagophore membrane to form a mitochondrial autophagosome and be degraded by lysosomes [35,36]. Xia et al. [37] demonstrated that kaempferol could reactivate mitophagy by increasing the expression levels of Pink1, Parkin, and LC3 and reducing p62 expression in a rat model of diabetic kidney disease (DKD). Qin et al. [38] found that platycodin D could promote the expression levels of Pink1, Parkin, and LC3B-II through the AMPK pathway, activate mitochondrial autophagy by downregulating P62 expression, and inhibit the NF-κB signalling pathway by reducing the phosphorylation levels of P-p65/p65 and P-p38/p38, thereby synergistically regulating diabetic ischemia/reperfusion injury. Therefore, the increased Pink1 and Parkin expressions, decreased P62 expression, increased LC3B-I-to-LC3B-II conversion, and increased LC3 colocalization with mitochondria in mammary epithelial cells from C4BPA knockout cows that we observed in the present study suggest that C4BPA knockout promotes mitophagy to remove damaged mitochondria.
Mitochondrial damage can activate the NF-κB signalling pathway, thereby inducing an inflammatory response [39]. This pathway serves as a critical link between external stimuli and the expression of inflammatory genes. Its activation is contingent upon the phosphorylation of the IκB kinase (IKK) complex, which leads to the degradation of IκBα and the subsequent release of the NF-κB p65 subunit into the nucleus to regulate the transcription of target genes [40]. Mayra et al. [41] demonstrated that C4BPA binds specifically to the CD40 molecule through its C-terminal domain, activating the noncanonical NF-κB signalling pathway in placental tissues. In the present study, the expression levels of P-p65/p65 and P-IκBα/IκBα decreased significantly after C4BPA gene knockout, indicating that NF-κB signalling pathway activation was inhibited. This coincides with the suppression of the inflammatory response by reducing the expression of the inflammatory factors mentioned above. In addition, Huang et al. [42] reported that TJ0113 reduced lipid accumulation, inflammation, and fibrosis in the liver of nonalcoholic steatohepatitis (MASH) mice by inducing mitophagy through the Pink1/Parkin signalling pathway and inhibiting the NF-kB/NLRP3 signalling pathway. Liu et al. [43] demonstrated that Staphylococcus aureus infection of bovine mammary epithelial cells activates Pink1-/Parkin-mediated mitophagy and suppresses the NF-κB signalling pathway by reducing the P-p65 and P-IκBα (as indicated by decreased P-p65/p65 and P-IκBα/IκBα ratios), thereby attenuating the inflammatory response. Therefore, we propose that knockout of the C4BPA gene alleviates the inflammatory response by promoting mitophagy and suppressing the NF-κB signalling pathway.
The release of ROS is a vital component of the inflammatory response [16]. Moreover, the production of ROS increases in BMECs, which damages mitochondria in dairy cows with Klebsiella pneumoniae-induced mastitis [44]. Therefore, ROS and inflammatory responses are mutually reinforcing. However, in the present study, we found that after knockout of the C4BPA gene, ROS levels increased, while the levels of inflammatory factors decreased. This may be because the relationship between ROS levels and the inflammatory response involves the regulation of multiple genes. After C4BPA knockout, the functions of other genes may be altered, resulting in elevated ROS levels and downregulated expression of inflammatory factors. In addition, the factors triggering cellular inflammatory responses are diverse. Mitochondrial dysfunction has been identified as a significant contributing factor to the establishment of a chronic inflammatory response [45]. Mitochondrial DNA-dependent activation of endolysosomal TLR9 or cytoplasmic inflammasomes can generate pro-inflammatory responses [46]. Jiang et al. [47] reported that ROS are upstream activators of dynamin-related protein 1 (Drp1) and that their increase can activate Drp1 by promoting mitophagy to form ROS–DRP1–mitophagy feedback during myogenic differentiation. Mitophagy can clear damaged mitochondria and mitochondrial DNA within cells, thus reducing the substrate availability for inflammatory responses [48]. Based on the above findings, we hypothesize that knockout of the C4BPA gene leads to increased ROS levels, which promote mitophagy to clear damaged mitochondria, thereby reducing the pro-inflammatory factors levels and suppressing the inflammatory response. However, this hypothesis requires further experimental validation.
It should be acknowledged that our study has certain limitations. Although our electron microscopy results indicate an association between C4BPA loss and altered mitochondrial morphology, the absence of process-specific controls for the knockout model means we cannot rule out the possibility that these morphological changes may potentially arise from the experimental procedure itself. Further validation employing targeted interventions and in vivo experiments will be conducted in future studies.
5. Conclusions
Knockout of the C4BPA gene in bovine mammary epithelial cells not only promotes mitophagy via activation of the Pink1/Parkin pathway but also alleviates the inflammatory response by inhibiting the NF-κB pathway.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/vetsci13020151/s1. Figure S1: The original Western Blot image for Figure 4; Figure S2: The original Western Blot image for Figure 5.
Author Contributions
Conceptualization, Z.Z., H.Y. and Y.Z.; methodology, X.C. and W.S.; software, W.S. and Q.L.; validation, Q.T. and Q.X.; formal analysis, Y.Z. and H.Y.; project administration, Z.Z. and H.Y.; investigation, R.C.; resources, H.Y., Z.Z. and Y.Z.; data curation, Z.Z., H.Y. and Y.Z.; writing—original draft preparation, Y.Z.; writing—review and editing, Z.Z., H.Y. and Y.Z.; visualization, W.S. and Y.Z.; supervision, Z.Z. and H.Y.; funding acquisition, Z.Z., H.Y., Z.L. and P.J.; All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
This study was reviewed and approved by the Animal Experiment Ethics Committee of Guangdong Ocean University in accordance with all applicable laws, regulations, and ethical standards (Approval Code: 20250515). The Committee confirmed that the bovine mammary epithelial cells (derived from Chinese Holstein cows) used in the experimental protocol fulfilled all ethical requirements. All procedures were approved by the Laboratory Animal Management and Ethics Committee of Guangdong Ocean University and were conducted in accordance with relevant regulations.
Informed Consent Statement
Not applicable.
Data Availability Statement
The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.
Conflicts of Interest
No potential conflict of interest was reported by the authors.
Funding Statement
This work was supported by the National Natural Science Foundation of China (No. 32202632, 32072717, 32302716); the Natural Science Foundation of Guangdong Province (No. 2025A1515011477); the Key Laboratory of Animal Resources and Breed Innovation in West Guangdong (No. 2021A05024).
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Noris M., Remuzzi G. Overview of Complement Activation and Regulation. Semin. Nephrol. 2013;33:479–492. doi: 10.1016/j.semnephrol.2013.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Rainard P. The Complement in Milk and Defense of the Bovine Mammary Gland against Infections. Vet. Res. 2003;34:647–670. doi: 10.1051/vetres:2003025. [DOI] [PubMed] [Google Scholar]
- 3.Zipfel P.F., Skerka C. Complement Regulators and Inhibitory Proteins. Nat. Rev. Immunol. 2009;9:729–740. doi: 10.1038/nri2620. [DOI] [PubMed] [Google Scholar]
- 4.Kadavá T., Hevler J.F., Kalaidopoulou Nteak S., Yin V.C., Strasser J., Preiner J., Heck A.J. Higher-Order Structure and Proteoforms of Co-Occurring C4b-Binding Protein Assemblies in Human Serum. EMBO J. 2024;43:3009–3026. doi: 10.1038/s44318-024-00128-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Criado-García O., Fernaud-Espinosa I., Bovolenta P., De La Cuesta R.S., De Córdoba S.R. Expression of the β-chain of the complement regulator C4b-binding protein in human ovary. Eur. J. Cell Biol. 1999;78:657–664. doi: 10.1016/S0171-9335(99)80051-X. [DOI] [PubMed] [Google Scholar]
- 6.Olcina M.M., Kim R.K., Balanis N.G., Li C.G., Von Eyben R., Graeber T.G., Ricklin D., Stucki M., Giaccia A.J. Intracellular C4BPA Levels Regulate NF-κB-Dependent Apoptosis. iScience. 2020;23:101594. doi: 10.1016/j.isci.2020.101594. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Guo W., Liu J., Li W., Ma H., Gong Q., Kan X., Cao Y., Wang J., Fu S. Niacin Alleviates Dairy Cow Mastitis by Regulating the GPR109A/AMPK/NRF2 Signaling Pathway. Int. J. Mol. Sci. 2020;21:3321. doi: 10.3390/ijms21093321. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Krishnamoorthy P., Goudar A.L., Suresh K.P., Roy P. Global and Countrywide Prevalence of Subclinical and Clinical Mastitis in Dairy Cattle and Buffaloes by Systematic Review and Meta-Analysis. Res. Vet. Sci. 2021;136:561–586. doi: 10.1016/j.rvsc.2021.04.021. [DOI] [PubMed] [Google Scholar]
- 9.Suriyasathaporn W., Schukken Y.H., Nielen M., Brand A. Low Somatic Cell Count: A Risk Factor for Subsequent Clinical Mastitis in a Dairy Herd. J. Dairy Sci. 2000;83:1248–1255. doi: 10.3168/jds.S0022-0302(00)74991-5. [DOI] [PubMed] [Google Scholar]
- 10.Dreyer C., Losand B., Spiekers H., Hummel J. Influence of Fat-to-Protein Ratio and Udder Health Parameters on the Milk Urea Content of Dairy Cows. J. Dairy Sci. 2025;108:2527–2546. doi: 10.3168/jds.2024-25492. [DOI] [PubMed] [Google Scholar]
- 11.Harmon R.J. Physiology of Mastitis and Factors Affecting Somatic Cell Counts. J. Dairy Sci. 1994;77:2103–2112. doi: 10.3168/jds.S0022-0302(94)77153-8. [DOI] [PubMed] [Google Scholar]
- 12.Fonseca M., Kurban D., Roy J.-P., Santschi D.E., Molgat E., Dufour S. Usefulness of Differential Somatic Cell Count for Udder Health Monitoring: Association of Differential Somatic Cell Count and Somatic Cell Score with Quarter-Level Milk Yield and Milk Components. J. Dairy Sci. 2025;108:3900–3916. doi: 10.3168/jds.2024-25402. [DOI] [PubMed] [Google Scholar]
- 13.Džermeikaitė K., Krištolaitytė J., Sutkevičienė N., Vilkonienė T., Vaičiulienė G., Rekešiūtė A., Girdauskaitė A., Arlauskaitė S., Bajcsy Á.C., Antanaitis R. Relationships Among In-Line Milk Fat-to-Protein Ratio, Metabolic Profile, and Inflammatory Biomarkers During Early Stage of Lactation in Dairy Cows. Vet. Sci. 2025;12:187. doi: 10.3390/vetsci12020187. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Kan X., Hu G., Liu Y., Xu P., Huang Y., Cai X., Guo W., Fu S., Liu J. Mammary Fibrosis Tendency and Mitochondrial Adaptability in Dairy Cows with Mastitis. Metabolites. 2022;12:1035. doi: 10.3390/metabo12111035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Chen X., Zheng X., Zhang M., Yin H., Jiang K., Wu H., Dai A., Yang S. Nuciferine Alleviates LPS-Induced Mastitis in Mice via Suppressing the TLR4-NF-κB Signaling Pathway. Inflamm. Res. 2018;67:903–911. doi: 10.1007/s00011-018-1183-2. [DOI] [PubMed] [Google Scholar]
- 16.Turk R. The Role of Oxidative Stress and Inflammatory Response in the Pathogenesis of Mastitis in Dairy Cows. Mljekarstvo. 2017;67:91–101. doi: 10.15567/mljekarstvo.2017.0201. [DOI] [Google Scholar]
- 17.Wellnitz O., Reith P., Haas S.C., Meyer H.H.D. Immune Relevant Gene Expression of Mammary Epithelial Cells and Their Influence on Leukocyte Chemotaxis in Response to Different Mastitis Pathogens. Vet. Med. 2006;51:125–132. doi: 10.17221/5531-VETMED. [DOI] [Google Scholar]
- 18.Huo Y., Shen T., Feng T., Li M., Zhao W., Loor J.J., Aernouts B., Psifidi A., Xu C. β-Hydroxybutyrate-Induced Mitochondrial DNA (mtDNA) Release Mediated Innate Inflammatory Response in Bovine Mammary Epithelial Cells by Inhibiting Autophagy. J. Anim. Sci. Biotechnol. 2025;16:15. doi: 10.1186/s40104-024-01143-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Liu H., Zhen C., Xie J., Luo Z., Zeng L., Zhao G., Lu S., Zhuang H., Fan H., Li X., et al. TFAM Is an Autophagy Receptor That Limits Inflammation by Binding to Cytoplasmic Mitochondrial DNA. Nat. Cell Biol. 2024;26:878–891. doi: 10.1038/s41556-024-01419-6. [DOI] [PubMed] [Google Scholar]
- 20.Meng M., Li X., Huo R., Ma N., Chang G., Shen X. A High-Concentrate Diet Induces Mitochondrial Dysfunction by Activating the MAPK Signaling Pathway in the Mammary Gland of Dairy Cows. J. Dairy Sci. 2023;106:5775–5787. doi: 10.3168/jds.2022-22907. [DOI] [PubMed] [Google Scholar]
- 21.Küng C., Lazarou M., Nguyen T.N. Advances in Mitophagy Initiation Mechanisms. Curr. Opin. Cell Biol. 2025;94:102493. doi: 10.1016/j.ceb.2025.102493. [DOI] [PubMed] [Google Scholar]
- 22.Li Y., Zhu Y., Chu B., Liu N., Chen S., Wang J. Lactobacillus Rhamnosus GR-1 Prevents Escherichia Coli-Induced Apoptosis Through PINK1/Parkin-Mediated Mitophagy in Bovine Mastitis. Front. Immunol. 2021;12:715098. doi: 10.3389/fimmu.2021.715098. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Iqbal A., Ziyi P., Yu H., Jialing L., Haochen W., Jing F., Ping J., Zhihui Z. C4BPA: A Novel Co-Regulator of Immunity and Fat Metabolism in the Bovine Mammary Epithelial Cells. Front. Genet. 2022;12:830566. doi: 10.3389/fgene.2021.830566. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Chen X., Zhao Z., Jiang X., Li J., Miao F., Yu H., Lin Z., Jiang P. The Complement Component 4 Binding Protein α Gene: A Versatile Immune Gene That Influences Lipid Metabolism in Bovine Mammary Epithelial Cell Lines. Int. J. Mol. Sci. 2024;25:2375. doi: 10.3390/ijms25042375. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Kalińska A., Gołębiewski M., Wójcik A. Mastitis Pathogens in Dairy Cattle—A Review. World Sci. News. 2017;89:16–25. [Google Scholar]
- 26.Raju V., Reddy R., Javan A.C., Hajihossainlou B., Weissleder R., Guiseppi-Elie A., Kurabayashi K., Jones S.A., Faghih R.T. Tracking Inflammation Status for Improving Patient Prognosis: A Review of Current Methods, Unmet Clinical Needs and Opportunities. Biotechnol. Adv. 2025;82:108592. doi: 10.1016/j.biotechadv.2025.108592. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Zhang J., Chen N., Yang Z., Gao Y., Zhang B., Li J., Zhou B., Tang Z., Dong W., Zhao X., et al. Role of Adiponectin in Regulating Cytokines and Its Contribution to the Occurrence and Progression of Clinical Mastitis in Holstein Cows. Int. J. Mol. Sci. 2025;26:2898. doi: 10.3390/ijms26072898. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Zhao G., Li H., Huang L., Cheng Y., Liu J., Song R., Wang X. Integrated Multi-Omics Analysis Reveals That Gongying San Ameliorates Subclinical Mastitis by Modulating Intestinal Microbiota and Metabolites in Dairy Cows. Front. Vet. Sci. 2025;12:1589900. doi: 10.3389/fvets.2025.1589900. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Friedman J.R., Nunnari J. Mitochondrial Form and Function. Nature. 2014;505:335–343. doi: 10.1038/nature12985. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Ashrafi G., Schwarz T.L. The Pathways of Mitophagy for Quality Control and Clearance of Mitochondria. Cell Death Differ. 2013;20:31–42. doi: 10.1038/cdd.2012.81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Ott M., Gogvadze V., Orrenius S., Zhivotovsky B. Mitochondria, Oxidative Stress and Cell Death. Apoptosis. 2007;12:913–922. doi: 10.1007/s10495-007-0756-2. [DOI] [PubMed] [Google Scholar]
- 32.Meng L., Liu S., Luo J., Tu Y., Li T., Li P., Yu J., Shi L. Oxidative Stress and Reactive Oxygen Species in Otorhinolaryngological Diseases: Insights from Pathophysiology to Targeted Antioxidant Therapies. Redox Rep. 2025;30:2458942. doi: 10.1080/13510002.2025.2458942. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Duan W., Yang T., Liu W., Zhan C. Microcystin-LR Hijacks Mitochondrial Bioenergetics and Wnt Crosstalk: Unveiling a Novel Dual-Pathway Mechanism for Adipogenesis Dysregulation in Environmental Toxicology. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2025;298:110329. doi: 10.1016/j.cbpc.2025.110329. [DOI] [PubMed] [Google Scholar]
- 34.Wang Y., Liu H.-H., Cao Y.-T., Zhang L.-L., Huang F., Yi C. The Role of Mitochondrial Dynamics and Mitophagy in Carcinogenesis, Metastasis and Therapy. Front. Cell Dev. Biol. 2020;8:413. doi: 10.3389/fcell.2020.00413. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Sarraf S.A., Raman M., Guarani-Pereira V., Sowa M.E., Huttlin E.L., Gygi S.P., Harper J.W. Landscape of the PARKIN-Dependent Ubiquitylome in Response to Mitochondrial Depolarization. Nature. 2013;496:372–376. doi: 10.1038/nature12043. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Heo J.-M., Ordureau A., Paulo J.A., Rinehart J., Harper J.W. The PINK1-PARKIN Mitochondrial Ubiquitylation Pathway Drives a Program of TBK1 Activation and Recruitment of OPTN and NDP52 to Promote Mitophagy. Mol. Cell. 2015;60:7–20. doi: 10.1016/j.molcel.2015.08.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Xia C., Zhang J., Chen H., Jiang W., Zhou S., Zheng H., Sun W. Kaempferol Improves Mitochondrial Homeostasis via Mitochondrial Dynamics and Mitophagy in Diabetic Kidney Disease. Int. Immunopharmacol. 2025;162:115121. doi: 10.1016/j.intimp.2025.115121. [DOI] [PubMed] [Google Scholar]
- 38.Qin X., Liu J., Zhao X., Wang L., Liu X., Chen Z. Platycodin D Attenuates Diabetic Renal Ischemia/Reperfusion Injury by Enhancing Mitophagy and Suppressing MAPK/NF-κB Signaling Activation. Biochim. Biophys. Acta (BBA) Mol. Basis Dis. 2025;1871:168026. doi: 10.1016/j.bbadis.2025.168026. [DOI] [PubMed] [Google Scholar]
- 39.Jin K., Liu Y., Shi Y., Zhang H., Sun Y., Zhangyuan G., Wang F., Yu W., Wang J., Tao X., et al. PTPROt Aggravates Inflammation by Enhancing NF-κB Activation in Liver Macrophages during Nonalcoholic Steatohepatitis. Theranostics. 2020;10:5290–5304. doi: 10.7150/thno.42658. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Bonizzi G., Karin M. The Two NF-κB Activation Pathways and Their Role in Innate and Adaptive Immunity. Trends Immunol. 2004;25:280–288. doi: 10.1016/j.it.2004.03.008. [DOI] [PubMed] [Google Scholar]
- 41.Ithier M.C., Parobchak N., Yadava S., Cheng J., Wang B., Rosen T. Fetal Lung C4BPA Induces P100 Processing in Human Placenta. Sci. Rep. 2019;9:5519. doi: 10.1038/s41598-019-42078-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Huang C.-L., Qi-En S., Cen X.-F., Ye T., Qu H.-S., Chen S.-J., Liu D., Xia H.-G., Xu C.-F., Zhu J.-S. TJ0113 Attenuates Fibrosis in Metabolic Dysfunction-Associated Steatohepatitis by Inducing Mitophagy. Int. Immunopharmacol. 2025;156:114678. doi: 10.1016/j.intimp.2025.114678. [DOI] [PubMed] [Google Scholar]
- 43.Liu K., Zhou X., Fang L., Dong J., Cui L., Li J., Meng X., Zhu G., Li J., Wang H. PINK1/Parkin-Mediated Mitophagy Alleviates Staphylococcus Aureus-Induced NLRP3 Inflammasome and NF-κB Pathway Activation in Bovine Mammary Epithelial Cells. Int. Immunopharmacol. 2022;112:109200. doi: 10.1016/j.intimp.2022.109200. [DOI] [PubMed] [Google Scholar]
- 44.Cheng J., Zhang J., Yang J., Yi B., Liu G., Zhou M., Kastelic J.P., Han B., Gao J. Klebsiella Pneumoniae Infection Causes Mitochondrial Damage and Dysfunction in Bovine Mammary Epithelial Cells. Vet. Res. 2021;52:17. doi: 10.1186/s13567-021-00898-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Kauppila T.E.S., Kauppila J.H.K., Larsson N.-G. Mammalian Mitochondria and Aging: An Update. Cell Metab. 2017;25:57–71. doi: 10.1016/j.cmet.2016.09.017. [DOI] [PubMed] [Google Scholar]
- 46.West A.P., Shadel G.S. Mitochondrial DNA in Innate Immune Responses and Inflammatory Pathology. Nat. Rev. Immunol. 2017;17:363–375. doi: 10.1038/nri.2017.21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Jiang A., Wang L., Liu X., Li J., Wang H., Wu S., Bao W. ROS-Drp1-Mitophagy Feedback Loop Regulates Myogenic Differentiation via Actin Cytoskeleton Remodeling-Mediated MRTF-A/SRF Axis. Redox Rep. 2025;30:2536400. doi: 10.1080/13510002.2025.2536400. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Jiménez-Loygorri J.I., Villarejo-Zori B., Viedma-Poyatos Á., Zapata-Muñoz J., Benítez-Fernández R., Frutos-Lisón M.D., Tomás-Barberán F.A., Espín J.C., Area-Gómez E., Gomez-Duran A., et al. Mitophagy Curtails Cytosolic mtDNA-Dependent Activation of cGAS/STING Inflammation during Aging. Nat. Commun. 2024;15:830. doi: 10.1038/s41467-024-45044-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.





