Skip to main content
BMC Veterinary Research logoLink to BMC Veterinary Research
. 2026 Jan 16;22:139. doi: 10.1186/s12917-025-05264-z

Effect of the antimicrobial peptide BmKn2-7 in inhibiting Vibrio parahaemolyticus and its role in improving microbiota, immunity and Vibrio resistance in Litopenaeus vannamei

Qihang Liang 1,2,#, Qi Wang 1,2,#, Pinqi Chi 1,2, Depeng Fan 3, Beiping Tan 1,2, Shiwei Xie 1,2, Junming Deng 1,2, Hongyu Liu 1,2,, Ling Zeng 4,
PMCID: PMC12947397  PMID: 41540432

Abstract

Antimicrobial peptide BmKn2-7, a rationally optimized derivative of the scorpion venom peptide BmKn2, shows strong potential as an antibiotic alternative for controlling Vibrio parahaemolyticus in aquaculture. This study evaluated its antibacterial mechanisms and in vivo efficacy in Litopenaeus vannamei through biochemical assays, transcriptomic profiling, and challenge experiments. BmKn2-7 exhibited potent in-vitro activity (MIC = 125 µg/mL) and disrupted bacterial homeostasis by increasing membrane permeability, inducing oxidative stress, and inhibiting P-type ATPase. RNA-seq analysis revealed extensive transcriptional reprogramming, including the downregulation of quorum-sensing, virulence, and β-lactam resistance–associated genes. In vivo, BmKn2-7 significantly improved shrimp survival following V. parahaemolyticus infection and selectively reduced Vibrio abundance in the gut without compromising overall microbiota diversity. Together, these findings demonstrate that BmKn2-7 acts through complementary bactericidal and anti-virulence pathways while promoting intestinal microbial resilience, supporting its potential as a promising antimicrobial candidate for reducing vibriosis risk in shrimp aquaculture.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-025-05264-z.

Keywords: Antimicrobial peptide, Litopenaeus vannamei, Vibrio parahaemolyticus, Antibacterial effect

Introduction

Since the 21st century, the shrimp aquaculture industry in China has entered a new stage; with the expansion of the aquaculture scale, the aquaculture mode gradually tends to intensification [1]. However, the increasing aquaculture density and irrational feeding of diets have led to the accumulation of feed residues in the water system, resulting in deterioration of water quality and proliferation of pathogenic micro-organisms, and ultimately frequent occurrence of aquatic animal diseases [2]. Therefore, antibiotics are widely used in aquaculture for preventive and curative purposes to reduce economic losses [3]. However, the abuse of antibiotics has led to the emergence of drug-resistant strains of bacteria and drug residue problems [4]. Therefore, it’s particularly urgent to search for alternative antibiotic products with antimicrobial activity. Currently, antibiotic alternatives in aquatic feed mainly include microecological preparations, oligosaccharides, antimicrobial peptides (AMPs), enzymes, and a series of other active substances [57]. Among these antibiotic alternatives, AMPs, as natural components of the innate immune system, are widely present in the biological world and have significant inhibitory and killing effects on pathogenic microorganisms and even tumour cells [8]. Compared to probiotics that require strict storage conditions, AMPs offer superior stability in aquatic feed and rapid bactericidal action [9]. For instance, Rashidian et al. have indicated that dietary addition of 50 µg/g of AMP (CM11) remarkably upregulates the expression of antioxidant and immune genes in zebrafish (Danio rerio) liver [10]. Similarly, Liu et al. have demonstrated that dietary AMPs at 400–800 mg/kg enhance intestinal morphology, increase microbiota diversity, and enrich probiotic populations in grass carp (Ctenopharyngodon idellus) [11]. Previous studies have also revealed that AMPs at 400–800 mg/kg substantially improve the disease resistance of crucian carp (Carassius auratus var. Pengze) against Aeromonas hydrophila infection [12]. Cheng et al. have demonstrated that fermented soybean -AMP exerts in-vitro bactericidal activity by disrupting cell membrane integrity in Vibrio parahaemolyticus (V. parahaemolyticus); dietary supplementation at 62.5 µg/g could significantly improve the survival rate of Litopenaeus vannamei (L. vannamei) during V. parahaemolyticus infection [13, 14]. Their studies further reveal that 62.5 µg/g AMP supplementation enhances beneficial gut bacteria, suppresses pathogenic Vibrio and Flavobacterium populations, and improves microbial diversity in L. vannamei. Additionally, Gyan et al. have demonstrated that incorporating 0.4% AMPs into L. vannamei diets could markedly improve growth metrics, enhance antioxidant defenses, and stimulate innate immunity [15].

Among various AMPs, the bioactive peptide components found in scorpion venom exhibit remarkable molecular diversity, providing substantial potential for pharmacological development of therapeutic agent discovery and optimization [16, 17]. Currently, a spectrum of bioactive AMPs in scorpion venoms have been identified, including hadrurin, IsCT, scorpine, and StCT1, reflecting dual functional modalities of these natural compounds [1821]. BmKn2, an AMP derived from the venom of the scorpion Mesobuthus martensii Karsch, has been engineered into the variant BmKn2-7, which exhibits enhanced antibacterial efficacy and reduced hemolytic toxicity [22, 23]. Structural optimization of BmKn2-7, achieved through augmented positive charge density and preservation of its amphipathic α-helical conformation, achieves a balance between enhanced antimicrobial activity (particularly against drug-resistant strains) and reduced hemolytic toxicity [22]. Despite the great potential of BmKn2-7, its application in aquaculture remains underexplored. L. vannamei, one of the most extensively farmed shrimp species worldwide, is prized for its adaptability, disease resistance, and rapid growth [24]. However, V. parahaemolyticus, a Gram-negative pathogen prevalent in marine environments, poses a critical threat to L. vannamei aquaculture. This bacterium causes shell erosion, gastrointestinal vacuolization, and acute hepatopancreatic necrosis syndrome (AHPNS) in aquatic species (including fish, mollusks, and crustaceans) [25]. These findings collectively highlight the potential of scorpion venom-derived AMPs, especially BmKn2-7, as targeted therapeutic strategies against V. parahaemolyticus in shrimp aquaculture. However, in the process of translating this potential into practical applications, it’s necessary to mechanistically understand the anti-Vibrio activity of BmKn2-7 in complex host-pathogen interactions.

Although the antibacterial activity of BmKn2-7 against model organisms (e.g., S. aureus) through bacterial cell wall disruption has been fully documented, its mode of action against Vibrio pathogens and its in-vivo efficacy in crustaceans remain unexplored [22]. To address these knowledge gaps, this study elucidated BmKn2-7’s anti-Vibrio mechanisms in L. vannamei by integrating transcriptomic, biochemical, and challenge assays, aiming to lay a theoretical foundation for controlling V. parahaemolyticus in shrimp aquaculture.

Materials and methods

Materials

The BmKn2-7 peptides (FIKRIARLLRKIF-NH2) were commercially synthesized through solid-phase methodology with C-terminal amination modification (Sangon Biotech Co., Ltd., Shanghai). Peptide purity (> 98%) was determined by reversed-phase high-performance liquid chromatography (RP-HPLC) using a C18 analytical column (5 μm, 4.6 × 250 mm) with UV detection at 220 nm. Separation was achieved at a flow rate of 1.0 mL/min through a linear gradient of 0.1% trifluoroacetic acid in water/acetonitrile (10–90% acetonitrile over 30 min). All lyophilized peptides were stored at -80 °C to maintain stability prior to experimental use. V. parahaemolyticus (GDMCC 1.306) was purchased from Guangdong Microbial Culture Collection Centre (GDMCC). 2216E liquid medium was purchased from Qingdao Hope Bio-Technology Co., Ltd. Reactive Oxygen Species Assay Kit, N-phenylnaphthalen-1-amine (NPN), Propidium iodide (PI) and 3,3’-Dipropylthiadicarbocyanine iodide (DiSC3 (5)) were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. Alkaline phosphatase and adenosine triphosphatase were assayed using commercial kits (Nanjing Jiancheng Biological Engineering Institute, China).

MIC assay of the BmKn2-7

The broth microdilution method was used to determine the MIC of the BmKn2-7 [26]. The same volumes (10 µL) of bacteria (5 × 108 CFU/mL in 2216E medium) were added to 96well plates and 100 µl of BmKn2-7 (3.91, 7.81, 15.63, 31.25, 62.5, 125, 250, 500, and 1000 µg/ml) were added to each respective triplicate wells. Control wells were filled with 100 µl of PBS. The capped plate was shaken for 5 min at ambient temperature under the hood, then the plates were incubated for 32 h at 30℃, OD values were measured every four hours. The lowest concentration of BmKn2-7 without visible growth of test organisms was defined as the MIC.

Electron microscopy analysis

Logarithmic-phase bacterial cultures (2 mL) were centrifuged, and the supernatant was discarded. The bacterial pellets were then subjected to different treatments: the experimental group was exposed to 2 mL of 125 µg/mL BmKn2-7, and the control group was treated with an equivalent volume of sterile PBS. After 24 h of incubation at 37 °C, the samples were centrifuged and implemented three washing cycles with sterile PBS. Fixation was carried out using 2.5% glutaraldehyde (2 mL) at 4 °C for 12 h. The fixed samples were subsequently submitted to Bolf Biotechnology Co., Ltd. (Wuhan, China) for observation via scanning and transmission electron microscopy.

Outer membrane permeation test

Bacterial outer membrane permeability was determined by measuring the uptake of NPN. V. parahaemolyticus cells were grown overnight in 2216E medium, collected by centrifugation, and resuspended in PBS to an OD600 of 0.5. Aliquots of this suspension were supplemented with 40 µM/L NPN and different concentrations of BmKn2-7, with a sterile PBS group serving as the control. The mixtures were incubated at 37 °C for 6 h, after which fluorescence was recorded at an emission wavelength of 420 nm (excitation at 350 nm) on an MD SpectraMax i3x multifunctional microplate reader.

Inner membrane permeability test

The permeability of the bacterial inner membrane was assessed by monitoring the fluorescence of propidium iodide (PI). Briefly, V. parahaemolyticus was cultured for 24 h, centrifuged, and the pellet was washed and resuspended in PBS to an OD600 of 0.5. The bacterial suspension was exposed to 40 µM PI along with a range of BmKn2-7 concentrations, with a sterile PBS control. After 6 h of incubation at 37 °C, the fluorescence was quantified (λex/λem = 535/617 nm) with an MD SpectraMax i3x multifunctional microplate reader.

Cytoplasmic membrane depolarisation test

Changes in the cytoplasmic membrane potential were monitored using the fluorescent probe DISC3(5). Bacterial cells were cultured for 24 h, collected by centrifugation, washed, and adjusted to an OD600 of 0.5 with PBS. The bacterial suspension was first loaded with 20 µM DISC3(5) by incubating for 10 h at 37 °C in the dark. The dye-loaded cells were then treated with different concentrations of BmKn2-7 (sterile PBS as control). Following a 6-h incubation at 37 °C, the fluorescence intensity was quantified at an excitation of 622 nm and an emission of 670 nm on an MD SpectraMax i3x instrument.

Determination of reactive oxygen species (ROS)

The generation of reactive oxygen species (ROS) in bacterial cells was measured with a commercial assay kit employing the fluorescent probe DCFH-DA. V. parahaemolyticus cells were harvested after 24 h of culture, washed, and adjusted to OD600 0.5 with PBS. The bacterial suspensions were then incubated with BmKn2-7 or sterile PBS (control) for 6 h at 37 °C. Subsequently, 10 µM DCFH-DA was added to the samples. The fluorescence intensity was recorded at 525 nm emission upon 488 nm excitation using an MD SpectraMax i3x instrument.

The activities of P-type ATPase

Following a 24-h culture, V. parahaemolyticus cells were collected, washed with PBS, and adjusted to an OD600 of 0.5. The suspensions were incubated with different concentrations of BmKn2-7 at 37 °C for 6 h. The activity of P-type ATPase was then determined according to the manufacturer’s instructions of the assay kit (Nanjing Jiancheng Bioengineering Institute, China).

RNA isolation and sequencing

V. parahaemolyticus was cultured in 2216E medium at 37 °C for 24 h. The cultures were prepared in triplicate and subsequently centrifuged. After removing the supernatant, the bacterial pellets were collected for subsequent experiments. The harvested bacteria were divided into two experimental groups: NS group: Resuspended in phosphate-buffered saline (PBS); AMP group: Treated with BmKn2-7 (dissolved in PBS at 125 µg/mL) Both groups were incubated at 37 °C for 6 h, followed by centrifugation to remove the supernatant. The resulting bacterial pellets were immediately flash-frozen in liquid nitrogen for subsequent analysis. Subsequently, the cell samples were subjected to RNA-seq global transcriptomic analysis by Shanghai Majorbio Bio-pharm Technology Co., Ltd. The data were analyzed via the online Majorbio I-Sanger Cloud Platform (https://cloud.majorbio.com). To ensure the quality of sequencing data, SeqPrep (https://github.com/jstjohn/SeqPrep) and Sickle (https://github.com/najoshi/Sickle) with the default settings were used to filter raw data. The genome of V. parahaemolyticus ATCC 17,802 was used as a reference, and the cleaned reads were aligned to the reference transcriptome using Bowtie 2 (http://bowtie-bio.sourceforge. net/index.shtml). To identify the differentially expressed genes (DEGs) between the samples, gene level transcripts per million reads (TPM) were generated using RSEM (http://deweylab.github.io/RSEM) and DEGs were screened by DESeq2 (http://bioconductor.org/packages/stats/bioc/DESeq2) with |log2FC| ≥1.0 and p-adjust < 0.05. Then DEGs were further subjected to function annotation and pathway enrichment analysis by hypergeometric distribution testing ‘using Gene Ontology (GO) (http://www.geneontology.org/) and Kyoto Encyclopedia of Genes and Genomes (KEGG) (http://www.genome.jp/kegg/).

Validation of RNA-seq data by qRT-PCR

To validate the transcriptomic profiling data obtained from V. parahaemolyticus, qRT-PCR analysis was performed on the same RNA samples previously utilized for RNA sequencing. Ten differentially expressed genes (DEGs) associated with antioxidant defense and innate immunity were selected for verification based on systematic screening of RNA-Seq results (|log2FC| ≥1.0, adjusted p < 0.05). Primers were designed using genomic sequences from V. parahaemolyticus (RefSeq accession numbers: NC_004603.1, NC_004605.1; GenBank accession: BA000032.2). For genes on the complementary strand (e.g., nrfC), primer sequences were reverse-complemented to match the coding strand.

Gene-specific primers (Table 1) were commercially synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). qRT-PCR assays were conducted using an Applied Biosystems 7500 Real-Time PCR System (Life Technologies, USA) with the SYBR® Premix Ex Taq™ kit (Takara, Japan). The thermal cycling protocol comprised an initial denaturation at 95 °C for 2 min, followed by 40 cycles of 95 °C for 10 s and 72 °C for 20 s. Relative gene expression levels were quantified using the 2 − ΔΔCT method [27].

Table 1.

The primers for the detection of V. parahaemolyticus

Gene name Sequence (5′–3′) F Sequence (5′–3′) R Accession Number
Control TATCCTTGTTTGCCAGCGAG CTACGACGCACTTTTTGGGA BA000032.2 (134038.134223)
aceB AAAGGCACAGGTTGTGTGGA TTGTCTTCGCTACACGCCAT NC_004605.1 (202422.203000)
nrfC GCATGCTTCAGTACACGCAG ATTTTGACCACTGGCGTTGC NC_004603.1 (2012308.2012994, complement)
artP GCGATTGCTCGTGCATTGAT ATGCGTCACTACGACTTGGG NC_004605.1 (642527.643255)
puuA CCATTTGGTGAACAAGCGGG AGAAGGGGCTAGGTTGACCA NC_004603.1 (1896179.1897522)
mcp AGATGCGTACCGCGATCTTT TTTTTCCATACGCGGCAACG NC_004603.1 (1144081.1145718)
napB TCAACTGGAAGACACTCGCC ATGTGGAATCAACGGTGGCT NC_004605.1 (1274345.1274800)
fdhD TCAAGTTGTGCCGAGAGGAC TCGAACGGCTTTGTGGATCA NC_004605.1 (1004358.1005188)
cyoC AGTGCGTTCCTATCGGCATT TCGCCATGTTGTCGTTCAGA NC_004605.1 (635843.636445)
napC CTGTTTTGGGGCGCATTCAA CGAACGCCTGAACGGTTAGA NC_004605.1 (1274829.1275407)
curA TGTCGCTACGCAAAAGAGGT ACATCGATGCCGTTGTAGCA NC_004605.1 (1488287.1489321)

The Accession Numbers in Table 1 include both GenBank (BA_) and RefSeq (NC_) identifiers. GenBank entries were used for genes lacking RefSeq annotations, while RefSeq entries were prioritized for genes with standardized records

Challenge test

The challenge test was conducted at the Marine Biology Research Base of Guangdong Ocean University (Zhanjiang, China). Healthy L. vannamei shrimp (7.00 ± 0.50 g) were purchased from Zhanjiang Hisenor Marine Biotechnology Co., Ltd. V. parahaemolyticus (GDMCC 1.306) was cultured in 2216E medium at 37 °C for 24 h, harvested by centrifugation (8,000 ×g, 10 min, 4 °C), and adjusted to 5 × 10⁶ CFU/mL in PBS (a concentration determined through preliminary challenge tests) using plate counting. Shrimp were divided into three groups (n = 30 per replicate, triplicates): Control group (CG): 100 µL sterile saline; Infection control group (VP): 50 µL V. parahaemolyticus suspension (5 × 10⁶ CFU/mL), followed by 50 µL saline at 2 h post-injection; Treatment group (AMP): 50 µL V. parahaemolyticus suspension, followed by 50 µL BmKn2-7 (125 µg/mL in PBS) at 2 h post-injection. Injections were administered into the dorsal sinus using a sterile syringe. Mortality was recorded every 24 h for 7 days, with death defined as the absence of appendage movement.

Sampling collection

At the end of the experiment, three shrimp intestines were randomly obtained from each bucket and stored at -80 °C for intestinal flora analysis. Additionally, three shrimp hepatopancreases were collected from each replicate and preserved in 1.5 mL RNA Later solution in enzyme-free centrifuge tubes for gene expression analysis.

Intestinal microbiota analysis

Detection of the gut microbiota was accomplished using microbial high-throughput sequencing technology, which was facilitated by Gene Denovo Biotechnology Co., Ltd (Guangzhou, China) Microbial DNA was collected using HiPure Soil DNA Extraction Kit (Guangzhou Maihe Biotechnology Co., Ltd.). Bacterial 16 S rRNA gene fragments in the V3-V4 region were amplified using the universal primers for 16 S rRNA gene fragments (341 F: CCTACGGGGNGGCWGCAG; 806R: GGACTACHVGGGGGTATCTAAT). The 16 S rDNA target region of the ribosomal RNA gene were amplified by PCR(95 °C for 5 min, followed by 30 cycles at 95 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min and a final extension at 72 °C for 7 min). 50 µL mixture containing 10 µL of 5 × Q5@ Reaction Buffer, 10 µL of 5 × Q5@ High GC Enhancer, 1.5 µL of 2.5 mM dNTPs, 1.5 µL of each primer (10 µM), 0.2 µL of Q5@ High-Fidelity DNA Polymerase, and 50 ng of template DNA. Related PCR reagents were from New England Biolabs, USA. Amplicons were evaluated with 2% agarose gels and purified using the AMPure XP Beads (Beckman, CA, USA) according to the manufacturer’s instructions. Sequencing libraries were generated using Illumina DNA Prep Kit (Illumina, CA, USA) following manufacturer’s recommendation. The library quality was assessed with ABI StepOnePlus Real-Time PCR System (Life Technologies, Foster City, USA). At the end 2 × 250 bp paired-end reads were generated by sequencing on the Novaseq 6000 platform.

Immune-related and apoptotic genes of L. vannamei

Total RNA was isolated from experimental samples using the BioRNA Extraction System (Accurate Biotech, Hunan, China). RNA purity and concentration were determined spectrophotometrically (Nanodrop2000, Thermo Fisher Scientific, USA), with integrity verification via 1% agarose gel electrophoresis. First-strand cDNA synthesis was performed using the Evo M-MLV Reverse Transcriptase Kit (Accurate Biotech) following genomic DNA elimination. Gene-specific primers (Table 2) were commercially synthesized by Sangon Biotech (Shanghai, China). Quantitative real-time PCR (qPCR) was conducted in 10 µL reaction volumes containing: 5 µL SYBR® Green Pro Taq HS Premix (Accurate Biotech), 1 µL cDNA template, 0.5 µL each of forward and reverse primers (10 µM), and 3 µL nuclease-free water. Amplification cycles on a real-time PCR instrument comprised: 1: Initial denaturation at 95 °C for 30 s; 2: 40 cycles of 95 °C for 5 s (denaturation) and 60 °C for 30 s (annealing/extension); 3: Melt curve analysis from 95 °C to 65 °C with 0.5 °C/sec increments; 4: Final cooling to 4 °C. Relative gene expression levels were calculated using the comparative threshold cycle (2−ΔΔCT) method.

Table 2.

The primers for the detection of L. vannamei

Genes Forward (5’-3’) Reverse (5’-3’) GenBank no. Function
β-actin TGGACTTCGAGCAGGAGATG GGAATGAGGGCTGGAACAGG XM_027364954.1 Housekeeping
TNF-α CTCAGCCATCTCCTTCTTG TGTTCTCCTCGTTCTTCAC XM_027368774.1 Immunity
IL-1β TGTGACCACCATCCACCAGAAC GATCCCGCAGTAACCGAATAAG Designed by author Immunity
Cyt-c AGGGAAAGAAGCTGTTCGTG CAGTCGCTTGTGCCAGTTCC KF601549.1 Apoptosis
Bax GGTGGAATCACAAGAGAGCGA TGTTCTCCACGGTGTCTCAC XM_027383277.1 Apoptosis
Bcl-2 CCTTGCTTGACACAGTCGGA CAGACAAGGTCGTGAGGTGG XM_070143368.1 Apoptosis
Caspase3 ACATTTCTGGGCGGAACACC GTGACACCCGTGCTTGTACA KC660103.1 Apoptosis
P53 CGAATCCCCACATCCACG GGCGGCTGATACACCACC KX179650.1 Apoptosis

Statistical analysis

The experimental data were expressed as “mean ± standard error of the mean” (Mean ± SEM) and statistically analysed using SPSS 23.0 software. Data were analysed statistically by one-way variance followed by Tukey’s test. Intestinal flora and transcriptome analyses were performed on the Omicsmart dynamic online analysis platform (http://www.omicsmart.com). Challenge test cumulative survival was inspected on Graphpad prism software (version 10.1.2) using the Gehan Breslow-Wilcoxon method.

Result

Antibacterial

The MIC of BmKn2-7

The antimicrobial activity of BmKn2-7 against V. parahaemolyticus was quantified using the microdilution method. Following static incubation (37℃, 24 h), the MIC of BmKn2-7 was determined to be 125 µg/mL (Table 3), and consistent results were obtained from triplicate independent experiments.

Table 3.

OD600 of V. parahaemolyticus under different concentrations of antimicrobial peptide treatments

Concentration 0 h OD600 4 h OD600 8 h OD600 12 h OD600 16 h OD600 20 h OD600 24 h OD600 28 h OD600 32 h OD600
CON 0.047 ± 0.002 0.061 ± 0.005 0.340 ± 0.013 0.729 ± 0.006 0.747 ± 0.020 0.786 ± 0.034 0.693 ± 0.075 0.623 ± 0.095 0.656 ± 0.057
1000 µg/mL 0.083 ± 0.012 0.083 ± 0.006 0.089 ± 0.010 0.085 ± 0.007 0.084 ± 0.014 0.092 ± 0.015 0.077 ± 0.008 0.081 ± 0.002 0.083 ± 0.011
500 µg/mL 0.080 ± 0.004 0.064 ± 0.006 0.062 ± 0.000 0.060 ± 0.011 0.059 ± 0.004 0.061 ± 0.007 0.062 ± 0.013 0.058 ± 0.005 0.058 ± 0.001
250 µg/mL 0.065 ± 0.004 0.053 ± 0.000 0.057 ± 0.010 0.057 ± 0.002 0.053 ± 0.003 0.054 ± 0.004 0.053 ± 0.011 0.051 ± 0.007 0.051 ± 0.008
125 µg/mL 0.051 ± 0.001 0.048 ± 0.009 0.049 ± 0.003 0.051 ± 0.006 0.054 ± 0.008 0.052 ± 0.003 0.055 ± 0.001 0.056 ± 0.000 0.053 ± 0.002
62.5 µg/mL 0.048 ± 0.004 0.048 ± 0.003 0.124 ± 0.015 0.296 ± 0.023 0.458 ± 0.045 0.525 ± 0.064 0.491 ± 0.071 0.530 ± 0.036 0.560 ± 0.068
31.25 µg/mL 0.046 ± 0.002 0.049 ± 0.006 0.205 ± 0.024 0.336 ± 0.047 0.496 ± 0.013 0.515 ± 0.054 0.502 ± 0.035 0.551 ± 0.018 0.590 ± 0.096
15.63 µg/mL 0.047 ± 0.005 0.050 ± 0.009 0.252 ± 0.037 0.421 ± 0.028 0.511 ± 0.068 0.543 ± 0.066 0.545 ± 0.025 0.619 ± 0.031 0.641 ± 0.072
7.81 µg/mL 0.046 ± 0.007 0.052 ± 0.004 0.255 ± 0.017 0.490 ± 0.037 0.563 ± 0.049 0.585 ± 0.079 0.597 ± 0.017 0.690 ± 0.048 0.696 ± 0.011
3.91 µg/mL 0.047 ± 0.005 0.056 ± 0.004 0.282 ± 0.024 0.628 ± 0.058 0.603 ± 0.022 0.63 ± 0.072 0.638 ± 0.061 0.670 ± 0.014 0.682 ± 0.045

Experimental data was presented as mean ± SEM·(n = 3)

Effects of BmKn2-7 on the morphology of V. parahaemolyticus

A scanning electron microscope (SEM) was used to observe V. parahaemolyticus to investigate the effect of BmKn2-7 on the morphology of V. parahaemolyticus after AMP treatment. As evident in Fig. 1, V. parahaemolyticus in the blank NS group showed intact morphology. After treatment with 125 µg/mL of BmKn2-7, V. parahaemolyticus’s surface appeared wrinkled and collapsed, compared with the blank group (Fig. 1A-B). Additionally, the changes in bacterial ultrastructure after treatment with 125 µg/mL of BmKn2-7 were also explored using a transmission electron microscope (TEM). It was found that V. parahaemolyticus in the control group showed structurally intact cell membrane and full and dense intracellular material (Fig. 1C). On the contrary, after treatment with 125 µg/mL of BmKn2-7, intracellular cavitation, loose cytoplasmic distribution, cell membrane lysis, rupture, and leakage of contents were observed (Fig. 1D). The results of SEM and TEM both suggested that BmKn2-7 has a potential to disturb the biofilm formation of V. parahaemolyticus.

Fig. 1.

Fig. 1

Effects of BmKn2-7 on the morphology of V. parahaemolyticus A-B: Morphology of V. parahaemolyticus under SEM observation, magnification 20,000x, scale length 2.00 microns; A: Control group; B: 125 µg/mL group; C-D: Morphology of V. parahaemolyticus observed by TEM, magnification 2,000x, scale length 5.00 microns; C: Control group; D: 125 µg/mL group

Effects of BmKn2-7 on the outer membrane permeability of V. parahaemolyticus

As shown in Fig. 2A, after treatment of different concentrations of BmKn2-7 in V. parahaemolyticus, the fluorescence intensity of NPN was increased in a concentration-dependent manner.

Fig. 2.

Fig. 2

BmKn2-7 exerts multi-mechanistic antibacterial effects on V. parahaemolyticus A: Effects of BmKn2-7 on the outer membrane permeability of V. parahaemolyticus; B: Effects of BmKn2-7 on the inner membrane permeability of V. parahaemolyticus; C: Cytoplasmic membrane depolarization of V. parahaemolyticus; D: Effects of BmKn2-7 on cellular ROS production; E: Effects of BmKn2-7 on ATPase activity of V. parahaemolyticus

Effects of BmKn2-7 on the inner membrane permeability of V. parahaemolyticus

As indicated in Fig. 2B, after treatment of different concentrations of BmKn2-7 in V. parahaemolyticus, the fluorescence intensity of PI was increased in a concentration-dependent manner.

Cytoplasmic membrane depolarization of V. parahaemolyticus caused by BmKn2-7

As observed from Fig. 2C, after treatment of different concentrations of BmKn2-7 in V. parahaemolyticus, the fluorescence intensity of DiSC3(5) was increased in a concentration-dependent manner. This suggested that BmKn2-7 had a strong cytoplasmic membrane depolarization ability. Taken together, the above results (3.1.2–3.1.5 sections) indicated that BmKn2-7 disrupted the integrity of the bacterial outer/inner membrane in a concentration-dependent manner, leading to cell membrane depolarization and subsequent leakage of intracellular material.

Effects of BmKn2-7 on cellular ROS production of V. parahaemolyticus

The effects of BmKn2-7 on the cellular ROS production of V. parahaemolyticus were investigated. According to the results (Fig. 2D), after treatment of different concentrations of BmKn2-7 in V. parahaemolyticus, the fluorescence intensity of DCF was increased in a concentration-dependent manner, and the fluorescence intensity of DCF can reflect the ROS level. Hence, these results indicated that BmKn2-7 can induce the generation of ROS in a concentration-dependent manner, and high levels of ROS further promoted V. parahaemolyticus death.

Effects of BmKn2-7 on P-type ATPase activity of V. parahaemolyticus

The effects of BmKn2-7 on P-type ATPase activity of V. parahaemolyticus were further analyzed. ATPase activity was measured to assess the impact of BmKn2-7 on bacterial energy metabolism. As indicated by the results (Fig. 2E), treatment with different concentrations of BmKn2-7 for 6 h resulted in a concentration-dependent decrease in enzymatic activity, demonstrating that BmKn2-7 disrupted energy metabolism in V. parahaemolyticus.

V. parahaemolyticus transcriptome analysis

Sequencing data quality assessment

The transcriptome changes converted by BmKn2-7 in V. parahaemolyticus were investigated via RNA-sequencing (RNA-seq) analysis. The sequencing of the V. parahaemolyticus generated 152,087,018 raw reads. After filtering of sequencing contamination, adapters, and low-quality raw reads, a total of 150,543,648 (98.99%) clean high-quality reads were obtained. The average value of Q30% and Q20% of the clean reads was 96.31% and 98.81%, respectively. Based on the statistical results, it was found that transcriptome sequencing data had good sequencing quality, low error rate, high match rate, and high base quality.

Functional annotation

Regarding annotation, the unigenes were compared with databases (such as NR, Swiss-Prot, Pfam, COG, GO, and KEGG) to comprehensively obtain the functional information of genes and to provide statistics on the annotation of each database. Among them, there were 5038 (99.92%) in NR, 3444 (68.31%) in Swiss-Prot, 4055 (80.42%) in COG, 3250 (64.46%) in GO, and 2739 (54.32%) in the KEGG database (Fig. S1).

Gene ontology (GO) can help us understand the gene products and functional properties of genes in V. parahaemolyticus. A total of 9320 unigenes were divide into 20 subcategories of 3 main categories: biological process (BP), molecular function (MF), and cellular component (CC) (Fig. S2). Among the sub-category of BP, cellular process had the highest value (1462, 42.17%), followed by metabolic process (1269, 36.60%). With regard to CC subcategory, cellular anatomical entity was the dominant group (1704, 89.07%). In the category of MF, the dominant groups were catalytic activity (1759, 43.94%) and binding (1400, 34.97%). Additionally, according to the COG annotation results, a total of 3840 unigenes were classified into 24 COG types (Fig. S3). Among them, the cluster of Amino acid transport and metabolism (E) was the representative of the largest group, followed by Signal transduction mechanisms (T), Transcription (K), Translation, ribosomal structure, and biogenesis (J).

Analysis of differentially expressed gene profiles

As shown in Fig. 3A, there were 4411 co-expressed genes between the NS group and AMP group, with 29 unique genes in the NS group and 61 unique genes in the AMP group. Principal component analysis (PCA) results demonstrated separation of the transcriptomes of different groups, with 32.82% and 23.82% variation in PC1 and PC2, respectively (Fig. 3B). A total of 219 DEGs were found in the NS group Compared with the AMP group, including118 upregulated genes and 101 downregulated genes (Fig. 3C).

Fig. 3.

Fig. 3

A: Venn diagram of differentially expressed genes; B: PCA analysis; C: Volcano map of differentially expressed genes

In this study, the characteristics of gene products were expressed using GO enrichment analysis that involved BP, MF, and CC. The histogram shows the secondary classification of GO annotation analysis of DEGs. As displayed by Fig. 4A, most of the DEGs mapped to the GO database belonged to BP, with organic acid catabolic process, carboxylic acid catabolic process, and alpha-amino acid catabolic process being the dominant terms. Regarding CC, Respirasome was the dominant category. As for MF, the highest value was oxidoreductase activity.

Fig. 4.

Fig. 4

A: GO enrichment analysis of DEGs; B: KEGG enrichment analysis of DEGs

Based on the detected DEGs, the changes in functional pathway were investigated through Kyoto Encyclopaedia of Genes and Genomes (KEGG) enrichment analysis (Fig. 4B). KEGG enrichment analysis helps to further understand the biological functions of genes. The number of DEGs in different KEGG terms was statistically analyzed; KEGG was mainly divided into four categories: environmental information processing, metabolism, cellular processes, and human diseases. DEGs were classified into four categories, most of which belong to the metabolism category. Regarding the environmental information processing category, the dominant subcategory was ABC transporters. The dominant subcategories in metabolism were TCA cycle, caprolactam degradation, and tryptophan metabolism. The dominant subcategory in cellular processes was quorum sensing. As for human diseases, the dominant subcategories were beta-Lactam resistance and insulin resistance. iPath2.0 was used to visualize metabolic pathways, which helped us understand the alteration of V. parahaemolyticus caused by BmKn2-7. As shown in Fig. 5, treatment of BmKn2-7 activated amino sugar and nucleotide sugar metabolism, glyoxylate and dicarboxylate metabolism, starch and sucrose metabolism, valine, leucine, and isoleucine biosynthesis, while inhibiting arginine and proline metabolism, butanoate metabolism, oxidative phosphorylation, photosynthesis, and porphyrin metabolism. The results of iPath were consistent with KEGG enrichment analysis results.

Fig. 5.

Fig. 5

Metabolic pathway alterations in V. parahaemolyticus by BmKn2-7 treatment visualized by iPath2.0

In addition, it was found that under the treatment of BmKn2-7, putA and putP were downregulated, which is required for virulence. The gene of periplasmic oligopeptide-binding protein (oppA) was downregulated, which is associated with bacterial quorum sensing; and other genes of oligopeptide permease ABC transport operon (oppC, oppD, and oppF) were also downregulated, indicating a close link to the nutrient acquisition of bacteria. The expression of thermotolerant direct hemolysin (tdh) was inhibited after the treatment of BmKn2-7. We noticed that tctA and tctC were downregulated by BmKn2-7, and the regulation of these two genes inhibited the two-component system. These results suggested that BmKn2-7 may alleviate the toxicity of V. parahaemolyticus by regulating these genes (Supplementary Material 3).

Validation of transcriptome by quantitative real-time polymerase chain reaction (qRT-PCR)

Subsequently, 10 metabolism-related DEGs were selected to validate the transcriptome to identify and verify the transcriptome expression profile. As shown in Fig. 6, consistent expression trends identified across both RNA-seq and qRT-PCR analyses further corroborated the robustness of transcriptomic data. Specifically, the expression of nitrate reductase genes (napB and napC) was downregulated by BmKn2-7, indicating that the metabolism of V. parahaemolyticus was disrupted.

Fig. 6.

Fig. 6

Comparison of the expression of RNA-Seq and qRT-PCR verification

Challenge test

The cumulative survival rates in different treatment groups after the challenge test of V. parahaemolyticus were summarized in Fig. S4. Among these groups, the CG group showed the highest cumulative survival rate, and no shrimp mortality was observed. On the contrary, the VP group (intraperitoneal injection of 50 µL V. parahaemolyticus) exhibited the lowest cumulative survival rate, which was significantly lower than that of the CG group (P < 0.001). The cumulative survival rate of the AMP group was higher than that of the VP group (P < 0.05) and lower than that of the CG group (P < 0.05).

Intestinal microbiota analysis

Sequencing data quality assessment

The data preprocessing statistics and QC results were presented in Table S1 (Supplementary material 1). The average optimized sequences obtained (Clean Reads) in the three groups were 70,900 in the NS group, 61,043 in the VP group, and 100,451 in the AMP group. Additionally, regarding the average number of effective sequences obtained in the three groups, there was 64,450 in the NS group, 56,431 in the VP group, and 91,700 in the AMP group. The average effective ratios for the three groups were 90.86% (NS), 92.32% (VP), and 91.35% (AMP), respectively.

Diversity analysis of the intestinal microbiota

Differences were analyzed using the Kruskal-Wallis test, and box plots of the intestinal microbiota diversity index were obtained (Fig. S5A-E). The Good’s coverage index was above 99.8%, indicating that the sequencing quality of the samples met the requirements for analysis. Sob, Shannon, ACE, and Chao1 indexes were all highest in the AMP group and lowest in the VP group. Among them, the Shannon index showed remarkable difference between the groups (P < 0.05). β-diversity analysis [level of operational taxonomic units (OTUs)] of the intestinal microbiota was carried out based on the weighted unifrac distance and the Kruskal-Wallis test (Fig. S6A-D). According to principal co-ordinate analysis (PCoA)and non-metric multi-dimensional scaling (NMDS)analysis results, there was no overlap between the three groups of samples and the distances between groups were relatively large, suggesting great differences in the structure of the intestinal microbiota between groups (Fig. S6A, B). The unweighted pair-group method using arithmetic average (UPGMA) cluster analysis results revealed that the distance between the AMP group and the other two groups of samples was large (Fig. S6D). Additionally, the Kruskal-Wallis test results revealed that the median of the distance between the three groups of samples was significantly different (P < 0.05).

Analysis of species composition

At the phylum level, Proteobacteria, Firmicutes, Bacteroidota, and Fusobacteriota predominated (Fig. 7A). The relative abundance of Proteobacteria was highest in the VP group (96.23% ± 1.84%), followed by the NS (85.36%± 0.62%) and AMP groups (70.50% ± 4.50%). The relative abundance of Firmicutes was highest in the AMP group (20.41% ± 4.19%), followed by the NS (13.36% ± 1.65%) and VP groups (2.25% ± 0.85%). The relative abundance of Bacteroidota in each group was 0.68% ± 0.01% (NS), 1.30% ± 0.24% (VP), and 3.30% ± 1.23% (AMP), respectively. Regarding Fusobacteriota, the relative abundance in each group was 0.04% ± 0.01% (NS), 0.39% ± 0.01% (VP), and 5.11% ± 2.23% (AMP), respectively. At the genus level, the bacterial community was dominated by Vibrio, Photobacterium, Paraclostridium, and Acinetobacter (Fig. 7C). The VP group had the highest relative abundance of Vibrio (77.52% ± 2.47%), followed by the NS (65.68% ± 0.77%) and AMP groups (49.35% ± 2.03%). The relative abundance of Photobacterium in each group was 11.58% ± 1.32% (NS), 11.12% ± 0.15% (VP), and 9.14% ± 1.92% (AMP), respectively. Regarding the relative abundance of Paraclostridium in each group, there was 5.90% ± 2.74% (NS), 1.27% ± 0.53% (VP), and 9.41% ± 3.73% (AMP), respectively. Pearson correlation analysis results revealed that Proteobacteria was negatively correlated with Firmicutes, Verrucomicrobiota, and Actinobacteriota (Fig. 7B). Clostridium_sensu_stricto_11 was negatively correlated with Vibrio and positively correlated with Paraclostridium, Akkermansia, and Serratia (Fig. 7D). Detailed information on Pearson correlation analysis at the phylum and genus levels is shown in Supplementary material 2.

Fig. 7.

Fig. 7

Analysis of the species composition of the intestinal microbiota. A: Top 10 species in relative abundance at the phylum level; B: Species correlation network diagram based on Pearson correlation analysis (Phylum level, |r| >0.5, P < 0.5). Red lines indicate positive correlation. Blue dashed lines indicate negative correlations. Line thickness is determined by the correlation coefficient; C: Top 10 species in relative abundance at the genus level; D: Species correlation network diagram based on Pearson correlation analysis (genus level, |r| >0.5, P < 0.5)

Indicator species analysis

Venn (Fig. 8A) and upset (Fig. 8B) analysis results revealed 90 shared OTUs for the three groups. As for the unique OTUs for each group, there were 66 (NS), 29 (VP), and 167 (AMP), respectively. Next, the Linear discriminant analysis effect size (LEfSe) analysis method was employed, coupled with LDA scores, to identify differentially abundant species between groups (Fig. 8C, D). There were 5, 5, and 10 differential species in the NS, VP, and AMP groups, respectively. The differential species in the NS group all belonged to the Proteobacteria, mainly represented by Tatumella_ptyseos and Pantoea. Vibrio and Vibrionales were the primary differential species in the VP group. The differential species in the AMP group are mainly concentrated in Firmicutes and Clostridiales.

Fig. 8.

Fig. 8

Indicator species analysis of the intestinal microbiota. A, B: Veen and upset diagrams based on OTU levels; C, D: Intestinal microbiota Linear Discriminant Analysis (LDA) Effect Size (LEfSe) analysis (LDA > 2, P < 0.05). C: Histogram of LDA distribution. D: Cladogram based on the LEfSe analysis

Expression immune related genes

The heatmap analysis of immune and apoptotic gene expression demonstrated distinct cluster patterns among the experimental groups (Fig. 9). Specifically, the relative expression level of tumor necrosis factor alpha (TNF-α) in the VP group was significantly higher than that in the NS and AMP groups (P < 0.05), while the relative expression level of interleukin-1beta (IL-1β) in the AMP group was remarkably lower than that in the NS and VP groups (P < 0.05). The VP group showed significantly higher relative expression level of the Bax/Bcl-2 ratio than the AMP group (P < 0.05). The VP group had the highest relative expression levels of Caspase3 and P53, followed by the NS group, and Caspase3 and P53 levels were the lowest in the AMP group (P < 0.05).

Fig. 9.

Fig. 9

The heatmap of L. vannamei’s hepatopancreatic immunity-related and apoptosis gene. Different superscript letters represent significant differences (P < 0.05)

Discussion

While AMPs are commonly administered via feed to enhance animal growth, immunity, and disease resistance, their in vitro use remains understudied [28, 29]. Given the economic importance of L. vannamei shrimp farming and the significant losses caused by V. parahaemolyticus, this study investigated the changes in V. parahaemolyticus after BmKn2-7 treatment and the effects of BmKn2-7 on L. vannamei against infection [1, 30]. The goal was to evaluate the in vitro function of BmKn2-7 against this pathogen, thereby helping to alleviate its impact and providing a basis for understanding its inhibitory mechanism.

The present study found that BmKn2-7 can reduce the viability of V. parahaemolyticus and cause damage to the cell surface and interior. A previous study has evidenced that AMPs show antimicrobial activities against diverse pathogens [31]. Consistently, our study revealed that BmKn2-7 inhibited the viability of V. parahaemolyticus. The MIC of BmKn2-7 against V. parahaemolyticus was determined as 125 µg/mL, indicating potent bactericidal activity within a clinically relevant concentration range. These findings align with prior studies reporting MIC values of 128 µg/mL for other AMPs against Vibrio spp [32]. This suggests that the efficacy of BmKn2-7 is comparable to established insect-derived peptides. Additionally, Chen et al. have shown that AMPs can induce V. parahaemolyticus cell membrane damage, which is consistent with our research [33]. From these studies, it can be hypothesized that BmKn2-7 decreased bacterial viability by disrupting the integrity of the bacterial cell membrane.

The effects of BmKn2-7 on the permeability of the outer membrane of V. parahaemolyticus were determined using an NPN fluorescent probe. Moreover, the effects of BmKn2-7 on the permeability of the inner membrane of V. parahaemolyticus were determined using a PI fluorescent probe. In this study, the Bmkn2-7 variant was developed from Bmkn2 by enhancing the overall positive charge [22]. The depolarization of cell membrane can affect the normal function of cells, which in turn triggers cell apoptosis or death [34]. The ability of the BmKn2-7 to depolarize the cytoplasmic membrane was determined using the membrane potential-sensitive fluorescent probe DiSC3 (5). The trend of the BmKn2-7 to depolarize the cytoplasmic membrane was similar to that of outer membrane permeability and inner membrane permeability. When an AMP interacts with bacteria, membrane permeability increases and membrane transport proteins become damaged or dysregulated. As a result, the normal potential difference across the membrane collapses, ultimately leading to membrane depolarization [34]. Our study revealed that BmKn2-7 specifically suppressed P-type ATPase activity in V. parahaemolyticus in a concentration-dependent manner. P-type ATPases are ion transporters that maintain essential cellular gradients such as Ca²⁺ and Na⁺/K⁺. They function by coupling ATP hydrolysis to the active transport of ions across membranes [35]. P-type ATPases are essential for the virulence of V. parahaemolyticus, enabling host tissue colonization through pH adaptation and metal ion scavenging [36]. Similar effects have been reported for melittin, which inhibits ATPase activity in E. coli at micromolar concentrations. This inhibition leads to rapid ATP depletion and subsequently reduces bacterial culturability [37]. The conserved targeting of ATP across AMP families underscores its critical role in bactericidal efficacy. This metabolism crisis synergizes with membrane disruption and ROS overproduction, driving bacterial death. These results reveal that BmKn2-7 can disrupt the membrane of V. parahaemolyticus by causing structural disorganization and increasing permeability of the bacterial outer membrane.

In addition to physical membrane disruption, our RNA-Seq analysis results revealed broad transcriptional changes in V. parahaemolyticus after treatment of BmKn2-7, especially in metabolic and virulence-associated pathways. A previous study has investigated the relationship between BmKn2-7 structure and its antimicrobial ability [38]. Zeng et al. demonstrated that intramuscular administration of BmKn2-7 activates both metabolic and immune signaling pathways in L. vannamei during Vibrio infection [39]. However, there is a scarcity of studies exploring the mechanisms by which AMPs inhibit and eliminate biofilms. Most GO terms were assigned to the Biological Process category. This indicates that BmKn2-7 altered multiple cellular processes, particularly pathways involved in organic acid and carboxylic acid catabolism. Additionally, as indicated by KEGG enrichment analysis results, BmKn2-7 could affect metabolism, ABC transporters, quorum sensing, and beta-Lactam resistance in V. parahaemolyticus. In this study, the oxidoreductase activity was downregulated after treament of BmKn2-7. BmKn2-7 also upregulated the response to oxidative stress, indicating that BmKn2-7 increased oxidative stress in V. parahaemolyticus. Quorum sensing, which is essential for biofilm formation and virulence, was a major pathway identified in the KEGG analysis. Transcriptomic data further confirmed that BmKn2-7 suppressed quorum-sensing activity in V. parahaemolyticus [40]. BmKn2-7 downregulated the expression of oppA, oppC, oppD, and oppF to inhibit quorum sensing, key components of oligopeptide permease essential for quorum sensing, thereby inhibiting QS [41]. Additionally, our results showed that ABC transports were downregulated. ABC transports have been shown to play an important role in bacterial growth, pathogenesis, and virulence [42]. Genes associated with the β-lactam resistance pathway were significantly downregulated after BmKn2-7 treatment. These genes commonly encode β-lactamases that inactivate β-lactam antibiotics [43, 44]. Consistently, Liu et al. have reported that after treating Acinetobacter baumannii with AMP Cec4, the β-lactam resistance pathway is downregulated [45]. Previous studies primarily focus on AMPs’ membrane disruption [46] or immune enhancement [15], but our transcriptomic data uniquely highlighted BmKn2-7’s ability to simultaneously downregulate β-lactam resistance genes and quorum sensing pathways. Zheng et al. have found that the decrease of putA can increase the survival rate of mice when against Pseudomonas aeruginosa; the ability of bacterial defense against oxidative stress is associated with proline utilization [47]. BmKn2-7 downregulated putA and putP, which are required for proline catabolism. Because proline is an important energy source during infection, reduced proline utilization may weaken Vibrio virulence and limit its ability to establish infection. The expression of tdh, encoding the key virulence factor thermostable direct hemolysin (TDH), was downregulated by BmKn2-7 [48]. In this study, tdh was downregulated by BmKn2-7, indicating that BmKn2-7 may inhibited TDH to reduce the harmful effects of V. parahaemolyticus by downregulating tdh, consistent with attenuated cytotoxicity in challenge assays. Two-component regulatory systems, consisting of histidine kinases and response regulators, control the expression of many virulence factors. Therefore, inhibition of these systems can markedly reduce bacterial virulence [49]. In the present study, it was found that BmKn2-7 inhibited the expression of tctA and tctC, contributing to the observed attenuation of cytotoxicity. This two-component system belongs to the tripartite tricarboxylate transporter (TTT) family [50], and inhibition of them will disturb the energy metabolism of bacteria. The dual mechanism of BmKn2-7 (membrane disruption + quorum sensing inhibition) is expected to impose a high genetic barrier to resistance, as simultaneous mutations in multiple pathways are evolutionarily unfavorable [51]. This multi-targeting aligns with the emerging paradigm that AMPs’ multi-mechanistic action reduces selective pressure for resistance mutations [51]. However, the quorum sensing inhibition hypothesis relies on transcriptional data; future work should quantify biofilm formation and quorum sensing signal molecules (e.g., AHLs). Compared to conventional antimicrobial peptides, BmKn2-7 exhibits a distinctive multimodal mechanism. In the study by Gyan et al., the AMP supplemented in shrimp diets demonstrated immunoenhancing effects but failed to reduce bacterial virulence factors [15]. Similarly, AMP CM11 enhances immunity in D. rerio and demonstrates membrane-disruptive activity, yet no studies report its capacity to attenuate virulence determinants [10, 52]. In contrast, BmKn2-7 concurrently compromises bacterial membrane integrity and suppresses virulence factor production. This synergistic action mitigates resistance development risk, representing its unique advantage.

The shrimp gut consists of a large number of microorganisms and is a comprehensive ecosystem. The gut microbiota is closely linked to digestion, metabolism, and immune function, and its impact is not limited to the intestinal environment [53]. The diversity of the intestinal bacterial communities is closely associated with shrimp health and disease [54]. In previous research, AMPs have been used as a dietary supplement to improve intestinal immunity [55]. In our study, most diversity and richness indices did not differ significantly among groups. The only exception was the Shannon index, which showed a notable change. This indicated that injection of BmKn2-7 had little effects on the diversity of intestinal microbiota after V. parahaemolyticus infection. Consistent results have also been reported in previous findings [56]. Regarding the β-diversity of intestinal microbiota, there were significant differences in the composition of microbial communities among the three treatment groups. Interestingly, the differences in community composition of AMP and NS are smaller than AMP and NS, suggesting that injection of BmKn2-7 can significantly change microbial community composition. Similar results have also been evidenced by Gao [56]. Previous studies have shown that Proteobacteria is the most abundant colonizers in shrimp gut [57]. Generally, the health of aquaculture is highly associated with the relative abundance of Proteobacteria, a gram-negative bacterium, in the intestinal microbiota [58]. In this study, Proteobacteria were the most abundant bacterium among all treatment groups, with the AMP group showing the lowest relative abundance of Proteobacteria and the VP group showing the highest relative abundance. These differences can lead to differences in host health. Consistently, it has been evidenced that the relative abundance of Vibrio is strongly correlated with host health [48]. Vibrio seems to be everywhere in aquaculture systems, and some of them can cause various ‘vibriosis’ diseases. Therefore, eliminating Vibrio may play a key role in preventing ‘vibriosis’ diseases [59]. The present study found that injection of BmKn2-7 can notably reduce the relative abundance of Vibrio in the shrimp gut. Consistently, previous researchers have also found that the supplement of AMP significantly reduce the abundance of Vibrio [14]. Liu et al. demonstrated that AMP-supplemented feeds selectively suppress pathogenic taxa within the gut microbial community of grass carp (C. idellus), effectively reducing colonization by detrimental bacteria [11]. Notably, this selective suppression of Vibrio spp. without disrupting commensal diversity contrasts sharply with broad-spectrum antibiotics that cause dysbiosis [60]. The probably mechanisms by which BmKn2-7 regulates the intestinal microbiota were as follows: (1) AMPs can affect with anionic lipopolysaccharides (LPS) or lipoteichoic acid in the membranes of Gram-negative and -positive bacteria, respectively, through electrostatic interactions, thereby allowing these AMPs to destroy bacteria by disrupting microbial membranes [61, 62]; (2) AMPs can maintain the balance of gut microbiome indirectly by influencing immune system and promote other immune system in the host, thereby inhibiting the growth and colonization of pathogenic bacteria [6365]. Future field studies should quantify its persistence and resistance selection in aquaculture water systems. As a foundational study, we demonstrated BmKn2-7’s therapeutic potential through pathogen-challenged models. Its selective Vibrio suppression without disrupting a wide microbiota suggests its clinical utility in outbreak containment. Subsequent work will delineate AMP direct effects on healthy shrimp.

V. parahaemolyticus was selected as a bacterial challenge test for shrimp to investigate the effects of BmKn2-7 on disease resistance in shrimp. AMPs can trigger shrimp defense mechanisms and have been shown to improve survival against pathogens like WSSV and Vibrio harveyi [15, 66, 67]. In the present study, injection of BmKn2-7 decreased the mortality of L. vannamei when against V. parahaemolyticus. The partial recovery of survival rate in the BmKn2-7-treated group suggested potential residual inflammation or tissue damage, warranting further investigation through histopathological analysis and cytokine profiling. The 20% increase in survival rate (from 63% in the VP group to 83% in the AMP group) can be directly attributed to BmKn2-7’s in-vitro bactericidal efficacy, as evidenced by a MIC of 125 µg/mL. Our study showed that the combined action of membrane disruption and quorum sensing inhibition could mechanistically explain BmKn2-7’s efficacy in reducing V. parahaemolyticus pathogenicity, which is a general strategy to control bacterial infections [68], as evidenced by the attenuated virulence in shrimp challenge assays. We suggested that BmKn2-7 can enhance the immune system of shrimp and kill Vibrio, thus improving the survival and disease resistance of shrimp during infection. The sustained protection observed may result from two effects of BmKn2-7. First, it induces irreversible membrane lysis in Vibrio (Fig. 1), preventing bacterial recovery. Second, it enhances shrimp immunity by activating key immune-related genes (Fig. 9). These findings can assist in lowering death rates during disease outbreaks in the shrimp aquaculture industry and boosting the survival rate of shrimp during cultivation, thereby enhancing profitability.

In L. vannamei, TNF-α and IL-1β are crucial innate immune cytokines, playing significant roles in immune defense and inflammatory regulation and essential for pathogen response [69, 70]. Compared with NS group, the VP group showed markedly upregulated pro-inflammatory genes (TNF-α and IL-1β), along with the activated NF-κB pathway [71]. Reduced bacterial loads likely contribute to the lower inflammation observed. However, the greater-than-expected suppression of TNF-α and IL-1β suggests that BmKn2-7 may also act directly on shrimp immune-signaling pathways. This represents a potential advantage over conventional antibiotics. This is supported by findings that AMPs inhibit TNF-α and IL-1β to reduce inflammation [72]. Apoptotic regulators further highlighted this intervention. It has been shown that the mitochondrial stress marker Bax/Bcl-2 ratio surges in VP, reflecting disrupted mitochondrial integrity; AMP could restore this balance to near-control levels [73]. Executioner protease Caspase3 and stress sensor P53 mirror this trend, peaking in VP and declining sharply in AMP, indicating the suppressed apoptotic cascades after treatment [74, 75]. The trend of Cyt-c among the three groups further validated that AMP attenuated infection-caused apoptosis [76]. Collectively, these patterns underscore the capacity of BmKn2-7 to resolve inflammation, stabilize apoptotic thresholds, and mitigate Vibrio-induced dysregulation.

In conclusion, our study unveils a tripartite antimicrobial strategy of BmKn2-7 against V. parahaemolyticus (Fig. 10) :(1) direct bactericidal action through membrane disruption, (2) virulence attenuation via quorum sensing suppression, (3) promoted a microbiota structure associated with ecological resilience and enhancing L. vannamei immunity. Although further studies are needed to confirm its efficacy across species and dosing regimens, the multi-target mechanism revealing the potential of BmKn2-7 could be potential as an antimicrobial alternative with lower resistance risk. The above studies demonstrate that injection of BmKn2-7 as an emergency intervention has been proven effective during the critical early stages of Vibrio outbreaks in shrimp aquaculture systems. While BmKn2-7 shows multimodal potential, our study is limited by the absence of a peptide-only control group (precluding assessment of its constitutive effects) and exclusive focus on L. vannamei. Future work should establish this treatment, validate dietary supplementation regimens, and extend applications to other commercially relevant aquatic species.

Fig. 10.

Fig. 10

Effect of BmKn2-7 on Vibrio parahaemolyticus

Supplementary Information

Acknowledgements

We sincerely express our profound gratitude to the laboratory instructors and fellow students for their invaluable support of this research. Special acknowledgement is extended to Bio-Form Biotechnology (Guangdong) Co., Ltd and Professor Ling Zeng for their essential technical contributions.

Authors’ contributions

Qihang Liang and Qi Wang designed the methodology, curated the data, and drafted the original manuscript. Hongyu Liu and Ling Zeng secured funding, supervised and administered the project, and contributed to writing, review, and editing. Pinqi Chi carried out software development, formal analysis, and conceptualization. Depeng Fan, Shiwei Xie and Junming Deng provided resources. Beiping Tan conducted the investigation and contributed to methodology.

Funding

This work was financially supported by the Key Research Projects of Ordinary Universities in Guangdong Province (2024ZDZX2085), Natural Science Foundation of Shenzhen (202408133001322), and Research on breeding technology of candidate species for Guangdong modern marine ranching (2024-MRB-00-001).

Data availability

Raw sequencing data for transcriptome analyses have been deposited in the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/) database under BioProject accession numbers PRJNA1328909 (https://www.ncbi.nlm.nih.gov/sra/?term=PRJNA1328909). Raw sequencing data for intestinal microbiota have been deposited in China National Center for Bioinformation (https://www.cncb.ac.cn/) database under accession numbers CRA031190 (https://ngdc.cncb.ac.cn/gsa/browse/CRA031190).

Declarations

Ethics approval and consent to participate

This experiment was approved by the Ethics Committee for Animal Experiments of Guangdong Ocean University (Ethics approval No. IACUC-GDOU-10/2019-A0186).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Qihang Liang and Qi Wang contributed equally to this work.

Contributor Information

Hongyu Liu, Email: liuhyu@gdou.edu.cn.

Ling Zeng, Email: jeny126@126.com.

References

  • 1.Emerenciano MGC, Rombenso AN, Vieira FD, Martins MA, Coman GJ, Truong HH, Noble TH, Simon CJ. Intensification of Penaeid shrimp culture: an applied review of advances in production Systems, nutrition and breeding. Animals. 2022;12(3):39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wang Q, Li W, Liu H, Tan B, Dong X, Chi S, Yang Q, Zhang S, Fan D, Hu YJMR. The isolation, identification, whole-genome sequencing of Clostridium Butyricum LV1 and its effects on growth performance, immune response, and disease-resistance of Litopenaeus vannamei. Microbiol Res. 2023;272:127384. [DOI] [PubMed] [Google Scholar]
  • 3.Nayak SK. Multifaceted applications of probiotic Bacillus species in aquaculture with special reference to Bacillus subtilis. Reviews Aquaculture. 2021;13(2):862–906. [Google Scholar]
  • 4.Tran NT, Li ZZ, Ma HY, Zhang YL, Zheng HP, Gong Y, Li SK. Clostridium butyricum: a promising probiotic confers positive health benefits in aquatic animals. Reviews Aquaculture. 2020;12(4):2573–89. [Google Scholar]
  • 5.Cook MA, Wright GD. The past, present, and future of antibiotics. Sci Transl Med. 2022;14(657):eabo7793. [DOI] [PubMed]
  • 6.Goldstein EJC, Citron DM, Tyrrell KL, Merriam CV. Comparative In vitro activities of SMT19969, a new antimicrobial Agent, against Clostridium difficile and 350 Gram-Positive and Gram-Negative aerobic and anaerobic intestinal flora isolates. Antimicrob Agents Chemother. 2013;57(10):4872–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Hackel MA, Karlowsky JA, Canino MA, Sahm DF, Scangarella-Oman NE. In vitro activity of gepotidacin against Gram-Negative and Gram-Positive anaerobes. Antimicrob Agents Chemother. 2022;66(2):7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zhang QY, Yan ZB, Meng YM, Hong XY, Shao G, Ma JJ, Cheng XR, Liu J, Kang J, Fu CY. Antimicrobial peptides: mechanism of action, activity and clinical potential. Military Med Res. 2021;8(1):48. [DOI] [PMC free article] [PubMed]
  • 9.Rodrigues T, Guardiola FA, Almeida D, Antunes AJM. Aquatic Invertebrate Antimicrobial Peptides in the Fight Against Aquaculture Pathogens. Microorganisms. 2025;13(1):156. [DOI] [PMC free article] [PubMed]
  • 10.Rashidian G, Moghaddam MM, Mirnejad R, Azad ZM. Supplementation of zebrafish (Danio rerio) diet using a short antimicrobial peptide: evaluation of growth performance, Immunomodulatory function, antioxidant activity, and disease resistance. Fish Shellfish Immunol. 2021;119:42–50. [DOI] [PubMed] [Google Scholar]
  • 11.Liu SL, Wang SD, Liu XW, Wen LF, Zou JX. Effects of dietary antimicrobial peptides on intestinal morphology, antioxidant status, immune responses, microbiota and pathogen disease resistance in grass carp Ctenopharyngodon idellus. Microb Pathog. 2022;165:105386. [DOI] [PubMed]
  • 12.Wang SD, Xie SL, Zhou AG, Zhang CN, Wen LF, Xu GH, Zou JX. Effects of mixed antimicrobial peptide on the growth performance, antioxidant and immune responses and disease resistance of Pengze crucian carp (Carassius auratus var. Pengze). Fish Shellfish Immunol. 2021;114:112–8. [DOI] [PubMed] [Google Scholar]
  • 13.Cheng AC, Lin HL, Shiu YL, Tyan YC, Liu CH. Isolation and characterization of antimicrobial peptides derived from Bacillus subtilis E20-fermented soybean meal and its use for preventing Vibrio infection in shrimp aquaculture. Fish Shellfish Immunol. 2017;67:270–9. [DOI] [PubMed] [Google Scholar]
  • 14.Cheng AC, Yeh SP, Hu SY, Lin HL, Liu CH. Intestinal microbiota of white shrimp, Litopenaeus vannamei, fed diets containing Bacillus subtilis E20-fermented soybean meal (FSBM) or an antimicrobial peptide derived from B. subtilis E20-FSBM. Aquac Res. 2020;51(1):41–50. [Google Scholar]
  • 15.Gyan WR, Yang QH, Tan BP, Jan SS, Jiang L, Chi SY, Dong XH, Liu HY, Shuang Z. Effects of antimicrobial peptides on growth, feed utilization, serum biochemical indices and disease resistance of juvenile shrimp, Litopenaeus vannamei. Aquac Res. 2020;51(3):1222–31. [Google Scholar]
  • 16.Fan SZ, Sun ZB, Jiang DH, Dai C, Ma YB, Zhao ZH, Liu H, Wu YL, Cao ZJ, Li WX. BmKCT toxin inhibits glioma proliferation and tumor metastasis. Cancer Lett. 2010;291(2):158–66. [DOI] [PubMed] [Google Scholar]
  • 17.Ma YB, Zhao RM, He YW, Li SR, Liu J, Wu YL, Cao ZJ, Li WX. Transcriptome analysis of the venom gland of the Scorpion Scorpiops jendeki: implication for the evolution of the Scorpion venom arsenal. BMC Genomics. 2009;10:15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Torres-Larios A, Gurrola GB, Zamudio FZ, Possani LD. Hadrurin, a new antimicrobial peptide from the venom of the Scorpion hadrurus Aztecus. Eur J Biochem. 2000;267(16):5023–31. [DOI] [PubMed] [Google Scholar]
  • 19.Conde R, Zamudio FZ, Rodriguez MH, Possani LD. Scorpine, an anti-malaria and anti-bacterial agent purified from Scorpion venom. FEBS Lett. 2000;471(2–3):165–8. [DOI] [PubMed] [Google Scholar]
  • 20.Yuan WY, Cao LY, Ma YB, Mao PY, Wang WP, Zhao RM, Wu YL, Cao ZJ, Li WX. Cloning and functional characterization of a new antimicrobial peptide gene StCT1 from the venom of the Scorpion Scorpiops Tibetanus. Peptides. 2010;31(1):22–6. [DOI] [PubMed] [Google Scholar]
  • 21.Dai L, Yasuda A, Naoki H, Corzo G, Andriantsiferana M, Nakajima TJB. Communications br: IsCT, a novel cytotoxic linear peptide from Scorpion opisthacanthus Madagascariensis. Biochem Biophys Res Commun. 2001;286(4):820–5. [DOI] [PubMed]
  • 22.Cao LY, Dai C, Li ZJ, Fan Z, Song Y, Wu YL, Cao ZJ, Li WX. Antibacterial Activity and Mechanism of a Scorpion Venom Peptide Derivative In Vitro and In Vivo. vol 7, e40135, (2012). PLoS One. 2024;19(12):2. [DOI] [PMC free article] [PubMed]
  • 23.Zeng XC, Wang SX, Zhu Y, Zhu SY, Li WX. Identification and functional characterization of novel Scorpion venom peptides with no disulfide Bridge from Buthus martensii Karsch. Peptides. 2004;25(2):143–50. [DOI] [PubMed] [Google Scholar]
  • 24.Li FP, Huang J, Wang MZ, Chen L, Xiao YH. Sources, distribution and dynamics of antibiotics in Litopenaeus vannamei farming environment. Aquaculture. 2021;545:737200.
  • 25.Su YC, Liu CC. Vibrio parahaemolyticus : A concern of seafood safety. Food Microbiol. 2007;24(6):549–58. [DOI] [PubMed] [Google Scholar]
  • 26.Guo D, Yang ZY, Zheng XY, Kang SM, Yang ZK, Xu YF, Shi C, Tian HY, Xia XD. Thymoquinone inhibits biofilm formation and Attachment-Invasion in host cells of Vibrio parahaemolyticus. Foodborne Pathog Dis. 2019;16(10):671–8. [DOI] [PubMed] [Google Scholar]
  • 27.Du R, Xia L, Ning XX, Liu LM, Sun WJ, Huang C, Wang HM, Sun SR. Hypoxia-induced Bmi1 promotes renal tubular epithelial cell-mesenchymal transition and renal fibrosis via PI3K/Akt signal. Mol Biol Cell. 2014;25(17):2650–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Yoon JH, Ingale SL, Kim JS, Kim KH, Lohakare J, Park YK, Park JC, Kwon IK, Chae BJ. Effects of dietary supplementation with antimicrobial peptide-P5 on growth performance, apparent total tract digestibility, faecal and intestinal microflora and intestinal morphology of weanling pigs. J Sci Food Agric. 2013;93(3):587–92. [DOI] [PubMed] [Google Scholar]
  • 29.Zhao ZX, Song CY, Xie J, Ge XP, Liu B, Xia SL, Yang S, Wang Q, Zhu SH. Effects of fish meal replacement by soybean peptide on growth performance, digestive enzyme activities, and immune responses of yellow catfish Pelteobagrus fulvidraco=. Fish Sci. 2016;82(4):665–73. [Google Scholar]
  • 30.Bowley J, Baker-Austin C, Porter A, Hartnell R, Lewis C. Oceanic Hitchhikers - Assessing pathogen risks from marine microplastic. Trends Microbiol. 2021;29(2):107–16. [DOI] [PubMed] [Google Scholar]
  • 31.Büyükkiraz ME, Kesmen Z. Antimicrobial peptides (AMPs): A promising class of antimicrobial compounds. J Appl Microbiol. 2022;132(3):1573–96. [DOI] [PubMed] [Google Scholar]
  • 32.Chou H-T, Kuo T-Y, Chiang J-C, Pei M-J, Yang W-T, Yu H-C, Lin S-B. Chen W-JJIjoaa: design and synthesis of cationic antimicrobial peptides with improved activity and selectivity against Vibrio spp. 2008;32(2):130–8. [DOI] [PubMed]
  • 33.Chen ML, Lin NF, Liu XD, Tang X, Wang ZY, Zhang DL. A novel antimicrobial peptide screened by a Bacillus subtilis expression system, derived from Larimichthys Crocea ferritin H, exerting bactericidal and parasiticidal activities. Front Immunol. 2023;14:13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Liu F, Wang HM, Cao SS, Jiang CG, Hou JC. Characterization of antibacterial activity and mechanisms of two linear derivatives of bactenecin. LWT-Food Sci Technol. 2019;107:89–97. [Google Scholar]
  • 35.Palmgren MG. Nissen pjarob: P-type ATPases. Annu Rev Biophys. 2011;40(1):243–66. [DOI] [PubMed]
  • 36.Palmgren MJJoBC. P-type atpases: many more enigmas left to solve. J Biol Chem. 2023;299(11). [DOI] [PMC free article] [PubMed]
  • 37.Nehme H, Ayde H, El Obeid D, Sabatier JM, Fajloun ZJA. Potential inhibitory effect of apis mellifera’s venom and of its two main components—melittin and pla2—on Escherichia coli f1f0-atpase. Antibiotics (Basel). 2020;9(11):824. [DOI] [PMC free article] [PubMed]
  • 38.Lee K, Shin SY, Kim K, Lim SS, Hahm KS, Kim Y. Antibiotic activity and structural analysis of the scorpion-derived antimicrobial peptide IsCT and its analogs. Biochem Biophys Res Commun. 2004;323(2):712–9. [DOI] [PubMed] [Google Scholar]
  • 39.Zeng L, Sun YL, Zhang HL, Yi XX, Du R, Chen ZM, Wang Q. Scorpion venom peptides enhance immunity and survival in Litopenaeus vannamei through antibacterial action against Vibrio parahaemolyticus. Front Immunol. 2025;16:17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Johansen P, Jespersen L. Impact of quorum sensing on the quality of fermented foods. Curr Opin Food Sci. 2017;13:16–25. [Google Scholar]
  • 41.Slamti L, Lereclus. DJRim. The oligopeptide ABC-importers are essential communication channels in Gram-positive bacteria. Res Microbiol. 2019;170(8):338–44. [DOI] [PubMed]
  • 42.How SS, Nathan S, Lam SD, Chieng S. ATP-binding cassette (ABC) transporters: structures and roles in bacterial pathogenesis. J Zhejiang Univ Sci B. 2024:18. [DOI] [PMC free article] [PubMed]
  • 43.Bush K, Bradford PA. β-Lactams and β-Lactamase inhibitors: an overview. Cold Spring Harb Perspect Med. 2016;6(8):22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Wilke MS, Lovering AL, Strynadka NCJ. β-lactam antibiotic resistance:: a current structural perspective. Curr Opin Microbiol. 2005;8(5):525–33. [DOI] [PubMed] [Google Scholar]
  • 45.Liu WW, Wu ZY, Mao CJ, Guo G, Zeng Z, Fei Y, Wan S, Peng J, Wu JW. Antimicrobial peptide Cec4 eradicates the bacteria of clinical Carbapenem-Resistant Acinetobacter baumannii biofilm. Front Microbiol. 2020;11:13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Benfield AH, Henriques STJFMT. Mode-of-action of antimicrobial peptides: membrane disruption vs. Intracell Mech. 2020;2:610997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zheng RP, Feng XM, Wei XY, Pan XL, Liu C, Song RP, Jin YX, Bai F, Jin SG, Wu WH, et al. PutA is required for virulence and regulated by PruR in Pseudomonas aeruginosa. Front Microbiol. 2018;9:12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Baker-Austin C, Oliver JD, Alamo M, Ali A, Waldor MK, Qadri F, Martinez-Urtaza J. Vibrio spp. Infections. Nat Rev Dis Primers. 2018;4:19. [DOI] [PubMed] [Google Scholar]
  • 49.Cho SY, Yoon SI. Structural analysis of the activation and DNA interactions of the response regulator VbrR from Vibrio parahaemolyticus. Biochem Biophys Res Commun. 2021;555:102–8. [DOI] [PubMed] [Google Scholar]
  • 50.Rosa LT, Bianconi ME, Thomas GH, Kelly DJ. Tripartite ATP-Independent periplasmic (TRAP) transporters and tripartite tricarboxylate transporters (TTT): from uptake to pathogenicity. Front Cell Infect Microbiol. 2018;8:16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Yang J, Zhang J, Feng Z, Ma YJM. The role and mechanisms of antimicrobial peptides in overcoming Multidrug-Resistant bacteria. Molecules. 2024;30(1):128. [DOI] [PMC free article] [PubMed]
  • 52.Mirnejad R, Fasihi-Ramandi M, Behmard E, Najafi A, Moghaddam MM. Interaction of antibacterial CM11 peptide with the gram-positive and gram-negative bacterial membrane models: a molecular dynamics simulations study. Chem Pap. 2023;77(7):3727–35. [Google Scholar]
  • 53.Prakash S, Rodes L, Coussa-Charley M, Tomaro-Duchesneau C. Gut microbiota: next frontier in Understanding human health and development of biotherapeutics. Biologics: Targets Therapy. 2011;5:71–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Xiong J, Wang K, Wu J, Qiuqian L, Yang K, Qian Y. Zhang DJAm, biotechnology: changes in intestinal bacterial communities are closely associated with shrimp disease severity. Appl Microbiol Biotechnol. 2015;99:6911–9. [DOI] [PubMed]
  • 55.Liu Q, Yao S, Chen Y, Gao S, Yang Y, Deng J, Ren Z, Shen L, Cui H, Hu Y. Use of antimicrobial peptides as a feed additive for juvenile goats. Sci Rep. 2017;7(1):12254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Gao SJ, Zhang QC, Liu CX, Shen H, Wang JA. Effects of maggot antimicrobial peptides on growth performance, immune function, and cecal flora of yellow-feathered broilers. Front Vet Sci. 2023;10:11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Xiong JB, Dai WF, Zhu JY, Liu KS, Dong CM, Qiu QF. The underlying ecological processes of gut microbiota among cohabitating Retarded, overgrown and normal shrimp. Microb Ecol. 2017;73(4):988–99. [DOI] [PubMed] [Google Scholar]
  • 58.Wang YL, Wang BJ, Liu M, Jiang KY, Wang MQ, Wang L. Aflatoxin B1 (AFB1) induced dysregulation of intestinal microbiota and damage of antioxidant system in Pacific white shrimp (Litopenaeus vannamei). Aquaculture. 2018;495:940–7. [Google Scholar]
  • 59.Valente CD, Wan AHL. Vibrio and major commercially important vibriosis diseases in decapod crustaceans. J Invertebr Pathol. 2021;181:18. [DOI] [PubMed] [Google Scholar]
  • 60.Rosa CP, Brancaglion GA, Miyauchi-Tavares TM, de Corsetti PP. Almeida lajls: Antibiotic-induced dysbiosis effects on the murine Gastrointestinal tract and their systemic repercussions. Life Sci. 2018;207:480–91. [DOI] [PubMed]
  • 61.Luo Y, Song YZ. Mechanism of antimicrobial peptides: antimicrobial, Anti-Inflammatory and antibiofilm activities. Int J Mol Sci. 2021;22(21):20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Zong X, Fu J, Xu BC, Wang YZ, Jin ML. Interplay between gut microbiota and antimicrobial peptides. Anim Nutr. 2020;6(4):389–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Yang D, Biragyn A, Kwak LW, Oppenheim JJ. Mammalian defensins in immunity: more than just microbicidal. Trends Immunol. 2002;23(6):291–6. [DOI] [PubMed] [Google Scholar]
  • 64.Yue G, Merlin D, Selsted ME, Lencer WI, Madara JL, Eaton DC. Cryptdin 3 forms anion selective channels in cytoplasmic membranes of human embryonic kidney cells. Am J Physiol-Gastroint Liver Physiol. 2002;282(5):G757–65. [DOI] [PubMed] [Google Scholar]
  • 65.Lehrer RI, Jung G, Ruchala P, Andre S, Gabius HJ, Lu WY. Multivalent binding of carbohydrates by the human α-Defensin, HD5. J Immunol. 2009;183(1):480–90. [DOI] [PubMed] [Google Scholar]
  • 66.Brown KL, Hancock REW. Cationic host defense (antimicrobial) peptides. Curr Opin Immunol. 2006;18(1):24–30. [DOI] [PubMed] [Google Scholar]
  • 67.Dupuy JW, Bonami JR, Roch P. A synthetic antibacterial peptide from Mytilus galloprovincialis reduces mortality due to white spot syndrome virus in palaemonid shrimp. J Fish Dis. 2004;27(1):57–64. [DOI] [PubMed] [Google Scholar]
  • 68.Defoirdt T, Boon N, Bossier P, Verstraete W. Disruption of bacterial quorum sensing: an unexplored strategy to fight infections in aquaculture. Aquaculture. 2004;240(1–4):69–88. [Google Scholar]
  • 69.Yin XL, Zhuang XQ, Luo WT, Liao MQ, Huang L, Cui QQ, Huang JY, Yan CX, Jiang ZX, Liu Y, et al. Andrographolide promote the growth and immunity of Litopenaeus vannamei, and protects shrimps against Vibrio alginolyticus by regulating inflammation and apoptosis via a ROS-JNK dependent pathway. Front Immunol. 2022;13:17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Zhu ZH, Shi W, Li F, Zhang M, Luo K, Tong DF, Yu YY, Zhang XY, Lu LZ, Yan MC. Studies on immunological characteristics and transcriptomic analysis of Litopenaeus vannamei low salt-tolerance family. Dev Comp Immunol. 2024;161:11. [DOI] [PubMed] [Google Scholar]
  • 71.Ortis F, Miani M, Colli ML, Cunha DA, Gurzov EN, Allagnat F, Chariot A, Eizirik DL. Differential usage of NF-κB activating signals by IL-1β and TNF-α in pancreatic beta cells. FEBS Lett. 2012;586(7):984–9. [DOI] [PubMed] [Google Scholar]
  • 72.Vincent SA, Mathew P, Antony SP. Shrimp antimicrobial peptides: A multitude of possibilities. Int J Pept Res Ther. 2022;28(5):14. [Google Scholar]
  • 73.Chan WH. Citrinin induces apoptosis in mouse embryonic stem cells. IUBMB Life. 2008;60(3):171–9. [DOI] [PubMed] [Google Scholar]
  • 74.Nuñez-Hernandez DM, Felix-Portillo M, Peregrino-Uriarte AB, Yepiz-Plascencia G. Cell cycle regulation and apoptosis mediated by p53 in response to hypoxia in hepatopancreas of the white shrimp Litopenaeus vannamei. Chemosphere. 2018;190:253–9. [DOI] [PubMed] [Google Scholar]
  • 75.Felix-Portillo M, Martínez-Quintana JA, Arenas-Padilla M, Mata-Haro V, Gómez-Jiménez S, Yepiz-Plascenci G. Hypoxia drives apoptosis independently of p53 and Metallothionein transcript levels in hemocytes of the whiteleg shrimp Litopenaeus vannamei. Chemosphere. 2016;161:454–62. [DOI] [PubMed] [Google Scholar]
  • 76.Hu WY, Yao CL. Molecular and immune response characterizations of a novel AIF and cytochrome c in Litopenaeus vannamei defending against WSSV infection. Fish Shellfish Immunol. 2016;56:84–95. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

Raw sequencing data for transcriptome analyses have been deposited in the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/) database under BioProject accession numbers PRJNA1328909 (https://www.ncbi.nlm.nih.gov/sra/?term=PRJNA1328909). Raw sequencing data for intestinal microbiota have been deposited in China National Center for Bioinformation (https://www.cncb.ac.cn/) database under accession numbers CRA031190 (https://ngdc.cncb.ac.cn/gsa/browse/CRA031190).


Articles from BMC Veterinary Research are provided here courtesy of BMC

RESOURCES