Cardiac drug potential: exploring individual and combined cardiac drugs to promote differentiation of adipose-derived stem cells into cardiomyocytes

Abstract

Background

Stem cell–based cardiac regenerative medicine holds significant promise for regenerating damaged cardiomyocyte by cardiomyocyte differentiation. Among stem cell types, adipose-derived stem cells (ADSCs) are the most extensively studied due to their ease of isolation and expansion, yet current differentiation protocols remain inefficient and poorly reproducible. Given the well-established roles of certain cardiac drugs—such as Salbutamol, Ivabradine, and Entresto—their potential influence on the regulation of cardiomyocyte differentiation may provide a valuable foundation for advancing differentiation protocols. This study investigates the potential of clinically approved cardiac drugs to enhance ADSC differentiation into cardiomyocytes. 

Methods

ADSCs were isolated from adipose tissue after liposuction surgery from healthy female patients (n = 6, age 23–40 year) using enzymatic methods. ADSCs at early passages (2–3) were treated with Salbutamol, Ivabradine, or Entresto for 21 days. Subsequently, RT-PCR was performed for pluripotency markers (OCT4, NANOG, and SOX2) and cardiac-specific genes (GATA4, NKX2.5, cTNNI, α-MHC).

Result

Treatment of ADSCs with each cardiac drug independently led to downregulation of pluripotency-markers compared to controls which indicate a loss of stemness. This was accompanied by increased expression of some early cardiomyocyte markers and slight increase in late cardiomyocyte markers expression, indicating commitment toward cardiac lineage commitment. In light of these results, a combination of these drugs have improved the differentiation of ADSCs into cardiomyocytes and significantly increase gene expression of early cardiomyocyte markers and late cardiomyocyte markers.

Conclusion

Clinically approved cardiac drugs promote ADSC differentiation toward the cardiomyocyte lineage, offering a novel and safe approach for cardiac regenerative medicine.

Supplementary Information

The online version contains supplementary material available at 10.1007/s11033-026-11553-z.

Introduction

Cardiovascular disease remains the leading cause of death worldwide, accounting for approximately 17.9 million deaths annually according to the World Health Organization. Myocardial infarction (MI) results in irreversible cardiomyocyte loss, leading to adverse cardiac remodeling, heart failure, and reduced quality of life [1]. Although pharmacological and mechanical strategies are widely employed, it focus on manage symptoms and fail to address the fundamental need for cardiomyocyte regeneration. Stem cell-based cardiac regenerative medicine is a potential solution to regenerate damaged cardiomyocyte after myocardial infarction by cardiomyocyte differentiation through multiple approaches including Adult-stem cells (MSCs), induced pluripotent stem cells (iPSCs), and embryonic stem cells (ESCs). Adipose-derived stem cells (ADSCs) one of the most extensively studied cell types due to their features such as easily obtainable, do not required immunosuppressive agents, and abundant and expandable [2]. And most importantly, ADSCs demonstrate multipotent differentiation potential and ability to promote neovascularization, angiogenesis, and cell survival [3].

The field of stem cell-based cardiac regenerative medicine shows significant promise but faces important challenges including, insufficient Cardiomyocyte differentiation, reproducibility issues, maturation state, safety concerns and limited cell retention [4]. Several approaches have been employed to enhance cardiomyocyte differentiation include, chemical Induction by drugs (5-azacytidine), growth factor-based protocols (FGF), physical and Environmental Factors (mechanical stimulation, 3D systems, Co-culture approaches). Drug-induced cardiomyocyte differentiation provides multiple advantages: established safety and pharmacokinetics (since the drugs are already clinically approved), reduced development time and costs compared to novel compounds, easier regulatory approval, well-known molecular targets and pathways [5].

Different drugs have been used to promote Cardiomyocyte differentiation such as 5-azacytidine and Wnt pathway inhibitor. It is noteworthy that these drugs were insufficient and sometimes were unsafe to be used [5, 6]. Therefore, our study seeks to explore and identify novel small-molecule agents that can enhance and improve Cardiomyocyte differentiation. Despite of well-known role of cardiac drugs include, Salbutamol, Ivabradine, and Entresto’s [7–9], their potential effects on Cardiomyocyte differentiation regulation and signaling pathways could provide a foundation for enhancing cardiomyocyte differentiation.

Salbutamol is a selective β-adrenergic agonist mainly used to improving cardiac function in heart failure patients, it stimulates cardiac beta-1 receptors, leading to positive inotropic and chronotropic effects [7, 10]. Several molecular mechanisms underpin the potential of salbutamol to promote cardiomycyte differentiation, suggesting its promising role in cardiomycyte differentiation. Salbutamol activates related transcriptional enhancer factor-1 (RTEF-1) transcription factor that mediates the α1-adrenergic reactivation and reprograming of cardiomyocyte genes. RTEF-1 activate key promoters of cardiomyocyte differentiation such as β-myosin heavy chain and skeletal α-actin [11]. Also, Salbutamol interacts with GATA4, a transcription factor essential for cardiac development and modulating cardiac subtype differentiation [12]. On the other hand, Salbutamol activates β-adrenergic receptors via p38 mitogen-activated protein kinase, which are existing in ESC. Therefore, Salbutamol promotes cardiogenic differentiation of ESCs via mitogen-activated protein kinase (MAPK) pathways and extracellular-signal regulated kinase pathways. This process leads to upregulation of cardiac genes and functionally enhance cardiomyocyte [13]. Also, Salbutamol was promoting cardiac differentiation in from murine-induced pluripotent stem cells via the MEK-ERK1/2 pathway [14]. Finally, integrate salbutamol in differentiation protocols of cardiomyocyte can promotes the quality of differentiated cardiomyocyte [15].

Ivabradine is well-known as hyperpolarization-activated cyclic nucleotide-gated channels inhibitor which reduce heart rate and enhance myocardial blood flow [8]. Also, it improves calcium handling in cardiomyocyte and maintain a healthy cardiac structure and function [16]. Also, Ivabradine reduce apoptosis and promotes cardiomyocyte survival and differentiation via down-regulating matrix metalloproteinase (MMP)−2 [8, 17],. Ivabradine has shown anti-oxidant, anti-inflammatory, and anti-degenerative properties in induced MI [18]. Ivabradine is important regulator of NF-κB Pathway on Notch Signaling [19, 20], which play important roles in cardiomyocyte differentiation [21].

Entresto is combination of Sacubitril and valsartan that used heart failure medication. Sacubitril regulate cardiomyocyte hypertrophy and protects against cardiac pathological remodeling by modulate CCAAT-enhancer binding protein-b (CEBPb), GATA-binding protein 4 (GATA4), and CBP/p300-interacting transactivator 4 (CITED4) transcription factors [22]. Valsartan reduce adverse remodeling and cell death in cardiomyocyte by blocks angiotensin II type I receptors [23]. Sacubitril/valsartan activate AMPK signaling pathway which lead cardioprotective effects through inflammation, fibrosis, apoptosis, and autophagy modulation [9]. Therefore, Sacubitril/valsartan could be used to enhance cardiomyocyte differentiation because AMPK Activation induced cardiomyocyte differentiation of pluripotent stem cells (iPSCs) increased expression of cardiac specific markers [24]. Although the well-documented role of sacubitril/valsartan to enhance cardiac remodeling and improve heart function, it has underlying potential molecular mechanisms of cardiomyocyte differentiation.

Building upon this background, the present study aims to investigate whether selected drugs, beyond their established role in cardiac remodeling and functional improvement, possess the capacity to modulate the molecular pathways involved in cardiomyocyte differentiation. Specifically, we intends to evaluate the effects of selected novel drugs on the differentiation in adipose-derived stem cells (ADSCs) and link drug-mediated modulation of cardiac pathways with the direct promotion of cardiomyogenic lineage commitment. To achieve this, we employed a stepwise experimental approach combining differentiation protocols, gene expression analyses, and histological assessments to comprehensively characterize the outcomes of drug treatment on cardiomyocyte differentiation.

Materials and methods

This study was reviewed and approved by the Institutional Review Board (IRB) of King Saud University Medical City (KSU–IRB). Approval number: [E-24–8857], dated [12 March 2023]. Written informed consent was obtained from all donors before sample collection in accordance with institutional guidelines and the Declaration of Helsinki.

Adipose tissue collection and processing

To begin with, adipose tissue were collected from elective liposuction procedures from healthy female patients (n = 6, age 23–40 year). Adipose tissue was collected in sterile containers containing phosphate-buffered saline, supplemented with 1% penicillin/streptomycin. Samples were processed within 4 h of collection to ensure cell viability.

Cell isolation

The standard protocol was applied, starting with tissue preparation and washing three times with PBS, followed by incubation with Collagenase type ІІ 500 unit/ml (GIBCO, 17101-015) with controlled agitation at 37C⁰ for overnight. Then, terminate digestion by adding an equal volume of DMEM containing 10% fetal bovine serum (FBS) to neutralize collagenase activity. The digested tissue was filtered through 100 μm and 40 μm cell strainers and centrifuged at 300×g for 5 min at room temperature to separate the cellular pellet from mature adipocytes and debris [25]. ADSCs were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% penicillin-streptomycin, and maintained at 37 °C in a humidified atmosphere with 5% CO₂. Cells between passages [2–4] were used for experiments.

Cell culture conditions

ADSCs were cultured in complete medium consisting of: DMEM low glucose, 10% FBS, 1% penicillin/streptomycin, 2 mM L-glutamine. Cells were maintained at 37 °C in a humidified atmosphere with 5% CO₂. Medium was changed every 2–3 days, and cells were passaged at 80–90% confluence using 0.25% trypsin-EDTA (Gibco, Cat#25200-056).

Phenotype

ADSCs were characterized for MSC cell surface marker expression using flow cytometry at passages two and three, and once the cells reached confluence. Cell suspensions of ADSCs were collected with 0.05% trypsin/EDTA, then washed and incubated for 30 min with FITC-, APC or PE-conjugated monoclonal antibodies: CD13 APC, CD29 PE, CD73 PE (BD Biosciences, Cat#550257), CD14 APC (BD Biosciences, Cat#555398), CD31 FITC, and CD45 FITC (BD Biosciences, Cat#555482). An isotype control with nonspecific FITC/PE/APC-conjugated IgG was used to evaluate background fluorescence. Analysis was performed using BD FACSC onto II flow cytometer with at least 10,000 events recorded per sample.

Differentiation protocol

To induce cardiomyocyte differentiation, ADSCs were seeded at a density of [2000 cells/cm²] and treated with drugs used, Valsartan (10սM)(MCE, HY-18204), sacubitril (20սM) (MCE, HY-15407), ivabradine (10սM) (MCE, HY-B0162A), salbutamol (10սM) (MCE, HY-B1037)] according to the established differentiation protocol. The concentrations selected for Salbutamol (10 µM) [26, 27], Ivabradine (10 µM) [28], Sacubitril (20 µM), and Valsartan (10 µM) [29] were based on previously published studies demonstrating effective used in in-vitro cardiogenic studies at these doses without inducing cytotoxicity. Control groups were maintained under standard culture conditions without induction drugs. Morphological changes and phenotypic characteristics were monitored after the 21 days differentiation period using RT-PCR and Crystal violet stain.

RNA extraction and RT-PCR

Total RNA was extracted from differentiated and control cells using Innu-PREP RNA Mini Kit (Analytik Jena) according the manufacturer’s protocol. RNA purity and concentration were determined using NanoDrop spectrophotometer at 260/280 nm (Nanodrop 2000; Applied Biosystems). Complementary DNA (cDNA) was synthesized using 100ng of RNA [High Capacity c DNA Reverse transcription kit applied biosystems, Cat: 00709629] in a ProFlex PCR system and multigene thermal cycler, in accordance with the manufacturer’s guidelines. Quantitative real-time PCR (qRT-PCR) was performed using [Power SYBR Green PCR Master Mix/applied biosystems, Cat: 2010603] on (Applied Biosystems Real-Time PCR Detection System). Gene expression analysis of specific markers were calculated using 2^ (-ΔΔCt) method, normalized to housekeeping genes (GAPDH), the control group normalized to a fold-change value of 1.0. All plotted values in the figures represent relative fold changes compared to this reference baseline.

Gene	Forward Primer (5’−3’)	Reverse Primer (5’−3’)	Size (bp)
Pluripotency markers
OCT4	CTTGCTGCAGAAGTGGGTGGAGGAA	CTGCAGTGTGGGTTTCGGGCA	144
NANOG	TTTGTGGGCCTGAAGAAAACT	AGGGCTGTCCTGAATAAGCAG	164
SOX2	GCCGAGTGGAAACTTTTGTCG	GGCAGCGTGTACTTATCCTTCT	151
Early cardiac markers
GATA4	CCTACCCAGCCTACATGGACT	ACATATCGAGATTGGGGTGTCT	158
NKX2.5	AAGTGCGACGAGGCAACTG	GGTCTTGACCTGCGTGGA	142
ANP	CCGATGCAGACGATTCAACC	CTGCTGCTGCTGCTGTTG	167
Late cardiac markers
cTNNI	AGGACCTCACCAAAGATCGC	GCTCCTCGGTGTCCTCGT	189
α-MHC	CCAACACCAACCTGTCCAAG	CAGCTTGTCAAAGGAGCCG	174
β-MHC	CCGAGTCCCAGGTCAACAA	CTTCACGGGCACCCTTGGA	156
Housekeeping genes
GAPDH	TGCACCACCAACTGCTTAGC	GGCATGGACTGTGGTCATGAG	87
β-ACTIN	CATGTACGTTGCTATCCAGGC	CTCCTTAATGTCACGCACGAT	250

Crystal violet stain

Crystal violet staining was performed to assess morphological changes consistent with cardiomyocyte phenotype. Cells were fixed with 4% paraformaldehyde for 10 min, rinsed with PBS, and incubated with 0.1% crystal violet solution for 20 min at room temperature. Excess stain was removed by washing with distilled water. Stained cells were visualized and captured at defined intervals using an inverted phase-contrast microscope.

Statistical analysis

All experiments were performed in triplicate, and data are presented as mean ± standard deviation (SD). Statistical analyses were conducted using GraphPad Prism version 9.0 (GraphPad Software, San Diego, CA, USA). Data normality was assessed using the Shapiro–Wilk test prior to statistical comparisons. For non-normally distributed data, comparisons involving more than two groups, one-way analysis of variance (ANOVA) was performed, followed by Dunn’s post-hoc multiple comparison test. For comparisons between two groups, Student’s t-test was used. A p-value < 0.05 was considered statistically significant.

Result

Isolation & phenotyping of ADSCs

ADSC isolation protocols was comply with good manufacturing practice (GMP) guidelines. Adipose-derived stem cells were isolated using Type II collagenase enzyme digestion at concentrations of 500un/ml for overnight at 37 °C and agitation, followed by centrifugation and cell collection steps. Isolated ADSCs are superior yield after isolation with good proliferative capacity and adhere to plastic surfaces. ADSC were typically appear long, thin and spindle-like morphology, with tapered ends. Also, there was multiple small and bright dots are visible throughout the field whish are most consistent with lipid droplets commonly observed shortly after isolation of ADSCs. Isolated ADSC demonstrate various sizes, nuclear contours, and cytoplasmic textures, indicating morphological heterogeneity. Notably, ADSCs were healthy, with no evidence of vacuolization or detachment, reflecting the characteristic phenotype of ADSCs in standard culture conditions (Fig. 1A).

Fig. 1.

(A) Representative phase-contrast microscopy images showing ADSCs. At primary culture, a population of ADSCs displaying a fibroblast-like and spindle-shaped morphology with elongated cell bodies. And multiple small, bright, round dots whish are most consistent with lipid droplets after isolation. At Passage 2, ADSCs display typical fibroblast-like spindle morphology with elongated processes, adherence to the culture plate surface, and display the typical mesenchymal stem cell (MSC) growth pattern, including alignment and partial whorl-like arrangements. Scale bar = 50 μm, (40X). (B) flow cytometry analysis of positive surface markers in ADSCs. Representative dot plots showing positively stained for CD29 (96.5 ± 1.8%), CD73 (97.8 ± 1.2%), and CD13 (94.3 ± 2.1%), confirming their mesenchymal stem cell phenotype. The gated populations (P3/P4) indicate the proportion of cells expressing each marker. (C) Flow cytometry analysis of negative surface markers in ADSCs. Representative dot plots showing that ADSCs were negative for CD14 (0.8 ± 0.3%,), CD31 (1.2 ± 0.4%,), and CD45 (0.9 ± 0.3%), confirming the lack of contamination with monocytes, endothelial cells, or hematopoietic cells. The gated regions (P2–P4) illustrate minimal expression levels. Values are presented as mean ± SD for six independent donor samples (n = 6)

Fluorescence-activated cell sorting (FACS) analysis was conducted to assess the phenotypic profile of ADSCs. ADSCs exhibited a typical mesenchymal stem cell (MSC) phenotype, with strong expression of CD73 (mean 97.8 ± 1.2%), CD13 (94.3 ± 2.1%), and CD29 (96.5 ± 1.8%). Interestingly, CD34 was also detected at a moderate level (mean 70%) which is consistent with previously reported ADSC profiles (Fig. 1B). In contrast, the cells showed minimal expression of hematopoietic and endothelial markers, including CD14 (0.8 ± 0.3% CD31 (1.2 ± 0.4%), and CD45 (0.9 ± 0.3%). All percentages represent mean values from six independent samples (Fig. 1C).

Differentiation induced by Salbutamol, Ivabradine, and Entresto

Three groups of ADSCs were treated with Salbutamol, Ivabradine, and Entresto at recommended concentrations for 21 days, Salbutamol (10 µM) [26, 27], Ivabradine (10 µM) [28], Entresto at (Sacubitril (20 µM), and Valsartan (10 µM)) [29]. Control group and 5-azacytidine were added as control and standard differentiation protocol respectively. At day 21, ADSCs in control group displayed their distinctive characteristic irregular-shaped nucleus with noticeable, prominent nucleoli, high nuclear-to-cytoplasm ratio, centrally located nuclei, some showing a polygonal outline, without evidence of alignment or elongation. Following treatment with Salbutamol, the cells appear elongated and spindle-shaped, with partial alignment and visible cytoplasmic extensions, suggesting the initiation of cardiomyocyte-like remodeling. Entresto-treated cells revealed more noticeable morphological changes, characterized by more elongation, higher density, and tighter intercellular connectivity, with overlapping structures resembling early myotube-like organization. The most prominent changes were observed in the Ivabradine group, where cells showed a thin, highly elongated morphology with marked parallel alignment and network-like interconnections, closely resembling cardiomyocyte-like structural features (Fig. 2). Collectively, these observations indicate that all three drugs induced morphological shifts consistent with cardiomyogenic differentiation, with Ivabradine producing the most advanced cardiomyocyte-like phenotype, followed by Entresto and Salbutamol.

Fig. 2.

Morphological changes following individual drug treatments: representative phase-contrast images of ADSCs following 21-day treatment with Salbutamol, entrsto, Ivabradine, or control medium. Drug-treated cells display early cardiomyocyte-like features, including elongation, partial alignment, and increased cytoplasmic extensions. Ivabradine-treated cells demonstrate the most organized parallel alignment. Scale bar = 50 μm

Following treatment, marker analysis focused on the downregulation of pluripotency markers and the upregulation of cardiomyocyte-specific markers. MSCs markers were not re-evaluated after treatment, as the primary aim was to assess lineage commitment toward the cardiomyocyte phenotype rather than persistence of the MSC identity. Therefore, a marked downregulation of pluripotency-associated genes include Nanog Homeobox (NANOG), POU Class 5 Homeobox 1 (POU5F1) (OCT4), and SRY (Sex Determining Region Y)-Box 2 (SOX2) was observed in Salbutamol, Ivabradine, Entresto, and 5-azacytidine group comparing to control group. This downregulation was significant in all groups except NANOG & OCT4, and SOX2 gene expression in Salbutamol treated group and SOX2 gene expression in Entresto treated group (Fig. 3A). It is important to note that the expression of pluripotency genes was evaluated not to confirm MSC identity, but to monitor the expected decline in stemness as ADSCs commit toward the cardiomyocyte lineage. Additionally, treatment of ADSCs with the Salbutamol, Ivabradine, and Entresto resulted in upregulation of early cardiomyocyte-specific markers including Atrial Natriuretic Peptide (ANP), NKX2, and GATA Binding Protein 4 (GATA4) in comparison to control group. This upregulation was significant of ANP gene expression in Salbutamol group, NKX2 gene expression in Salbutamol, Ivabradine, and Entresto groups, and GATA4 gene expression in Ivabradine, group. Also, none of the early cardiomyocyte-specific markers was significant upregulation in 5-azacytidine treated group (Fig. 3B). In parallel, insignificant increase in the expression of lately cardiomyocyte-specific genes including Myosin Heavy Chain 7 (MYH7) and Troponin I, Cardiac Muscle (cTNNI) was detected in all groups (Fig. 3C).

Fig. 3.

Gene’s expression analysis following 21-day treatment with untreated control cells (CON), treated with 5-Azacytidine (5-AZA), Salbutamol (SALT), Ivabradine (IVAB), and Entresto (ENT). (A) Pluripotency marker expression (OCT4, SOX2, NANOG): Compared with controls, all treatments led to a significant downregulation of pluripotency markers. (B) Early cardiac gene expression (GATA4, NKX2.5, ANP): Compared with controls, drug-treated groups showed variable but generally increased expression of early cardiomyocyte markers. (C) Late cardiac gene expression. (cTNNI, MYH7): While trends toward increased expression were observed in some treated groups, the overall changes did not reach statistical significance compared with controls. Data are presented mean ± SD from n = 6 independent biological replicates, each performed in technical triplicates. Statistical analysis performed using one-way ANOVA with Dunn’s post-hoc test (p < 0.05). Fold-change values are displayed above each bar (*p < 0.05, **p < 0.01, ***p < 0.001, ns = not significant)

Differentiation induced by drugs combination

Given the observed enhancement of cardiomyocyte differentiation with Salbutamol, Ivabradine, and Entresto treatments groups. Subsequently, ADSCs were exposed to a combination of all three drugs to incorporate their potential synergistic effects. In the control group, ADSCs exhibited their typical characteristic fibroblast-like morphology, randomly oriented cells, being polygonal to spindle-shaped with broad cytoplasm and centrally located nuclei, and without clear alignment, or structural organization. Compared with the control, exposure of ADSCs to the drug combination resulted in marked morphological changes indicative of cardiomyogenic differentiation. Treated cells became highly elongated and spindle-shaped, with a pronounced tendency toward parallel alignment and interconnected cells with cardiomyocyte-like features. The enhanced cytoplasmic staining intensity indicated structural remodeling and accumulation of proteins characteristic of a cardiomyocyte-like phenotype (Fig. 4). Collectively, the drug combination induced a more advanced degree of cardiomyocyte-like morphology compared to the control group.

Fig. 4.

Morphological changes of ADSCs following combined drug treatment. Representative phase-contrast images of ADSCs treated with a combination of Salbutamol, Ivabradine, and Entresto for 21 days. Crystal violet staining demonstrating that cells exhibit marked elongation, parallel alignment, and interconnected morphology resembling early cardiomyocyte-like networks and control group maintained the typical fibroblast-like spindle morphology. Scale bar = 50 μm

In RT-PCR analysis, treatment of ADSCs with drug combination resulted in a transcriptional shift characterized by downregulation of pluripotency-associated genes such as OCT4, SOX2, and NANOG between control (CON) and drug-treated ADSCs, with statistical significance (Fig. 5.A). OCT4, SOX2, and NANOG are a core transcription factor maintaining pluripotency and downregulation of these genes commonly indicates loss of pluripotency and initiation of differentiation.

Fig. 5.

Gene’s expression analysis following 21-day treatment with untreated control cells (CON), treated with combination of cardiac drugs. (A) Pluripotency marker expression (OCT4, SOX2, NANOG): Compared with controls, treatments with drugs combination led to a significant downregulation of pluripotency markers. (B) Early cardiac gene expression (GATA4, NKX2.5, ANP): Compared with controls, drugs combination -treated groups showed significant increased expression of early cardiomyocyte markers. (C) Late cardiac gene expression. (TNNI, MYH7): statistical significance increased expression were observed drugs combination treated group, compared with controls. Data are presented mean ± SD from n = 6 independent biological replicates, each performed in technical triplicates. Gene expression was quantified using qRT-PCR and analyzed via the 2⁻ΔΔCt method, with control group normalized to 1.0. Statistical analysis performed using one-way T-test test (p < 0.05). Fold-change values are displayed above each bar (*p < 0.05, **p < 0.01, ***p < 0.001, ns = not significant)

Additionally, upregulation of three key cardiac transcription factors/markers—GATA4, NKX2, and ANP—in control (CON) versus drug-treated (Drugs) adipose-derived stem cells (ADSCs) was observed, with statistical significance (Fig. 5B). GATA4, NKX2, and ANP are essential transcription factors in early cardiac development, the significant upregulation reflects activation of cardiogenic pathways. Crucially, insignificant increase in the expression of lately cardiomyocyte-specific genes including cTNNI and MYH7 was detected drug-treated cells compared to controls, with statistical significance (Fig. 5C).

Discussion

To the best of our knowledge, it is the first study that provide new insight into the potential role of clinically approved cardiovascular drugs in directing ADSC differentiation toward a cardiomyocyte phenotype. The results demonstrated that exposure of ADSCs to Salbutamol, Ivabradine, or Entresto independently promotes early cardiac lineage commitment, as evidenced by the downregulation of pluripotency markers and upregulation of early cardiomyocyte markers.

In the first instance, our study targeted ADSCs due to their accessibility and represent a valuable source of ADSCs for regenerative medicine applications [30]. Despite of alternative safe and non-enzymatic methods are developed, enzymatic digestion method with xenogeneic components in collagenase enzyme was used to break down the connective tissue matrix and release ADSCs [31, 32]. Collagenase enzyme method is well-established protocols, no effects on cell function, and affords high cell yields compared to other methods [33–35]. In this study, isolated ADSCs displayed typical morphological characteristic of ADSCs including, adherence to plastic surfaces and expression of inclusion surface markers (CD73, CD90, and CD105), and negative for exclusion markers like CD45, CD34 [30, 36, 37]. Recently, ultrasonic cavitation methods was innovated to achieve similar yields to collagenase digestion method while avoiding xenogeneic and enzymatic exposure [38].

The selection of Salbutamol, Ivabradine, and Entresto was selected based on their ability to modulate signaling pathways known to influence cardiomyocyte differentiation. Salbutamol upregulate cardiomyocyte genes include β-myosin heavy chain and skeletal α-actin via RTEF-1 activation [11]. Also, Salbutamol influences cardiomyocyte differentiation primarily through its effects on GATA4 transcription factors and MEK-ERK1/2 pathway [12, 15]. Ivabradine enhance cardiomyocyte differentiation via various mechanisms including, creates a more favorable environment for cardiomyocyte differentiation by modulating ion channels [8], activation of Notch and NF-κB signaling pathways of, which is crucial for cardiomyocyte differentiation and function [20]. Entresto (Sacubitril& Valsartan) may enhance cardiomyocyte differentiation through its effects on different signaling pathways. Sacubitril influences GATA-binding protein 4 (GATA4) transcription factors and Valsartan modulates BMP, Notch signaling pathways which affecting cardiomyocyte differentiation [22, 39]. Our experimental data validate this selection, revealing that these drugs positively impacted ADSC commitment toward the cardiomyocyte differentiation, at least in part, through modulation of lineage-specifying signaling pathways, led to a significant shift in gene expression profiles. Remarkably, the positive control group treated with 5-azacytidine showed low upregulation of cardiac markers. This is align with previous studies demonstrating highly variable differentiation efficiency of 5-azacytidine and often cell-type dependent. 5-azacytidine typically induces transient epigenetic modifications rather than sustained cardiogenic signaling [40, 41], which may explain the weak induction of both early and late markers observed in our study. Also, a lower concentration was used to avoid cytotoxicity, which may have further limited its effectiveness. These findings highlight the need for more reliable and reproducible small-molecule inducers of cardiomyogenesis.

Together, the drug treatment not only triggers early cardiogenic transcription factors and, but also drives the expression of late structural markers, indicating progression toward functionally mature cardiomyocyte. Although treatment with Salbutamol, Ivabradine, and Entresto clearly increased the expression of early cardiomyocyte transcription factors, the late-stage structural markers MYH7 and cTNNI showed only modest, non-significant changes. These findings suggest that while the drugs are capable of initiating early cardiogenic commitment, they do not appear to promote progression toward full cardiomyocyte maturation within the 21-day induction period. Although cardiomyogenic commitment cannot be fully inferred from only transcriptional profiling, our study was designed as an initial high-throughput screening to identify drug combinations capable of inducing early cardiogenic gene programs. While protein-level validation at the same time points were beyond the predefined scope of this screening phase. Achieving mature cardiomyocyte features—such as organized sarcomeric structure, contractile function, and coordinated calcium handling—typically requires longer differentiation times and additional mechanical or biochemical cues. To address this, future work will include cTnT-positive cell quantification, immunostaining for sarcomeric organization, and calcium transient analysis to better evaluate functional maturation. Overall, our results indicate that these drugs act as early-stage inducers but are not sufficient on their own to support complete cardiomyocyte differentiation.

These drugs demonstrate promising potential in directing cardiomyocyte differentiation; however, further investigation is required to fully understand the interaction between these drugs. Additionally, while these drugs well-known in improving cardiac function, their exact molecular mechanisms in promote cardiomyocyte differentiation remain complex and not fully understood. On the other hand, it is important to recognize that this process is inherently complex and requires additional strategies to achieve optimal differentiation outcomes. Multiple strategies could be applied to enhance the differentiation and maturation of cardiomyocyte such as Bioreactor Systems, biomaterials approaches, growth factors [1, 42].Therefore, it is preferable not to rely exclusively on our targeted drugs, but rather to implement an integrated approach that incorporates additional strategies such as mechanical stimulation and 3D. Finally, cardiomyocyte differentiation is represents a critical frontier in regenerative medicine and heart drug discovery.

In conclusion, exposure of ADSCs to the three drugs demonstrated modest upregulation of early cardiogenic markers, and most late-stage markers remained non-significant indicating to transition toward a cardiac phenotype. The combined treatment of ADSCs with all three drugs induced advanced stage of differentiation morphology that highly elongated, parallel-aligned, interconnected cells with cardiomyocyte-like features. However, Drug Combination produced induced statistically significant changes in early and late-stage differentiation markers. Finally, our study was designed as an initial high-throughput screening to identify drug capable of inducing early cardiogenic gene programs. Future works will focus on further strengthen these findings, such as proteins and function level, as well as elucidating the underlying molecular mechanisms involved in cardiomyogenic differentiation.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Hessah Alshammari and Jawahir Abuhaimed conceptualized the study, designed the methodology, analyzed and interpreted the data and contributed to manuscript preparation. Seham Alshehri and Sara Abou Al-Saud performed some of the laboratory experiments. Abdulaziz Siyal and Sameerah Shaheensupervised the research, reviewed, and edited the manuscript. All authors approved the final version for submission.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Competing interests

The authors declare no competing interests.

Ethics approval and consent to participate

The study titled “Cardiac Drug Potential: Exploring Cardiac Drugs to Promote Differentiation of Adipose-Derived Stem Cells into Cardiomyocytes” was reviewed and approved by the Institutional Review Board (IRB) of King Saud University Medical City (KSU–IRB). Approval number: [E-24-8857], dated [12 March 2023]. Written informed consent was obtained from all donors before sample collection in accordance with institutional guidelines and the Declaration of Helsinki.

Artificial intelligence (AI) use disclosure

The authors acknowledge the use of ChatGPT (OpenAI, GPT-5 model) to assist with language refinement, organization, and improving the clarity of this manuscript. All content generated with AI assistance was reviewed and verified by the authors to ensure accuracy and integrity.