ABSTRACT
Pattern recognition receptors (PRRs) are pivotal for plant immunity, yet their discovery in crops is hindered by lineage‐specific divergence. We demonstrate that microbe‐associated molecular patterns (MAMPs) often activate immunity through phylogenetically unrelated, convergently evolved PRRs across plant lineages. Using the Phytophthora‐derived MAMP RLK6 as a prototype, we identified two leucine‐rich repeat receptor‐like proteins (LRR‐RLPs), NbRKR1 and NbRKR2, that redundantly perceive RLK6 in the model plant Nicotiana benthamiana. Strikingly, soybean retained RLK6 responsiveness despite lacking NbRKR1/2 orthologs. By integrating AlphaFold3 structural prediction with functional screening in N. benthamiana receptor mutants, we uncovered GmRLP30 as the convergent RLK6 receptor in soybean. Phylogenetic analysis revealed RKR1/2 conservation in Solanaceae but their absence in Capsicum annuum , which encodes a truncated RKR1 variant incapable of activating RLK6 immunity. Critically, heterologous expression of NbRKR1 or GmRLP30 in pepper restored RLK6 perception, confirming functional equivalence. These results establish a direct receptor‐mediated communication between pathogen and host surfaces, an ortholog‐independent pipeline for rapid PRR mining across crops, and a foundation for engineering synthetic immune interfaces with durable disease resistance.
Keywords: AI‐guided receptor discovery, cell–cell communication, convergent evolution, crop immune engineering, pattern‐triggered immunity
1. Introduction
In the two‐tiered plant innate immune system, cell‐surface pattern recognition receptors (PRRs) activate pattern‐triggered immunity (PTI) upon perceiving conserved extracellular patterns, including foreign microbe−/herbivore‐associated molecular patterns (MAMPs/HAMPs) as well as plant‐derived damage‐associated molecular patterns (DAMPs) (Jones and Dangl 2006; Ngou, Ding, and Jones 2022; Jones et al. 2024). Given their pivotal roles in plant immunity, over 60 plant PRRs have been identified and characterized over the past three decades, though the majority originate from model plants such as Arabidopsis and Solanaceae species (e.g., tomato, Nicotiana benthamiana) (Ngou, Ding, and Jones 2022). The characterization of PRRs primarily depends on genetic approaches that are highly effective in model plants, thereby limiting exploration in agriculturally important crops (Snoeck et al. 2025). Recent evolutionary analyses demonstrate that adaptive evolution driven by distinct ecological niches and habitat‐specific pressures has shaped the diversification of plant PRR repertoires (Ngou, Heal, et al. 2022; Li, Liu, et al. 2025). This is reflected in the observed pattern where most PRRs are lineage‐specific, with only a limited subset being evolutionarily conserved across plant taxa (Snoeck et al. 2025; Steinbrenner 2020; Zhang et al. 2023; Ngou et al. 2025). Consequently, sequence homology‐based cloning of PRR orthologs in crops is usually ineffective, as evolutionary divergence limits sequence conservation (Snoeck et al. 2025). Similarly, proteomics‐based strategies have succeeded only in isolated cases (Snoeck et al. 2025), probably constrained by the low abundance of PRR proteins (Jehle et al. 2013) and the transient nature of ligand‐receptor interactions. These collective constraints underscore the persistent challenges in identifying functional PRRs across agronomically important crop species.
Plant immune systems have evolved conserved mechanisms to detect pathogens through PRRs. A critical question arises: which evolutionary features of PRRs enable innovative, ortholog‐independent receptor discovery strategies in crops? While most documented MAMP‐PRR pairs exhibit one‐to‐one specificity (Ngou, Ding, and Jones 2022), recent studies have uncovered instances of one‐to‐many recognition, where phylogenetically distinct PRRs converge evolutionarily to recognize the same conserved pattern. Notably, these convergent PRRs from evolutionarily unrelated lineages usually share low sequence similarity and recognize different epitopes. For instance, two evolutionarily divergent receptor‐like proteins (RLPs) from Nicotiana benthamiana and the wild potato Solanum microdontum recognize Phytophthora elicitins through distinct mechanisms (Chen et al. 2023; Du et al. 2015). Similarly, Arabidopsis RLP30 and N. benthamiana RE02 exhibit limited sequence similarity yet recognize distinct regions of a small cysteine‐rich protein family conserved across fungi and oomycetes (Yang et al. 2023; Nie et al. 2021). Notably, leucine‐rich repeat (LRR)‐RLP receptors often exhibit genus‐ or even species‐specific distributions (Zhang et al. 2023). This evolutionary pattern suggests that leveraging convergently evolved PRRs, observed across model plants and crops, could accelerate the discovery of non‐orthologous functional analogs in crops, circumventing the constraints of homology‐based cloning and traditional mutant screening approaches.
Previously, we demonstrated that the Phytophthora‐derived MAMP PsRLK6 activates BAK1‐ and SOBIR1‐dependent PTI in both N. benthamiana and soybean (Pei et al. 2023), indicating that convergent LRR‐RLP receptors in these plants may recognize PsRLK6. Here, as a proof‐of‐concept for this strategy, we initially identified the cognate receptor of PsRLK6ECD in N. benthamiana through a virus‐induced gene silencing screen (Wang et al. 2018), followed by generating loss‐of‐function mutants via CRISPR/Cas9. Building on this approach, AI‐driven structural modeling of ligand‐receptor complexes combined with transient expression of candidates in this N. benthamiana mutant enabled the functional validation of soybean's convergent receptor. This integrative pipeline enabled the identification of a non‐orthologous, functionally convergent receptor in soybean, GmRLP30, which mediates RLK6‐triggered immune responses. In contrast, Capsicum annuum exhibits receptor degeneration and fails to respond to PsRLK6ECD, but immune perception and resistance can be restored via heterologous expression of NbRKR1 or GmRLP30. This integrative pipeline facilitates rapid discovery of evolutionary unrelated yet functionally analogous immune receptors across diverse crop species and enables practical immune reprogramming via receptor transfer, stacking, or synthetic design.
2. Results
2.1. Prevalence of Convergent Evolution in PRRs Across Plant Lineages
Emerging evidence demonstrates convergent evolution of PRRs mediating MAMP recognition (Ngou et al. 2025; Yang et al. 2023; Chen et al. 2024; Zhang et al. 2021). Given the lack of phylogenetic conservation among PRRs across plant lineages (Snoeck et al. 2025), the shared capacity of specific MAMPs to activate PTI in distantly related species implies the existence of functionally analogous, evolutionarily distinct receptors. To systematically evaluate the prevalence of convergent PRR evolution, we curated 14 well‐characterised MAMPs derived from bacteria: flagellin (Katsuragi et al. 2015; Dunning et al. 2007; Hind et al. 2016), EF‐Tu (Zipfel et al. 2006; Furukawa et al. 2014), and CSP (Wang et al. 2016); fungi (Ngou et al. 2025; Saur et al. 2016): E02 (Nie et al. 2021), PG6 (Zhang et al. 2021), and SCP (Yang et al. 2023); oomycetes: XEG1 (Wang et al. 2018; Ma et al. 2015; Sun et al. 2022), elicitin (Chen et al. 2023; Du et al. 2015), NLP (Albert et al. 2015), RLK6 (Pei et al. 2023), PL1 (Sun et al. 2024), GP42 (Torres Ascurra et al. 2023), and Pi‐Cer D (Kato et al. 2022); and herbivores: RPH1 (Zhou et al. 2024) that activate PTI across distantly related plant species (Figure 1A). Although these MAMPs are broadly recognised across plant lineages, only a limited subset of the convergently evolved PRRs has been functionally validated to date. Using known PRRs as queries, BLASTP searches identified top homologues in plant species capable of recognising the same MAMPs. Notably, these homologues from divergent plant families share only ~40% sequence identity (Figure 1B), consistent with their convergent evolution rather than orthologous conservation. Furthermore, numerous MAMPs capable of eliciting PTI across diverse plant families remain excluded from this analysis due to their unknown cognate receptors. Moreover, current MAMP validation efforts are largely confined to limited plants, significantly underestimating the true recognition spectrum of these MAMPs. Collectively, these observations strongly support the prevalence of convergent PRR evolution as an underestimated yet widespread strategy for detecting MAMPs.
FIGURE 1.

Phylogenetic distribution of PRR‐mediated immune responses across plant lineages. (A) left panel: MAMPs derived from bacteria (flagellin, EF‐Tu, CSP), fungi (E02, PG6, SCP), oomycetes (XEG1, elicitin, NLP, RLK6, PL1, GP42, Pi‐Cer D), and herbivores (RPH1). Right panel: Evolutionary tree of 15 plant species spanning diverse families. Dashed colour‐coded lines connect PAMPs to species where they trigger immunity; bold lines indicate PRRs experimentally validated for PAMP recognition. Numbers above species denote validated PRRs/total PAMPs inducing immunity. (B) Top hits of receptors identified in different plant species by BLASTP searches.
2.2. Characterisation of the RLK6 Receptor in N. Benthamiana
To establish a discovery pipeline for convergently evolved PRRs in crops, we employed the oomycete‐derived MAMP PsRLK6 as a proof‐of‐concept. Building on prior findings that PsRLK6ECD activates BAK1‐ and SOBIR1‐dependent PTI in N. benthamiana, we hypothesized receptor‐mediated recognition through a putative LRR‐RLP (Pei et al. 2023). To identify the PsRLK6ECD receptor in N. benthamiana, a TRV‐based gene silencing assay was performed as previously described (Wang et al. 2018). Silencing two closely related LRR‐RLP genes, Nb10g01013 and Nb10g01008, which were designated as RKR1 and RKR2 (RLK6 Receptor 1 and 2, sharing 87.6% amino acid similarity), abolished PsRLK6ECD‐induced ROS production (Figure S1 and Figure S2A).
To determine the individual contributions of RKR1 and RKR2, we generated CRISPR/Cas9 mutant lines targeting each receptor (Figure S2B,C). In rkr1 mutants (rkr1‐1 and rkr1‐2), PsRLK6‐triggered ROS production and expression of the PTI marker gene CYP71D20 were almost completely abolished (> 90% reduction). In contrast, rkr2 mutants (rkr2‐1 and rkr2‐2) showed a partial impairment (~20%) (Figure 2A–C). To further investigate functional redundancy, we generated double mutants (rkr1‐1 and rkr‐2) by disrupting RKR2 in the rkr1‐1 mutant background (Figure S2D). These double mutants almost completely lost responsiveness to PsRLK6ECD (Figure 2A–C), confirming functional redundancy. Notably, reintroducing RKR1 or RKR2 into rkr‐1 mutant plants could restore ROS induction with differential rescue capacity. Transient expression of RKR1 restored ~75% ROS induction versus ~10% with RKR2, indicating RKR1 plays a dominant role in PsRLK6ECD recognition, while RKR2 contributes minimally (Figure S3A,B). Furthermore, pretreatment with PsRLK6ECD protein primed resistance to infection as evidenced by smaller lesions and reduced Phytophthora biomass, but these responses were abolished in rkr1 mutants, partially impaired in rkr2, and completely absent in double mutants (Figure 2D). All mutants exhibited wild‐type growth, excluding developmental pleiotropy (Figure S2E) and exhibited intact responses to the unrelated MAMP flg22 (Figure S4A,B). Also, RLK6 orthologs induced ROS accumulation in wild‐type plants was abolished in rkr‐1 mutant (Figure S5A). As a control, INF1, a well‐characterised MAMP from P. infestans , induced ROS accumulation in both wild‐type and rkr‐1 mutant plants (Figure S5A).
FIGURE 2.

PsRLK6ECD is recognised by two LRR‐RLP homologues in N. benthamiana. (A, B) ROS production triggered by PsRLK6ECD (1 μM) in leaf discs of indicated RKR mutants and wild‐type N. benthamiana plants. Total RLU (Relative Luminescence Unit) (±SD) is shown (n = 8). Experiments were repeated three times with similar results. (C) PsRLK6ECD‐induced up‐regulation of the PTI marker gene CYP71D20 requires RKR1 and RKR2 genes in N. benthamiana. The data are presented as mean ± SD (n = 3). (D) Representative leaves showing the disease symptoms of indicated RKR mutants and WT treated by GFP control or PsRLK6ECD protein in N. benthamiana leaves upon infection with P. capsici. Biomass of P. capsici infection with different treatments was measured. The data are presented as mean ± SD (n = 3). (E) PsRLK6ECD associates with RKR1 and RKR2 in planta; GFP was used as a negative control. HA‐tagged PsRLK6ECD or GFP was co‐expressed with FLAG‐tagged RKR1 or RKR2 in N. benthamiana. (F, G) Interactions of RKR1 with BAK1 and SOBIR1 in planta. N. benthamiana leaves were agroinfiltrated to express RKR1‐FLAG, BAK1‐HA, or SOBIR1‐HA and collected 2 d after treatment with or without 1 μM PsRLK6ECD for 10 min. Extracted proteins were subjected to Co‐IP using FLAG beads and western blotting with anti‐FLAG and anti‐HA antibodies. Experiments were repeated three times with similar results.
Finally, Co‐immunoprecipitation (Co‐IP) assays confirmed that both RKR1 and RKR2 interact with PsRLK6ECD, with RKR1 binding more strongly (Figure 2E). Similarly, RKR1 also could interact with the four abovementioned RLK6 orthologs (Figure S5B). To further examine the structural basis of PsRLK6 perception, we employed AlphaFold3 to predict receptor–ligand complexes. The immunogenic epitope of PsRLK6 (PsRLK6IE) was modelled with RKR1 and RKR2, both forming plausible binding interfaces, consistent with their experimentally validated interactions (SI Appendix, Figure S6A,B). Consistent with canonical LRR‐RLP signalling, RKR1 constitutively interacted with SOBIR1, while PsRLK6ECD protein treatment promoted its association with BAK1 (Figure 2E,F). No interactions were detected between the control receptor FLS2 and either BAK1 or SOBIR1, regardless of PsRLK6ECD protein treatment (Figure 2E,F). These results establish RKR1 and RKR2 as redundant LRR‐RLP receptors responsible for PsRLK6ECD perception in N. benthamiana. This sets the stage for identifying the convergent receptor of PsRLK6ECD in soybean.
2.3. Discovery of the Convergent Receptor in Soybean
To identify the soybean PRR capable of recognising PsRLK6, we initiated our investigation with genome‐wide annotation of LRR‐RLPs in soybean. Candidate receptors were filtered to include those containing a signal peptide and at least 10 extracellular LRRs, which yielded 96 candidates (Table S1 and Dataset S1). To prioritise receptors likely to interact with PsRLK6ECD, we employed AlphaFold3 (AF3) to model ternary complexes between each candidate receptor, the immunogenic epitope of PsRLK6, and the co‐receptor BAK1. Prioritised 20 candidates with interaction probability (ipTM) scores ≥ 0.75 were selected for functional validation (Abramson et al. 2024) (Figure 3A and Table S1). To bypass the technical challenges of soybean genetic manipulation, we leveraged the N. benthamiana rkr‐1 mutant deficient in endogenous PsRLK6ECD receptors (RKR1/RKR2) for functional characterisation. Each candidate soybean LRR‐RLP was transiently expressed in the mutant background, followed by infiltration with purified PsRLK6ECD protein. ROS burst assays revealed that GmRLP30 could restore PsRLK6ECD‐triggered ROS production (Figure 3A). Similarly, PsRLK6ECD‐triggered expression of CYP71D20 was restored by complementation with GmRLP30 (Figure 3B). Infection assays with P. capsici showed that GmRLP30 expression significantly reduced lesion sizes and pathogen biomass with PsRLK6ECD protein treatment (Figure 3C), mirroring the resistance conferred by RKR1/RKR2 in wild‐type plants.
FIGURE 3.

Discovery of the convergent receptor of PsRLK6ECD in soybean. (A) Pipeline for receptor discovery and validation. (1) Bioinformatics analysis: 96 soybean LRR receptor‐like proteins (LRR‐RLPs) with a signal peptide and ≥ 10 LRR domains were identified. (2) AF3 prediction: Structural modelling of ternary complexes (PsRLK6‐derived immunogenic epitope15, candidate LRR‐RLPs, and BAK1) prioritised 20 candidates with interaction probability (ipTM) scores ≥ 0.75. (3) Plasmid construction: Selected candidates were cloned into transient expression vectors. (4) Genetic complementation: Vectors were transiently expressed in the rkr‐1 mutant N. benthamiana. (5, 6). Leaf disk assay: Treated leaf disks were incubated for 12–16 h at room temperature. (7) ROS detection: Luminescence‐based ROS burst was measured after adding L012, HRP, and PsRLK6ECD protein. (8) Data analysis: GmRLP30 restored PsRLK6ECD‐induced ROS production in rkr‐1 mutant, confirming its role as the PsRLK6 receptor. This figure was drawn by BioRender. (B) GmRLP30 restored PsRLK6ECD‐induced up‐regulation of the PTI marker gene CYP71D20 in the rkr‐1 mutant. The data are presented as mean ± SD (n = 3). (C) Representative leaves showing the disease symptoms of GmRLP30, RKR1 transient expression treated by GFP or PsRLK6ECD protein in N. benthamiana leaves upon infection with P. capsici. Biomass of P. capsici infection with different treatments was measured (n = 3). (D) PsRLK6ECD associates with RKR1 and RKR2 in planta, GFP was used as a negative control. HA‐tagged PsRLK6ECD or GFP was co‐expressed with FLAG‐tagged RKR1 or RKR2 in N. benthamiana. (E, F) Interactions of GmRLP30 with BAK1 and SOBIR1 in planta. N. benthamiana leaves were agroinfiltrated to express GmRLP30‐FLAG, BAK1‐HA, or SOBIR1‐HA and collected 2 dpi after treatment with or without 1 μM PsRLK6ECD for 10 min. Extracted proteins were subjected to Co‐IP using FLAG beads and western blotting with anti‐FLAG and anti‐HA antibodies. FLS2‐FLAG as a negative control. Experiments were repeated three times with similar results.
To validate the functional role of GmRLP30 in its native host, we obtained an ethyl methanesulfonate (EMS)‐induced mutant line in soybean (Zhang et al. 2022). This mutant carries a G‐to‐A transition at nucleotide position 2421, introducing a premature stop codon in GmRLP30. Sanger sequencing confirmed the mutation (Figure S7A). PsRLK6ECD treatment of the mutant line showed markedly impaired ROS burst (Figure S7B) and reduced expression of the defence marker gene PR1 (Figure S7C), relative to wild‐type controls. Furthermore, pretreatment with PsRLK6ECD protein primed resistance to infection as evidenced by smaller lesions, but these responses were abolished in gmrlp30 mutants (Figure S7D). These results support that GmRLP30 is functionally required for PsRLK6ECD perception in soybean. Co‐IP assays in N. benthamiana confirmed direct interaction between GmRLP30 and PsRLK6ECD (Figure 3D). GmRLP30 constitutively associated with SOBIR1 and recruited BAK1 upon PsRLK6ECD protein treatment, forming a ternary complex analogous to the Nicotiana RKR1/BAK1/SOBIR1 module (Figure 3E,F). Strikingly, sequence alignment revealed that GmRLP30 and RKR1, derived from divergent plant species, share less than 50% identity, yet both receptors recognized PsRLK6ECD with comparable specificity (Figure S8). Our findings extend this paradigm of convergent receptor evolution to other plant lineages, demonstrating the effectiveness of this approach in successfully cloning convergent receptors across diverse plant species.
2.4. Heterologous Expression of RLK6 Receptors Confers Enhanced Resistance in Pepper
Comparative genomic analysis of Solanaceae PRRs revealed that RKR1 and RKR2 are generally conserved across species, yet both genes are compromised in Capsicum annuum . RKR2 is completely absent from the pepper genome (Figure 4A), while RKR1 contains a deletion resulting in a truncated coding sequence (Figure 4B). Consistently, PsRLK6ECD failed to elicit a ROS burst in pepper leaves (Figure 4C), and the pepper CaRKR1 protein was unable to interact with PsRLK6ECD in co‐immunoprecipitation assays (Figure 4D), suggesting functional degeneration. To test whether PsRLK6 perception could be restored, we transiently expressed either NbRKR1 or GmRLP30 in pepper. Both receptors reconstituted PsRLK6ECD‐induced ROS responses (Figure 4E) and enhanced resistance to P. capsici infection (Figure 4F), demonstrating that PsRLK6ECD‐triggered immunity can be synthetically restored in PRR‐deficient species via interspecies PRR transfer.
FIGURE 4.

Functional degeneration and heterologous restoration of RLK6 perception in pepper. (A) Phylogenetic relationship and distribution of RKR1 and RKR2 across Solanaceae species. (B) Diagram of NbRKR1 and CaRKR1 protein domains with amino acid positions labeled. (C) ROS production triggered by PsRLK6ECD or SOJ5 (1 μM) in leaf discs of peppers. Total RLU (Relative Luminescence Unit) (±SD) is shown (n = 8). Experiments were repeated three times with similar results. (D0) PsRLK6ECD does not associate with CaRKR1 in planta. HA‐tagged PsRLK6ECD was co‐expressed with FLAG‐tagged NbRKR1 or CaRKR1 in N. benthamiana. (E) Heterologous expression of NbRKR1 and GmRLP30 restored PsRLK6ECD‐induced ROS production in pepper. (F) Heterologous expression of NbRKR1 and GmRLP30 confers enhanced resistance to P. capsici in pepper. Representative leaves show the disease symptoms of indicated treatments upon infection with P. capsici. Biomass of P. capsici infection with different treatments was measured. The data are presented as mean ± SD (n = 3), **P < 0.01, two‐tailed Student's t test.
2.5. Integrative Pipeline for Uncovering Convergent PRRs in Crops
Collectively, our findings establish a two‐tiered pipeline for identifying convergent PRRs in crops: (1) Rapid PRR identification in model plants using genetic tools like VIGS or T‐DNA mutants to screen PRR libraries; (2) AI‐guided PRR identification by curating crop PRR databases and utilizing AF3 to predict ligand‐receptor complexes and prioritize candidates for validation in model plants. By combining model plant chassis with AI‐driven structural predictions, we can accelerate the identification of cryptic immune receptors in crops. This integrated pipeline bridges functional genomics, AI‐predictive biology, and precision genome editing—enabling rapid development of pathogen‐resistant crops through transfer, stacking, or synthetic immune receptor engineering rather than natural evolution (Figure 5).
FIGURE 5.

An integrated pipeline of crop convergent receptors identification and engineering. ① Rapid PRR identification in model plants. Nicotiana benthamiana (via VIGS) and Arabidopsis (via T‐DNA insert mutants) were used to screen for PRRs mediating immune responses to MAMPs/HAMPs. Immune outputs included cell death, ROS bursts, or reporter assays. Validated PRRs were confirmed by Co‐IP and further characterized in CRISPR‐edited PRR knockout lines. ② AI‐guided convergent crop PRRs identification. Step 1: Crop‐specific PRR databases (RLKs/RLPs) were filtered by bioinformatic criteria (e.g., signal peptides, LRR domain architecture). Step 2: AlphaFold3 predicted binding interfaces between candidate PRRs and PAMPs; top candidates were expressed in corresponding model plant PRR mutants to restore MAMP‐triggered ROS bursts or cell death. Step 3: Physical interaction between PRRs and PAMPs/co‐receptors was validated. Crop PRR mutants were generated via CRISPR‐Cas9 for functional validation where feasible. ③ Engineering PRRs for robust recognition. Insights into convergent PRR‐PAMP recognition mechanisms across crops informed synthetic biology approaches. Engineered PRRs (Stacking PRRs or synthetic chimeric PRRs) were designed to recognize distinct epitopes of the same PAMP, reducing pathogen escape via single mutations. This pipeline enables development of disease‐resistant crops with robust, evolutionarily durable immunity. Figure created with BioRender.
3. Discussion
Cell‐surface receptors facilitate reciprocal recognition between plants and pathogens, forming the molecular basis of cross‐kingdom communication. Intriguingly, LRR‐type RLKs evolved in both plants and oomycetes, albeit with distinct origins (Yin et al. 2023). In prior work, we identified Phytophthora sojae‐derived RLK6 and its oomycete orthologs as a novel class of MAMP that trigger PTI in both N. benthamiana and soybean (Pei et al. 2023). Here, we extend these findings by characterising the cognate receptors in these two phylogenetically distant species through VIGS screening and an integrated pipeline. Despite minimal sequence similarity, these receptors converge on PsRLK6ECD recognition, supporting the idea of convergent evolution. Strikingly, we demonstrated that an oomycete LRR‐RLK interacts directly with these plant LRR‐RLPs, forming a quaternary complex with the co‐receptors BAK1 and SOBIR1. These findings reveal that cross‐kingdom cell communication between Phytophthora and plants is mediated by direct receptor‐receptor engagement at the cell surface, although the extracellular domain of PsRLK6 is likely cleaved and released into the apoplastic space (Figure S9).
Over the past three decades, the majority of plant PRRs have been characterised through classical genetic approaches, notably forward genetic mapping and reverse genetics via targeted mutagenesis (Snoeck et al. 2025). While classical genetic methods have been instrumental in identifying plant PRRs, their application in crops is limited by the need for segregating populations or mutant libraries, which are resource‐intensive and time‐consuming. Recently, Ngou et al. developed a chimeric receptor pipeline by fusing extracellular domains of candidate receptors with the kinase domain from BRI1 (Brassinosteroid insensitive 1), enabling detection of BES1 (BRI1‐EMS‐SUPPRESSOR 1) dephosphorylation as a high‐throughput readout for LRR‐RLK‐XII receptor discovery in crops (Ngou et al. 2025). Nevertheless, whether this approach can be extended to other PRR families, especially LRR‐RLPs, remains uncertain. To overcome these limitations in crops, we established an integrated pipeline combining AI‐driven MAMP‐receptor interaction predictions, protein–protein interaction validation, and heterologous complementation in PRR‐deficient mutants. This approach is uniquely suited for identifying convergent PRRs in crops, particularly relevant given that numerous MAMPs with defined PRRs in model plants remain orphan ligands in crop species. However, this pipeline has inherent limitations, including restricted applicability to non‐convergent PRR evolutionary scenarios and high false‐positive rates in AI‐predicted receptor complexes that necessitate experimental prioritisation.
Despite persistent challenges in cloning crop PRRs, convergent PRRs offer compelling potential for disease‐resistant breeding. While MAMPs are traditionally viewed as conserved molecular patterns, accumulating evidence reveals widespread polymorphisms exist, which critically enable immune evasion by disrupting receptor binding or activating (Buscaill and van der Hoorn 2021; Stevens et al. 2024; Li, Bolaños, et al. 2025). For instance, convergent LRR‐RLKs SCORE and CORE could recognise polymorphic cold‐shock protein peptides (Ngou et al. 2025). Independent of MAMP polymorphisms, convergent PRRs across plant lineages frequently recognise structurally non‐overlapping epitopes or spatially distinct ligand domains. Therefore, stacking convergent PRRs in crops could enhance the robustness of MAMP recognition capable of countering pathogen co‐evolution and immune evasion, a strategy analogous to pyramid resistance genes in potato, which provides broad‐spectrum resistance against Phytophthora infestans by targeting multiple pathogen effectors (Zhao et al. 2025). Collectively, the convergent evolution of PRRs reflects a key adaptive strategy in the endless arms race between plants and pathogens, where recurrent selection pressures favour novel yet functionally analogous receptors to detect MAMPs. Leveraging this evolutionary paradigm not only provides a roadmap for rapid PRR discovery in crops but also enables the engineering of receptor‐stacked cultivars with enhanced recognition breadth against polymorphic MAMPs.
Notably, several successful examples of PRR transfer across plant families have demonstrated the feasibility of engineering synthetic immune recognition in crops. Introduction of Arabidopsis EFR into tomato and rice confers enhanced resistance to bacterial pathogens (Lacombe et al. 2010; Lu et al. 2015; Schwessinger et al. 2015), while the transfer of Nicotiana benthamiana RXEG1 into wheat, soybean, and cotton improves fungal resistance (Wang et al. 2023; Zeng et al. 2025). In this context, our demonstration that NbRKR1 and GmRLP30 restore RLK6‐triggered ROS and disease resistance in pepper—a species that has naturally lost functional RLK6 perception—further exemplifies the principle that immune competence can be synthetically rebuilt through cross‐species receptor transfer.
4. Materials and Methods
4.1. Plant Materials and Pathogen Infection Assays
Nicotiana benthamiana plants were grown in soil under controlled conditions (23°C, 16 h light/8 h dark). To generate loss‐of‐function mutants, Cas9‐expressing transgenic N. benthamiana plants were subjected to CRISPR‐mediated genome editing using an established protocol (Yin et al. 2023). Single‐guide RNAs (sgRNAs) targeting RKR1 (sgRNA1: CTATCTGTAATCCGTCTTGG; sgRNA2: CTGGTCCTGAAGACATTTAC; sgRNA3: TCACAAAATGCAATGCTTGG) and RKR2 (sgRNA1: ACTCTGGATCTGAGCTATAC; sgRNA2: AACTTGCCCTGCATCATTGC) were delivered via a tobacco rattle virus (TRV) vector. The rkr1/rkr2 double mutants were generated by introducing RKR2‐specific sgRNAs into the homozygous rkr1‐1 mutant background. For P. capsici infection, agar plugs (5 mm diameter) from actively growing mycelia were placed on leaf surfaces. Inoculated plants were maintained in high‐humidity chambers at 25°C. Lesion areas were quantified at 36 h post‐inoculation (hpi). Pathogen biomass was assessed via qPCR using P. capsici Actin‐specific primers normalized to host EF1α (primers are listed in Table S2).
4.2. Agrobacterium‐Mediated Transient Expression and Gene Silencing in Plants
Agrobacterium tumefaciens strain GV3101 carrying binary or silencing vectors was cultured on LB medium supplemented with appropriate antibiotics at 28°C. The bacterial cells were pelleted and resuspended in MES buffer (10 mM MgCl2, 10 mM MES, 200 μM acetosyringone, pH 5.7) in the dark for 2 h at room temperature before infiltration. For transient expression assays, suspended A. tumefaciens cell suspension was infiltrated into N. benthamiana or pepper leaves using a syringe without a needle at a concentration of OD600 of 0.5. For TRV (tobacco rattle virus)‐mediated gene silencing, A. tumefaciens cultures expressing TRV2 constructs and those expressing TRV1 were mixed at a 1:1 ratio to a final OD600 of 0.8 before injection into primary leaves of four‐leaf‐stage N. benthamiana seedlings. TRV:GFP was used as a control (Wang et al. 2018). Three weeks after treatment of TRV2 constructs, plants were used for corresponding assays.
4.3. Plasmid Construction
cDNAs from P. sojae and soybean (Williams 82) collected were used as a template to amplify the coding sequences of P. sojae and soybean GmRLP genes using the Phanta Super‐Fidelity DNA Polymerase (P501‐d1, Vazyme). Genes were cloned into vectors based on homologous recombination technology using the Vazyme ClonExpress II One Step Cloning Kit (C112, Vazyme). For Agrobacterium‐mediated transient expression in N. benthamiana, the coding sequences of PsRLK6 ECD , PsRLK6ECD orthologs, and GFP were cloned into the vector pBIN‐3 × HA. FLS2, RKR1, RKR2, CaRKR1, and GmRLP30 were cloned into the vector pCAMBIA1300‐FLAG. For expression of the protein in Pichia pastoris, PsRLK6ECD without the signal peptide was cloned into the pPICZaA vector (Pei et al. 2023). Primer sequences are listed in Dataset S2.
4.4. Expression and Purification of Recombinant PsRLK6ECD Protein
The extracellular domain of PsRLK6 (PsRLK6ECD) was heterologously expressed in Pichia pastoris KM71H (MutS) using the Easy Select Pichia Expression System (Invitrogen) (Pei et al. 2023). Transformants were initially cultured in yeast extract‐peptone‐dextrose (YPD) medium, followed by growth in buffered glycerol‐complex medium (BMGY, pH 6.5) at 30°C with shaking (250 rpm). Protein expression was induced by transferring cells to buffered methanol‐complex medium (BMMY, pH 6.5) containing 0.5% methanol, with daily methanol supplementation. After 72 h induction, culture supernatants were harvested by centrifugation (4000 × g, 20 min) and filtered through a 0.45 μm membrane. Recombinant PsRLK6ECD was purified via immobilised metal affinity chromatography using Ni‐NTA Superflow resin under native conditions. Eluted proteins were concentrated using Amicon Ultra centrifugal filters (Millipore). Protein purity and integrity were verified by SDS‐PAGE and Coomassie blue staining.
4.5. RNA Isolation and Quantitative Reverse Transcription PCR
Total RNA was extracted from N. benthamiana leaves using the PureLink RNA Mini Kit following the manufacturer's protocol. RNA quality and concentration were assessed spectrophotometrically. For cDNA synthesis, 900 ng of total RNA was reverse‐transcribed with oligo(dT) primers using the HiScript II Q RT SuperMix (Vazyme). Quantitative PCR (qPCR) reactions were performed in triplicate using SYBR qPCR Master Mix (Vazyme) on an ABI Prism 7500 Fast Real‐Time PCR System. The relative quantitative method (2−ΔΔCt) was used to evaluate the quantitative variation.
4.6. ROS Burst and DAB Staining Assays
Reactive oxygen species (ROS) production was quantified using an L‐012/peroxidase‐based chemiluminescence assay. Leaf discs (4 mm diameter) from N. benthamiana, soybean, or pepper plants were floated overnight in 200 μL sterile water in 96‐well plates. Water was replaced with a reaction buffer containing 20 μM L‐012 (Wako), 20 μg/mL horseradish peroxidase (Sigma‐Aldrich), and 1 μM test protein (PsRLK6ECD, GFP, or flg22 control). Luminescence was measured immediately using a GLOMAX96 microplate luminometer (Promega, Madison, WI, USA) at 30 s intervals for 80 min. For 3,3′‐diaminobenzidine (DAB, Sigma‐Aldrich) staining, agroinfiltrated leaves were excised 24 h post‐infiltration, vacuum‐infiltrated with DAB solution (1 mg/mL, pH 3.8), and incubated in darkness for 8 h. Chlorophyll was cleared by boiling in ethanol (95%), and H2O2 accumulation was visualised as brown polymerisation products.
4.7. Co‐Immunoprecipitation and Western Blotting
Total proteins were extracted from agroinfiltrated N. benthamiana leaves 36–48 h post‐infiltration (hpi) using lysis buffer (50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 5% glycerol, 5 mM DTT, 0.5% Triton X‐100, and 1× protease inhibitor cocktail). Lysates were centrifuged (20,000 × g, 15 min, 4°C), and supernatants were incubated with anti‐FLAG M2 magnetic beads (Sigma‐Aldrich) for 2 h at 4°C. Beads were washed three times with lysis buffer, and bound proteins were eluted in 2× Laemmli buffer by boiling (7–10 min). Eluates were resolved by SDS‐PAGE and transferred to PVDF membranes. Membranes were blocked with 5% non‐fat milk in TBST (20 mM Tris, 150 mM NaCl, 0.1% Tween 20) and probed with primary antibodies: anti‐HA (1:5000) or anti‐FLAG (1:5000). After washing in TBST three times and incubation with goat‐antimouse IgG secondary antibody for 1 h, the blots were detected with an ECL substrate kit.
4.8. Structure Modelling by AlphaFold 3
The extracellular domains of GmRLPs and the immunogenic epitope of PsRLK6ECD were modelled in complex with BAK1, respectively, using AlphaFold Server Beta (v3.0) with default parameters (Abramson et al. 2024). The extracellular domain of GmRLPs and BAK1 were determined using deepTMHMM. Structural predictions were visualised and analysed in PyMOL.
4.9. Bioinformatics and Data Analysis
Sequence alignments were performed using MUSCLE (v5.0), and phylogenetic trees were constructed with MEGA11 using the neighbour‐joining method (1000 bootstrap replicates) (Tamura et al. 2021). Statistical analyses were conducted in GraphPad Prism (v9.0). Data are presented as mean ± SD, with significance determined by Student's t‐test or ANOVA.
Author Contributions
Conceptualization, D.D., Z.Y., and Y.P.; Methodology, Z.Y., and Y.P.; Software, X.G., J.L., Y.C., and D.S.; Formal analysis, Y.P., and Z.Y.; Investigation, Y.P., Y.Z., H.W., Y.G., Z.G., Y.R., Y.R., J.Y., Y.W., P.J.; Writing – original draft, Z.Y., and Y.P.; Writing – review and editing, D.D.; Visualisation, Y.P., X.G., and J.L.; Supervision, D.D. and Y.Z.; Project administration, D.D., Z.Y., and Y.P.; Funding acquisition, D.S., D.D., Z.Y., and Y.P.
Conflicts of Interest
The authors declare no conflicts of interest.
Supporting information
Data S1: pbi70409‐sup‐0001‐Supinfo1.rar.
Table S1: pbi70409‐sup‐0002‐TableS1.xlsx.
Table S2: pbi70409‐sup‐0003‐TableS2.xlsx.
Figure S1: A pipeline to identify the receptor of PsRLK6ECD in N. benthamiana.
Figure S2: Generation of RKR mutants in N. benthamiana. (A) The distribution of RKR1 and RKR2 genes in chromosomes. (B‐D) CRISPR/Cas9‐mediated gene editing of RKR1, RKR2 and RKR1/2 double mutants (RKR). Mutations of RKR1 and RKR2 in rkr1‐1, rkr1‐2, rkr2‐1, rkr2‐2, rkr‐1 and rkr‐2, were detected by DNA sequencing and shown as chromatographs. Two homozygous lines, rkr1‐1 and rkr1‐2, carry a one‐nucleotide deletion and two‐nucleotide deletion in RKR1, respectively (B). Also, two homozygous lines, rkr2‐1 and rkr2‐2, carry a one‐nucleotide deletion and two‐nucleotide deletion in RKR2, respectively (C). CRISPR/Cas9‐mediated editing of RKR2 in the rkr1‐1 mutant. Two homozygous lines, rkr‐1 and rkr‐2, carry the different nucleotide insertion in RKR2 (D). (E) The rkr‐1, rkr‐2 and rkr mutants are morphologically indistinguishable from WT plants. Plants were grown on soil for 4 weeks and photographed. Scale bar, 1 cm.
Figure S3: RKR1 and RKR2 complementation assay in the rkr‐1 mutant plants. (A) Transient expression of RKR1 and RKR2 can compensate for the ROS burst induced by PsRLK6ECD in the rkr‐1 mutant. (B) Accumulation of relative light units (RLU) in 70 min was calculated for N. benthamiana with different treatments (n = 8). Statistical analysis was performed using Student's t test.
Figure S4: ROS burst triggered by flg22 in wild‐type or RKR mutant plants.
Figure S5: RKR1 mediates recognition of different RLK6 orthologs. (A) ROS accumulation induced by PsRLK6ECD homologues are dependent on RKR1 in planta. FLAG‐tagged RKR1 or RKR2 were co‐expressed with HA‐tagged GFP or PsRLK6ECD in N. benthamiana. (B) RKR1 interacts with PsRLK6ECD orthologs in planta. FLAG‐tagged RKR1 was co‐expressed with HA‐tagged GFP or PsRLK6ECD in N. benthamiana. The data are presented as mean ± SD (n = 6).
Figure S6: AlphaFold3‐predicted complexes between PsRLK6 immunogenic epitope and PRRs. (A, B) Predicted complex of NbRKR1 (grey) or NbRKR2 (yellow) with PsRLK6IE (cyan).
Figure S7: GmRLP30 regulates the recognition of PsRLK6ECD. (A) Sanger sequencing of the junction regions confirmed that gmrlp30 were mutated. (B) PsRLK6ECD triggered ROS burst in wild‐type or gmrlp30 mutant plants. Accumulation of relative light units (RLU) in 70 min was calculated for soybean treated with PsRLK6ECD. The data are presented as mean ± SD (n = 8). Statistical analysis was performed using Student's t test. (C) PsRLK6ECD‐induced up‐regulation of the PTI marker gene PR1 requires GmRLP30 gene in soybean. The data are presented as mean ± SD (n = 3). (D) Representative leaves showing the disease symptoms of indicated gmrlp30 mutants and WT treated by GFP control or PsRLK6ECD protein in soybean leaves upon infection with P. sojae. Biomass of P. sojae infection with different treatments were measured. The data are presented as mean ± SD (n = 3).
Figure S8: Sequence alignment of RKR1, RKR2, CaRKR1, and GmRLP30.
Figure S9: A schematic diagram of the mode of cell communication between plants and Phytophthora membrane receptors. Phytophthora‐derived membrane receptor RLK6 promotes oomycete sexual development under normal conditions. During plant–pathogen interaction, RLK6 is likely cleaved to release its extracellular domain (RLK6ECD), which enters the plant apoplast and functions as an immunogenic ligand. In Nicotiana benthamiana, RLK6ECD is perceived by the LRR‐RLP receptors RKR1 and RKR2; in soybean, the structurally distinct but functionally equivalent receptor GmRLP30 fulfils this role. Despite lacking sequence homology, these plant receptors directly bind PsRLK6ECD and recruit the conserved co‐receptors BAK1 and SOBIR1 to initiate pattern‐triggered immunity (PTI). This model highlights a rare example of membrane receptor–mediated cross‐kingdom signalling between pathogen and host, revealing a unique mechanism of extracellular communication through receptor–receptor recognition.
Acknowledgements
We thank Prof. Qingxin Song (Nanjing Agricultural University) for kindly providing the EMS‐induced soybean mutant line of GmRLP30 used in this study. This study was supported by grants from the National Natural Science Foundation of China (32372493 to D.S., 32472502 to Z.Y., and 32230089 to D.D.), the Fundamental Research Funds for the Central Universities (KJYQ2025050 to Z.Y.), the China Agriculture Research System (CARS‐21 to D.D.), the Postdoctoral Fellowship Program and China Postdoctoral Science Foundation (BX20250018 to Y.P.), and the China Postdoctoral Science Foundation (2024M761446 to Y.P.).
Funding: This study was supported by grants from the National Natural Science Foundation of China (32372493 to D.S., 32472502 to Z.Y., and 32230089 to D.D.), the Fundamental Research Funds for the Central Universities (KJYQ2025050 to Z.Y.), the China Agriculture Research System (CARS‐21 to D.D.), the Postdoctoral Fellowship Program and China Postdoctoral Science Foundation (BX20250018 to Y.P.), and the China Postdoctoral Science Foundation (2024M761446 to Y.P.).
Data Availability Statement
The data that supports the findings of this study is available in the Supporting Information of this article.
References
- Abramson, J. , Adler J., Dunger J., et al. 2024. “Accurate Structure Prediction of Biomolecular Interactions With AlphaFold 3.” Nature 630: 493–500. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Albert, I. , Böhm H., Albert M., et al. 2015. “An RLP23‐SOBIR1‐BAK1 Complex Mediates NLP‐Triggered Immunity.” Nature Plants 1: 15140. [DOI] [PubMed] [Google Scholar]
- Buscaill, P. , and van der Hoorn R. A. L.. 2021. “Defeated by the Nines: Nine Extracellular Strategies to Avoid Microbe‐Associated Molecular Patterns Recognition in Plants.” Plant Cell 33: 2116–2130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen, W. , Yan M., Chen S., et al. 2024. “The Complete Genome Assembly of Nicotiana Benthamiana Reveals the Genetic and Epigenetic Landscape of Centromeres.” Nature Plants 10: 1928–1943. [DOI] [PubMed] [Google Scholar]
- Chen, Z. , Liu F., Zeng M., et al. 2023. “Convergent Evolution of Immune Receptors Underpins Distinct Elicitin Recognition in Closely Related Solanaceous Plants.” Plant Cell 35: 1186–1201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Du, J. , Verzaux E., Chaparro‐Garcia A., et al. 2015. “Elicitin Recognition Confers Enhanced Resistance to Phytophthora infestans in Potato.” Nature Plants 1: 15034. [DOI] [PubMed] [Google Scholar]
- Dunning, F. M. , Sun W., Jansen K. L., Helft L., and Bent A. F.. 2007. “Identification and Mutational Analysis of Arabidopsis FLS2 Leucine‐Rich Repeat Domain Residues That Contribute to Flagellin Perception.” Plant Cell 19: 3297–3313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Furukawa, T. , Inagaki H., Takai R., Hirai H., and Che F. S.. 2014. “Two Distinct EF‐Tu Epitopes Induce Immune Responses in Rice and Arabidopsis.” Molecular Plant‐Microbe Interactions: MPMI 27: 113–124. [DOI] [PubMed] [Google Scholar]
- Hind, S. R. , Strickler S. R., Boyle P. C., et al. 2016. “Tomato Receptor FLAGELLIN‐SENSING 3 Binds flgII‐28 and Activates the Plant Immune System.” Nature Plants 2: 16128. [DOI] [PubMed] [Google Scholar]
- Jehle, A. K. , Lipschis M., Albert M., et al. 2013. “The Receptor‐Like Protein ReMAX of Arabidopsis Detects the Microbe‐Associated Molecular Pattern eMax From Xanthomonas.” Plant Cell 25: 2330–2340. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jones, J. D. , and Dangl J. L.. 2006. “The Plant Immune System.” Nature 444: 323–329. [DOI] [PubMed] [Google Scholar]
- Jones, J. D. G. , Staskawicz B. J., and Dangl J. L.. 2024. “The Plant Immune System: From Discovery to Deployment.” Cell 187: 2095–2116. [DOI] [PubMed] [Google Scholar]
- Kato, H. , Nemoto K., Shimizu M., et al. 2022. “Recognition of Pathogen‐Derived Sphingolipids in Arabidopsis.” Science 376: 857–860. [DOI] [PubMed] [Google Scholar]
- Katsuragi, Y. , Takai R., Furukawa T., et al. 2015. “CD2‐1, the C‐Terminal Region of Flagellin, Modulates the Induction of Immune Responses in Rice.” Molecular Plant‐Microbe Interactions: MPMI 28: 648–658. [DOI] [PubMed] [Google Scholar]
- Lacombe, S. , Rougon‐Cardoso A., Sherwood E., et al. 2010. “Interfamily Transfer of a Plant Pattern‐Recognition Receptor Confers Broad‐Spectrum Bacterial Resistance.” Nature Biotechnology 28: 365–369. [DOI] [PubMed] [Google Scholar]
- Li, S. X. , Liu Y., Zhang Y. M., Chen J. Q., and Shao Z. Q.. 2025. “Convergent Reduction of Immune Receptor Repertoires During Plant Adaptation to Diverse Special Lifestyles and Habitats.” Nature Plants 11: 248–262. [DOI] [PubMed] [Google Scholar]
- Li, T. , Bolaños E. J., Stevens D. M., et al. 2025. “Unlocking Expanded Flagellin Perception Through Rational Receptor Engineering.” Nature Plants 11: 1628–1641. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lu, F. , Wang H., Wang S., et al. 2015. “Enhancement of Innate Immune System in Monocot Rice by Transferring the Dicotyledonous Elongation Factor Tu Receptor EFR.” Journal of Integrative Plant Biology 57: 641–652. [DOI] [PubMed] [Google Scholar]
- Ma, Z. , Song T., Zhu L., et al. 2015. “A Phytophthora Sojae Glycoside Hydrolase 12 Protein Is a Major Virulence Factor During Soybean Infection and Is Recognized as a PAMP.” Plant Cell 27: 2057–2072. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ngou, B. P. M. , Ding P., and Jones J. D. G.. 2022. “Thirty Years of Resistance: Zig‐Zag Through the Plant Immune System.” Plant Cell 34: 1447–1478. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ngou, B. P. M. , Heal R., Wyler M., Schmid M. W., and Jones J. D. G.. 2022. “Concerted Expansion and Contraction of Immune Receptor Gene Repertoires in Plant Genomes.” Nature Plants 8: 1146–1152. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ngou, B. P. M. , Wylet M., Schmid M. W., et al. 2025. “Systematic Discovery and Design of Synthetic Immune Receptors in Plants. ” Science 389: eadx2508. [DOI] [PubMed]
- Nie, J. , Zhou W., Liu J., Tan N., Zhou J. M., and Huang L.. 2021. “A Receptor‐Like Protein From Nicotiana Benthamiana Mediates VmE02 PAMP‐Triggered Immunity.” New Phytologist 229: 2260–2272. [DOI] [PubMed] [Google Scholar]
- Pei, Y. , Ji P., Si J., et al. 2023. “A Phytophthora Receptor‐Like Kinase Regulates Oospore Development and Can Activate Pattern‐Triggered Plant Immunity.” Nature Communications 14: 4593. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Saur, I. M. , Kadota Y., Sklenar J., et al. 2016. “NbCSPR Underlies Age‐Dependent Immune Responses to Bacterial Cold Shock Protein in Nicotiana Benthamiana.” Proceedings of the National Academy of Sciences of the United States of America 113: 3389–3394. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schwessinger, B. , Bahar O., Thomas N., et al. 2015. “Transgenic Expression of the Dicotyledonous Pattern Recognition Receptor EFR in Rice Leads to Ligand‐Dependent Activation of Defense Responses.” PLoS Pathogens 11: e1004809. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Snoeck, S. , Johanndrees O., Nürnberger T., and Zipfel C.. 2025. “Plant Pattern Recognition Receptors: From Evolutionary Insight to Engineering.” Nature Reviews. Genetics 26: 268–278. [DOI] [PubMed] [Google Scholar]
- Steinbrenner, A. D. 2020. “The Evolving Landscape of Cell Surface Pattern Recognition Across Plant Immune Networks.” Current Opinion in Plant Biology 56: 135–146. [DOI] [PubMed] [Google Scholar]
- Stevens, D. M. , Moreno‐Pérez A., Weisberg A. J., et al. 2024. “Natural Variation of Immune Epitopes Reveals Intrabacterial Antagonism.” Proceedings of the National Academy of Sciences of the United States of America 121: e2319499121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun, G. , Xia Y., Li K., et al. 2024. “Dual Activation of Soybean Resistance Against Phytophthora Sojae by Pectin Lyase and Degraded Pectin Oligosaccharides.” Science China. Life Sciences 67: 2746–2760. [DOI] [PubMed] [Google Scholar]
- Sun, Y. , Wang Y., Zhang X., et al. 2022. “Plant Receptor‐Like Protein Activation by a Microbial Glycoside Hydrolase.” Nature 610: 335–342. [DOI] [PubMed] [Google Scholar]
- Tamura, K. , Stecher G., and Kumar S.. 2021. “MEGA11: Molecular Evolutionary Genetics Analysis Version 11.” Molecular Biology and Evolution 38: 3022–3027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Torres Ascurra, Y. C. , Zhang L., Toghani A., et al. 2023. “Functional Diversification of a Wild Potato Immune Receptor at Its Center of Origin.” Science 381: 891–897. [DOI] [PubMed] [Google Scholar]
- Wang, L. , Albert M., Einig E., Fürst U., Krust D., and Felix G.. 2016. “The Pattern‐Recognition Receptor CORE of Solanaceae Detects Bacterial Cold‐Shock Protein.” Nature Plants 2: 16185. [DOI] [PubMed] [Google Scholar]
- Wang, Y. , Xu Y., Sun Y., et al. 2018. “Leucine‐Rich Repeat Receptor‐Like Gene Screen Reveals That Nicotiana RXEG1 Regulates Glycoside Hydrolase 12 MAMP Detection.” Nature Communications 9: 594. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang, Z. , Yang B., Zheng W., et al. 2023. “Recognition of Glycoside Hydrolase 12 Proteins by the Immune Receptor RXEG1 Confers Fusarium Head Blight Resistance in Wheat.” Plant Biotechnology Journal 21: 769–781. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang, Y. , Steidele C. E., Rössner C., et al. 2023. “Convergent Evolution of Plant Pattern Recognition Receptors Sensing Cysteine‐Rich Patterns From Three Microbial Kingdoms.” Nature Communications 14: 3621. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yin, Z. , Shen D., Zhao Y., Peng H., Liu J., and Dou D.. 2023. “Cross‐Kingdom Analyses of Transmembrane Protein Kinases Show Their Functional Diversity and Distinct Origins in Protists.” Computational and Structural Biotechnology Journal 21: 4070–4078. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zeng, M. , Qiu P., Ouyang H., et al. 2025. “The Receptor‐Like Protein RXEG1 Confers Broad‐Spectrum Resistance in Soybean and Cotton by Recognizing Microbial Glycoside Hydrolase 12 Proteins.” Plant Biotechnology Journal 23: 3417. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang, L. , Hua C., Janocha D., Fliegmann J., and Nürnberger T.. 2023. “Plant Cell Surface Immune Receptors‐Novel Insights Into Function and Evolution.” Current Opinion in Plant Biology 74: 102384. [DOI] [PubMed] [Google Scholar]
- Zhang, L. , Hua C., Pruitt R. N., et al. 2021. “Distinct Immune Sensor Systems for Fungal Endopolygalacturonases in Closely Related Brassicaceae.” Nature Plants 7: 1254–1263. [DOI] [PubMed] [Google Scholar]
- Zhang, M. , Zhang X., Jiang X., et al. 2022. “iSoybean: A Database for the Mutational Fingerprints of Soybean.” Plant Biotechnology Journal 20: 1435–1437. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhao, X. , Zhang F., Chen X., et al. 2025. “Stacking Potato NLR Genes Activates a Calcium‐Dependent Protein Kinase and Confers Broad‐Spectrum Disease Resistance to Late Blight.” Journal of Integrative Plant Biology 67: 1910–1927. [DOI] [PubMed] [Google Scholar]
- Zhou, J. , Yin Z., Shen D., et al. 2024. “A Conserved Protein Family in Mirid Bug Riptortus pedestris Plays Dual Roles in Regulating Plant Immunity.” Plant Physiology 196: 2812–2824. [DOI] [PubMed] [Google Scholar]
- Zipfel, C. , Kunze G., Chinchilla D., et al. 2006. “Perception of the Bacterial PAMP EF‐Tu by the Receptor EFR Restricts Agrobacterium‐Mediated Transformation.” Cell 125: 749–760. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data S1: pbi70409‐sup‐0001‐Supinfo1.rar.
Table S1: pbi70409‐sup‐0002‐TableS1.xlsx.
Table S2: pbi70409‐sup‐0003‐TableS2.xlsx.
Figure S1: A pipeline to identify the receptor of PsRLK6ECD in N. benthamiana.
Figure S2: Generation of RKR mutants in N. benthamiana. (A) The distribution of RKR1 and RKR2 genes in chromosomes. (B‐D) CRISPR/Cas9‐mediated gene editing of RKR1, RKR2 and RKR1/2 double mutants (RKR). Mutations of RKR1 and RKR2 in rkr1‐1, rkr1‐2, rkr2‐1, rkr2‐2, rkr‐1 and rkr‐2, were detected by DNA sequencing and shown as chromatographs. Two homozygous lines, rkr1‐1 and rkr1‐2, carry a one‐nucleotide deletion and two‐nucleotide deletion in RKR1, respectively (B). Also, two homozygous lines, rkr2‐1 and rkr2‐2, carry a one‐nucleotide deletion and two‐nucleotide deletion in RKR2, respectively (C). CRISPR/Cas9‐mediated editing of RKR2 in the rkr1‐1 mutant. Two homozygous lines, rkr‐1 and rkr‐2, carry the different nucleotide insertion in RKR2 (D). (E) The rkr‐1, rkr‐2 and rkr mutants are morphologically indistinguishable from WT plants. Plants were grown on soil for 4 weeks and photographed. Scale bar, 1 cm.
Figure S3: RKR1 and RKR2 complementation assay in the rkr‐1 mutant plants. (A) Transient expression of RKR1 and RKR2 can compensate for the ROS burst induced by PsRLK6ECD in the rkr‐1 mutant. (B) Accumulation of relative light units (RLU) in 70 min was calculated for N. benthamiana with different treatments (n = 8). Statistical analysis was performed using Student's t test.
Figure S4: ROS burst triggered by flg22 in wild‐type or RKR mutant plants.
Figure S5: RKR1 mediates recognition of different RLK6 orthologs. (A) ROS accumulation induced by PsRLK6ECD homologues are dependent on RKR1 in planta. FLAG‐tagged RKR1 or RKR2 were co‐expressed with HA‐tagged GFP or PsRLK6ECD in N. benthamiana. (B) RKR1 interacts with PsRLK6ECD orthologs in planta. FLAG‐tagged RKR1 was co‐expressed with HA‐tagged GFP or PsRLK6ECD in N. benthamiana. The data are presented as mean ± SD (n = 6).
Figure S6: AlphaFold3‐predicted complexes between PsRLK6 immunogenic epitope and PRRs. (A, B) Predicted complex of NbRKR1 (grey) or NbRKR2 (yellow) with PsRLK6IE (cyan).
Figure S7: GmRLP30 regulates the recognition of PsRLK6ECD. (A) Sanger sequencing of the junction regions confirmed that gmrlp30 were mutated. (B) PsRLK6ECD triggered ROS burst in wild‐type or gmrlp30 mutant plants. Accumulation of relative light units (RLU) in 70 min was calculated for soybean treated with PsRLK6ECD. The data are presented as mean ± SD (n = 8). Statistical analysis was performed using Student's t test. (C) PsRLK6ECD‐induced up‐regulation of the PTI marker gene PR1 requires GmRLP30 gene in soybean. The data are presented as mean ± SD (n = 3). (D) Representative leaves showing the disease symptoms of indicated gmrlp30 mutants and WT treated by GFP control or PsRLK6ECD protein in soybean leaves upon infection with P. sojae. Biomass of P. sojae infection with different treatments were measured. The data are presented as mean ± SD (n = 3).
Figure S8: Sequence alignment of RKR1, RKR2, CaRKR1, and GmRLP30.
Figure S9: A schematic diagram of the mode of cell communication between plants and Phytophthora membrane receptors. Phytophthora‐derived membrane receptor RLK6 promotes oomycete sexual development under normal conditions. During plant–pathogen interaction, RLK6 is likely cleaved to release its extracellular domain (RLK6ECD), which enters the plant apoplast and functions as an immunogenic ligand. In Nicotiana benthamiana, RLK6ECD is perceived by the LRR‐RLP receptors RKR1 and RKR2; in soybean, the structurally distinct but functionally equivalent receptor GmRLP30 fulfils this role. Despite lacking sequence homology, these plant receptors directly bind PsRLK6ECD and recruit the conserved co‐receptors BAK1 and SOBIR1 to initiate pattern‐triggered immunity (PTI). This model highlights a rare example of membrane receptor–mediated cross‐kingdom signalling between pathogen and host, revealing a unique mechanism of extracellular communication through receptor–receptor recognition.
Data Availability Statement
The data that supports the findings of this study is available in the Supporting Information of this article.
