Skip to main content
BMC Pediatrics logoLink to BMC Pediatrics
. 2026 Jan 15;26:158. doi: 10.1186/s12887-025-06483-x

MiR-483-5p has the potential to serve as a biomarker in perioperative respiratory adverse events in children under general anesthesia

Xingxing Zhao 1,#, Ruiqi Yan 2,#, Jun Liu 3, Xiaotong Han 3, Xiaoning Ma 4, Min Li 5,, Yuelai Yang 6,
PMCID: PMC12947425  PMID: 41540379

Abstract

Background

Perioperative respiratory adverse events (PRAE) may cause critical illness in children undergoing anesthesia and surgery. So, this study aims to explore the diagnostic value of miR-483-5p in PRAE.

Methods

This study included 112 patients with PRAE and 93 patients without PRAE. MiR-483-5p expression was quantified utilizing RT-qPCR. The receiver operating characteristic (ROC) curve was utilized to assess the diagnostic value. The clinicopathological characteristics of PRAE and miR-483-5p level were analyzed by the Chi-squared test. Risk factors for PRAE were analyzed using multivariate logistic regression. The multicellular human alveolar model was established by treating it with lipopolysaccharide (LPS) at 48 h. Then, cell viability and inflammatory factors were detected in the PRAE model by cell counting kit-8 (CCK-8) assay and ELISA.

Results

MiR-483-5p was obviously increased and had high diagnostic value in PRAE. In PRAE, miR-483-5p was a risk factor and was closely related to clinical indicators. In the multicellular human alveolar model, overexpression of miR-483-5p reduced proliferation and elevated inflammatory factors levels, while inhibition of miR-483-5p increased proliferation and reduced inflammatory factors levels, which is consistent with the trend in the PRAE cell model.

Conclusion

MiR-483-5p might participate in PRAE in children by regulating proliferation and inflammatory factors, proving that it may be a biomarker in PRAE. In addition, miR-483-5p was a risk factor for PRAE. In the multicellular human alveolar model, LPS treatment significantly enhanced miR-483-5p expression.

Keywords: miR-483-5p, Perioperative respiratory adverse events, Biomarker, Diagnosis, Children

Introduction

Pediatric airway management is vital in routine anesthesia practice because children’s airways develop and change as they grow [1]. Perioperative pulmonary complications represent a significant portion of surgery and anesthesia risks and are the leading cause of postoperative morbidity, mortality, and extended hospital stays [2]. Perioperative adverse respiratory events (PRAE) are among the most common complications in pediatric anesthesia [3]. These events are a major cause of critical incidents, accounting for approximately three-quarters of serious events and one-third of perioperative cardiac arrests [4]. PRAE—including airway obstruction, laryngospasm, and oxygen desaturation—pose significant risks to children under general anesthesia and can be life-threatening in severe cases [5]. Therefore, identifying a diagnostic marker for PRAE is essential.

In recent years, microRNA (miRNA) has emerged as a promising biomarker due to its stability [6]. Our study focuses on miR-483-5p, which has been closely linked to lung diseases in numerous studies. In sepsis-induced acute lung injury, elevated miR-483-5p expression worsens symptoms in model mice [7]. In the pulmonary lesions of pneumonia caused by coronavirus disease 2019, miR-483-5p was linked to a higher percentage of ground-glass opacity, proving that it might have exacerbated the pulmonary lesions [8]. Patients with pulmonary tuberculosis show elevated miR-483-5p levels, which have significant diagnostic value [9]. Notably, miR-483-5p is also linked to lung cancer. It promotes epithelial-mesenchymal transition (EMT) and is associated with invasiveness and metastasis of lung adenocarcinoma [10]. Additionally, miR-483-5p overexpression can predict the onset of venous thromboembolism in lung cancer [11]. PRAE includes symptoms such as apnea, laryngeal spasm, decreased saturation, cough, fever, pulmonary rales, and pulmonary infection [12], all of which are related to inflammatory responses. MiR-483-5p is also closely associated with inflammation. For instance, it regulates inflammation in atherosclerotic diseases [13] and is highly expressed in inflammatory conditions such as rheumatoid arthritis [14]. Therefore, we hypothesize that miR-483-5p may play a role in PRAE in children under general anesthesia.

This study mainly analyzed serum miR-483-5p levels in 205 children undergoing general anesthesia surgery to evaluate its diagnostic value for PRAE.

Materials and methods

Patients and specimens

From March 2021 to February 2023, 205 children who underwent general anesthesia surgery in Affiliated Hospital of Gansu Medical College were included in this study. All the subjects were divided into the control group (n = 93) and the PRAE group (n = 112) based on whether PRAE occurred. The age range of the subjects in this study was 3 to 12 years old. The inclusion criteria for the PRAE group were any single or combined episodes of symptoms [15], mainly including respiratory dysfunction caused by laryngeal spasm, bronchospasm, low oxygen saturation, tongue retraction, cough, excessive phlegm, and shortness of breath. The exclusion criteria were as follows: Allergy to anesthetics; The surgical site is either the respiratory tract or the oral cavity; Suffering from liver and kidney diseases, cardiovascular diseases, and central nervous system diseases. All patients were given an intravenous injection of penehyclidine hydrochloride at a dose of 0.01 mg/kg before the operation. Sevoflurane was selected for inhalation induction during the operation, and drugs such as propofol and remifentanil were combined according to the patients’ own conditions. Fasting blood samples from all the study participants 24 h after surgery were collected, and serum was obtained and stored at -80 ℃. This study was approved by the Ethics Committee of Affiliated Hospital of Gansu Medical College and received informed consent from the guardians of the children patients. The procedures used in this study adhere to the tenets of the Declaration of Helsinki.

Establishment of the PRAE cell model

Human pulmonary microvascular endothelial cells (HPMECs) were provided by PromoCell (C-12281, Heidelberg, Germany) and cultured in endothelial cell medium (ECM) supplemented with FBS, antibiotics, and endothelial cell growth serum. Experiments are conducted using second to fourth-generation cells. HPMECs were treated with lipopolysaccharide (LPS) (1 µg/mL) for different durations (0, 6, 12, 24 h). Finally, HPMECs were treated with LPS at 24 h as the PRAE cell model. MiR-483-5p mimic or miR-483-5p inhibitor was transfected into the PRAE cell model to overexpress or inhibit miR-483-5p for 24 h using Lipofectamine 3000 (L3000150, Invitrogen, USA). All plasmids were provided by GenePharma (Shanghai, China).

Establishment of the multicellular human alveolar model

To further explore the role of miR-483-5p in PRAE, a multicellular human alveolar model composed of alveolar epithelial cell line A549, human monocyte-derived macrophages (MDMs), and dendritic cells (MDDCs) was constructed [16]. Monocytes isolated from human peripheral blood were seeded in 6-well cell culture plates at a density of 10⁶ cells/mL for 6 days, with 3 mL of complete cell culture medium (cRPMI) added to each well. cRPMI was RPMI-1640 medium with 10% FBS, 2 mM L-glutamine, and penicillin (100 units/mL)-streptomycin (100 µg/mL). When MDM differentiates, 10 ng/mL macrophage colony-stimulating factor (M-CSF) is added to cRPMI. MDDC differentiation was carried out under the conditions of 10 ng/mL recombinant human interleukin-4 (IL-4) and 10 ng/mL granule-macrophage colony-stimulating factor (GM-CSF). A549 cells were seeded in the upper chamber of Transwell insert dishes (PET membrane, pore size 3.0 μm) at a density of 28.0 × 10⁴ cells/cm², and 2 mL of cRPMI medium was added, while 3 mL of cRPMI medium was added to the lower chamber. Then, it was cultivated upright for 4 days at 37 ℃ and 5% CO₂. Gently scrape A549 cells that have grown from the membrane pores to the basal surface with a cell scraper, and add 300 µL of MDDC cell suspension (with a density of 7 × 10⁴ cells/cm²) to the basal surface of the Transwell chamber. The chamber was inverted and incubated at 37 °C and 5% CO₂ for 70 min to allow the cells to adhere. Then, place the small chamber back into the 6-well plate that has been filled with 3 mL of fresh preheated cRPMI medium. Gently add 2 mL of MDM cell suspension (with a density of 1.4 × 10⁴ cells/cm²) to the surface of A549 cells in the upper chamber of Transwell. The assembled co-culture model was cultivated under gas-liquid interface (ALI) conditions for 24 h to make the model closer to the physiological state. The multicellular human alveolar model was treated with LPS (1 µg/mL) for 48 h [17]. Overexpression or inhibition of miR-483-5p in the multicellular human alveolar model required transfection of miR-483-5p mimic or miR-483-5p inhibitor into A549 cells before co-culture using Lipofectamine 3000 (L3000150, Invitrogen, USA).

RT-qPCR

RNA was extracted from serum and cells utilizing TRIzol reagent (15596018CN, Invitrogen, USA). Then, RNA is reverse transcribed into cDNA utilizing the RevertAid RT Reverse Transcription Kit (K1691, Thermo, USA). MiR-483-5p expression was quantified utilizing the miScript SYBR Green PCR kit (218073, Qiagen GmbH, China). MiR-483-5p level was calculated with the 2-ΔΔCT method and normalized to U6. The primer sequences are as follows (from 5’-3’): miR-483-5p-forward: TCGGCAGGAAGACGGGAAGGAAA, reverse: CTCAACTGGTGTCGTGGA; and U6-forward: CTCGCTTCGGCAGCACA, reverse: AACGCTTCACGAATTTGCGT. The concentration of all primers is 0.2 µM. The reaction volume of all samples is 20 µL. The reaction conditions for qPCR were as follows: 95 °C for 2 min, 35 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 60 s.

Cell counting kit-8 (CCK-8) assay

Cell viability was determined by the CCK-8 kit (40203ES, Yeasen, China). HPMECs were digested and resuspended at a density of 2 × 10³ cells/mL. The cell suspension was seeded in a volume of 100 µL/well into a 96-well plate. The blank group and the experimental group were set. The culture plates lined with cells were incubated in an incubator at 37 ℃ and 5% CO₂ for 24 h. Then, 10 µL CCK-8 solution was added to each well and incubated for 1 h to measure the absorbance at 450 nm.

ELISA

The concentrations of tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) from serum and cells were detected using the Human TNF-α ELISA kit (ab181421, Abcam, UK) and Human IL-6 ELISA kit (ab178013, Abcam, UK). Following the addition of 50 µL of standards and 5-fold diluted samples to the plate, 100 µL of the enzyme conjugate was added, and the plate was incubated at 37 ℃ for 60 min. After a washing step, a substrate mixture (prepared by combining Solutions A and B) was added, followed by a 15 min incubation at 37 ℃ in the dark. The reaction was then stopped, and the absorbance was measured at 450 nm.

Statistical analysis

SPSS 23.0 was utilized to process all data. T-test and ANOVA were utilized to analyze differences between groups. The receiver operating characteristic (ROC) curve was used to detect the diagnostic value. Chi-squared test was used to analyze associations between the clinicopathological characteristics of PRAE and miR-483-5p level. Multivariate logistic regression was utilized to analyze risk factors for PRAE. The sample size for each group is 3. P < 0.05 was considered statistically significant.

Results

Baseline characteristics between the two groups

Table 1 demonstrated that the control group consisted of 45 males and 48 females, with an average age of 7.03 ± 2.80 years. The PRAE group comprised 52 males and 60 females, with an average age of 7.28 ± 2.85 years. Compared with the control group, the PRAE group showed significant increases in BMI (P < 0.001), ASA grade (P = 0.003), preoperative airway disease (P = 0.004), and anesthesia duration (P = 0.007). However, the two groups were not different in age (P = 0.539) and sex (P = 0.780).

Table 1.

Baseline characteristics between the two groups

Variable Control (n = 93) PRAE (n = 112) P value
Age (years) 7.03 ± 2.80 7.28 ± 2.85 0.539
Sex (male/female) 45/48 52/60 0.780
BMI (kg/m2) 16.58 ± 3.96 19.04 ± 3.86 < 0.001***
 ASA grade (Ⅰ-Ⅱ/Ⅲ) 61/32 50/62 0.003**
 Preoperative airway disease (yes/no) 24/69 51/61 0.004**
 Anesthesia duration (min) 80.92 ± 31.68 95.09 ± 41.70 0.007**

PRAE Perioperative respiratory adverse events, BMI Body mass index, ASA American society of anesthesiologists

 ** P < 0.01. *** P < 0.001

Effects of miR-483-5p on the PRAE

MiR-483-5p was obviously elevated in the PRAE group (Fig. 1A). MiR-483-5p had high diagnostic value in PRAE (AUC = 0.859, 95%CI: 0.8085–0.9096, Sensitivity = 80.36%, Specificity = 78.49%) (Fig. 1B).

Fig. 1.

Fig. 1

Diagnostic value of miR-483-5p in PRAE. A Relative expression of miR-483-5p in PRAE. B The diagnostic value of miR-483-5p in PRAE. *** P < 0.001

Risk factors for PRAE

Multivariate logistic regression demonstrated that in PRAE, BMI (OR = 2.661, P = 0.007), ASA grade (OR = 3.483, P = 0.003), preoperative airway disease (OR = 4.130, P = 0.003), anesthesia duration (OR = 2.330, P = 0.023), and miR-483-5p (OR = 11.772, P < 0.001) were risk factors. However, age (OR = 1.368, P = 0.397) and sex (OR = 0.597, P = 0.272) were not risk factors (Table 2).

Table 2.

Multivariate logistic regression analysis of risk factors for PRAE

Variable OR 95% CI for OR P value
Lower Upper
Age 1.368 0.663 2.823 0.397
Sex 0.597 0.238 1.500 0.272
BMI 2.661 1.299 5.451 0.007**
ASA grade 3.483 1.532 7.919 0.003**
Preoperative airway disease 4.130 1.636 10.427 0.003**
Anesthesia duration 2.330 1.124 4.831 0.023*
miR-483-5p 11.772 5.521 24.887 < 0.001***

PRAE Perioperative respiratory adverse events, BMI Body mass index, ASA American society of anesthesiologists

** P < 0.01. *** P < 0.001

Association between clinicopathological features and miR-483-5p level in PRAE patients

The PRAE group was divided into low- and high-level groups based on the average level of miR-483-5p. As demonstrated in Table 3, miR-483-5p level was closely related to BMI (P = 0.005), ASA grade (P < 0.001), preoperative airway disease (P < 0.001), and anesthesia duration (P < 0.001) in PRAE patients. Nevertheless, in PRAE, miR-483-5p level was not related to age (P = 0.127) or sex (P = 0.244).

Table 3.

Association between clinicopathological features and miR-483-5p expression levels in PRAE

Variable Total miR-483-5p P value
(n = 112) Low(n = 54) High(n = 58)
Age (years)
 ≤ 7 58 32 26 0.127
 > 7 54 22 32
Sex (male/female)
 male 52 22 30 0.244
 female 60 32 28
BMI (kg/m2)
 ≤ 19.04 59 36 23 0.005**
 > 19.04 53 18 35
ASA grade (Ⅰ-Ⅱ/Ⅲ)
 Ⅰ-Ⅱ 50 34 16 < 0.001***
 Ⅲ 62 20 42
Preoperative airway disease (yes/no)
 yes 51 11 40 < 0.001***
 no 61 43 18
Anesthesia duration (min)
 ≤ 95.09 56 37 19 < 0.001***
 > 95.09 56 17 39

PRAE Perioperative respiratory adverse events, BMI Body mass index, ASA American society of anesthesiologists

*** P < 0.001

Effects of miR-483-5p on the inflammation in the PRAE cell model

With the increase in LPS treatment time, proliferation in HPMECs decreased, while the levels of TNF-α and IL-6 increased (Fig. 2A, B, C). Finally, HPMECs treated with 1 µg/mL LPS at 24 h were selected as the PRAE cell model. MiR-483-5p was overexpressed or inhibited in the PRAE cell model, which was verified (Fig. 3A). In the PRAE cell model, overexpression of miR-483-5p reduced proliferation, while inhibition of miR-483-5p increased proliferation (Fig. 3B). In addition, overexpression of miR-483-5p increased the levels of TNF-α and IL-6, while inhibition of miR-483-5p reduced the levels of TNF-α and IL-6 (Fig. 3C, D).

Fig. 2.

Fig. 2

HPMECs were treated with 1 µg/mL of LPS for different time. A Cell viability in HPMECs. B The concentration of TNF-α. C The concentration of IL-6. n = 3. * P < 0.05. ** P < 0.01. *** P < 0.001

Fig. 3.

Fig. 3

Effect of miR-483-5p on the PRAE model. A Relative expression of miR-483-5p. B Cell viability in the PRAE model. C The concentration of TNF-α. D The concentration of IL-6. n = 3. ** P < 0.01. *** P < 0.001

Expression of miR-483-5p in the multicellular human alveolar model

After LPS treatment in the multicellular human alveolar model, miR-483-5p expression was significantly increased. MiR-483-5p expression was overexpressed or inhibited in the miR-483-5p mimic group or the miR-483-5p inhibitor group (Fig. 4A). Overexpression of miR-483-5p decreased proliferation, while inhibition of miR-483-5p increased proliferation (Fig. 4B). In addition, in the multicellular human alveolar model, overexpression of miR-483-5p increased TNF-α and IL-6 levels, while inhibition of miR-483-5p reduced TNF-α and IL-6 levels (Fig. 4C, D).

Fig. 4.

Fig. 4

Effects of miR-483-5p in the multicellular human alveolar model treated with LPS after overexpression or inhibition of miR-483-5p. A Relative expression of miR-483-5p in the multicellular human alveolar model. B Cell viability in the multicellular human alveolar model. C The concentration of TNF-α. D The concentration of IL-6. n = 3. ** P < 0.01. *** P < 0.001

Discussion

The major adverse events during anesthesia include respiratory diseases, drug errors, heart diseases, and neurological diseases [18]. At present, the number of pediatric surgical cases is on the rise worldwide. In pediatric anesthesia, PRAE is the most common factor leading to serious complications [19] and is very common among children [20], imposing a heavy burden on families. Due to the complexity of the causes of PRAE, there are currently no effective preventive management methods. Therefore, we sought to identify a biomarker for PRAE. Recently, miR-483-5p has been confirmed to participate in various diseases. For example, it aggravates endothelial cell injury in atherosclerosis [21]; In Alzheimer’s disease, miR-483-5p is abnormally overexpressed and reduces TAU phosphorylation by regulating ERK1/2. Additionally, miR-483-5p is highly expressed in lung cancer and affects the apoptosis of lung cancer cells [22]. This evidence demonstrates that miR-483-5p plays a crucial role in respiratory diseases, neurological diseases, and cardiovascular diseases, suggesting its likely association with perioperative adverse events. Given miR-483-5p’s link to various lung diseases, its possible involvement in PRAE warrants investigation. In our study, miR-483-5p was increased and had a significant diagnostic value in PRAE, indicating its potential as a diagnostic marker. To further explore whether miR-483-5p could serve as a biomarker for PRAE, we investigated the relationship between miR-483-5p and clinical indicators of PRAE. We found that miR-483-5p was closely linked to BMI, ASA grade, preoperative airway disease, and anesthesia duration, further supporting its potential as a biomarker for PRAE.

Multiple risk factors contribute to PRAE. Childhood obesity is associated with many respiratory diseases, and general anesthesia may exacerbate this effect [23]. Studies show that overweight and obese children have a higher probability of developing PRAE than normal children [24]. Moreover, it has been reported that ASA grade is an independent risk factor for PRAE [25]. Preoperative airway disease significantly impacts PRAE risk. Patients with obstructive sleep apnea syndrome experience PRAE more frequently [26]. Asthma patients face increased perioperative morbidity and mortality due to bronchospasm and hypoxemia, making children with asthma particularly vulnerable to PRAE [27]. Upper respiratory tract infection (URI) is another known risk factor [28]. These factors are all independent risk factors for PRAE, consistent with our results. Additionally, miR-483-5p was identified as a risk factor for PRAE.

As mentioned earlier, PRAE encompasses many symptoms [12]. Symptoms such as laryngeal spasm and lung infection may lead to serious lung diseases [29, 30]. Studies have shown that the decreased proliferation of pulmonary microvascular endothelial cells (PMECs) is associated with various pulmonary diseases [31, 32], which is consistent with the results of this study. Anesthesia for children with URI increases the risk of PRAE [33]. Upper respiratory tract viruses often trigger uncontrolled inflammation [34], suggesting that inflammation accompanies both URI and PRAE. In this study, LPS was used to construct the multicellular human alveolar model and PRAE cell model to further explore the function of miR-483-5p in PRAE. Multiple evidence have confirmed that miR-483-5p is linked to inflammatory responses. In inflammatory diseases such as chronic hepatitis C and atopic dermatitis, miR-483-5p shows an upregulation trend [35, 36]. In addition, miR-483-5p also affects proliferation. In atherosclerosis, the reduction of miR-483-5p increases proliferation [21]. Moreover, in human granulosa cells, miR-483-5p is also related to proliferation [37]. These findings align with our observations regarding the effect of miR-483-5p on proliferation and inflammatory factors.

Alveolar type II cells are essential for maintaining lung integrity and homeostasis. They are among the most extensively studied cell types for understanding the physiological and pathological mechanisms of many lung diseases [38]. In the lungs, macrophages are crucial for maintaining tissue homeostasis and providing frontline defense against pathogens [39]. Monocytes can differentiate into dendritic cells under inflammatory conditions [40]. The cytokine response characteristics of the multicellular human alveolar model after LPS stimulation closely matched those of perioperative pulmonary inflammation. The expression trend of miR-483-5p in it is also the same as that in the PRAE patients, further verifying the role of miR-483-5p in PRAE.

This research offers three key innovations. Firstly, we established an in vitro PRAE model using HPMECs to simulate lung injury. Secondly, we also provided a new risk factor, miR-483-5p, for PRAE. Third, we proposed biomarkers that provide new insights into preventing and treating PRAE.

However, this study also has limitations. Firstly, the sample size was limited. The youngest PRAE child in this study was three years old, and children under three years old were not included, which may have affected the reliability of the results. Secondly, in vitro cell experiments cannot simulate the age stage of patients. Finally, there is currently a lack of animal experiments exploring the specific molecular mechanism of miR-483-5p in PRAE. We may further explore the pathogenesis of PRAE by creating animal models, and at the same time, prove the reliability of this study by expanding the sample size.

Overall, miR-483-5p was increased and had high diagnostic value in PRAE. MiR-483-5p might participate in PRAE in children by regulating cell viability and inflammatory factors, indicating that it might be a biomarker in PRAE.

Acknowledgements

Not applicable.

Authors’ contributions

XXZ, RQY, ML, and YLY conceptualized and designed the study. XXZ, RQY, JL, and XTH collected, organized, and drafted the information. XXZ, RQY, and XNM analyzed the data. XXZ and JL wrote the manuscript. ML and YLY performed manuscript revision. All the authors have read and approved the manuscript.

Funding

This study was funded by Advanced Specialty Nursing Base of Shanghai Jiao Tong University School of Nursing (NX2023jd); Community Medicine Professional Committee, Shanghai Association of Chinese Integrative Medicine (2023SQ05); Community Medicine and Health Management Research Topics; Outstanding Nursing Talent Program-LinkedIn Cultivation, Shanghai Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine (JYHRC22-L04).

Data availability

All data generated or analyzed during this study are included in this article. Further enquiries can be directed to the corresponding author.

Declarations

Ethics approval and consent to participate

This study was approved by the Ethics Committee of Affiliated Hospital of Gansu Medical College and received informed consent from the guardians of the children’s patients. The procedures used in this study adhere to the tenets of the Declaration of Helsinki.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Xingxing Zhao and Ruiqi Yan contributed equally to this work.

Contributor Information

Min Li, Email: limin744000@163.com.

Yuelai Yang, Email: yangyuelaish@163.com.

References

  • 1.Klučka J, Štourač P, Štoudek R, Ťoukálková M, Harazim H, Kosinová M. Controversies in Pediatric Perioperative Airways. BioMed research international. 2015;2015:368761. [DOI] [PMC free article] [PubMed]
  • 2.Lee HJ, Woo JH, Cho S, Oh HW, Joo H, Baik HJ. Risk factors for perioperative respiratory adverse events in children with recent upper respiratory tract infection: A Single-Center-Based retrospective study. Ther Clin Risk Manag. 2020;16:1227–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Liao R, Zhou Z, Wang X, Shao H. Impact of Propofol administered before extubation on respiratory adverse events in pediatric patients undergoing tonsillectomy and adenoidectomy: A randomized controlled trial. Br J Hosp Med (London England: 2005). 2024;85(11):1–15. [DOI] [PubMed] [Google Scholar]
  • 4.von Ungern-Sternberg BS, Ramgolam A, Hall GL, Sly PD, Habre W. Peri-operative adverse respiratory events in children. Anaesthesia. 2015;70(4):440–4. [DOI] [PubMed] [Google Scholar]
  • 5.Tait AR, Voepel-Lewis T, Christensen R, O’Brien LM. The STBUR questionnaire for predicting perioperative respiratory adverse events in children at risk for sleep-disordered breathing. Paediatr Anaesth. 2013;23(6):510–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Fehlmann T, Ludwig N, Backes C, Meese E, Keller A. Distribution of MicroRNA biomarker candidates in solid tissues and body fluids. RNA Biol. 2016;13(11):1084–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Leng C, Sun J, Xin K, Ge J, Liu P, Feng X. High expression of miR-483-5p aggravates sepsis-induced acute lung injury. J Toxicol Sci. 2020;45(2):77–86. [DOI] [PubMed] [Google Scholar]
  • 8.Cecchini S, Di Rosa M, Fantechi L, Mecozzi S, Matacchione G, Giuliani A, Monsurrò V, Zoppi L, Cardelli M, Galeazzi R, et al. Relationship between imaging-derived parameters and Circulating MicroRNAs to study the degree of lung involvement in hospitalized geriatric patients with COVID-19 pneumonia. Geriatr Gerontol Int. 2024;24(9):962–72. [DOI] [PubMed] [Google Scholar]
  • 9.Zhang X, Guo J, Fan S, Li Y, Wei L, Yang X, Jiang T, Chen Z, Wang C, Liu J, et al. Screening and identification of six serum MicroRNAs as novel potential combination biomarkers for pulmonary tuberculosis diagnosis. PLoS ONE. 2013;8(12):e81076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Song Q, Xu Y, Yang C, Chen Z, Jia C, Chen J, Zhang Y, Lai P, Fan X, Zhou X, et al. miR-483-5p promotes invasion and metastasis of lung adenocarcinoma by targeting RhoGDI1 and ALCAM. Cancer Res. 2014;74(11):3031–42. [DOI] [PubMed] [Google Scholar]
  • 11.Zhang M, Li J, Tai G, Li C, Wu H. Overexpression of miR-483-5p predicts venous thrombo-embolism onset in patients with lung cancer especially in high BMI cases. Acta Biochim Pol. 2023;70(2):247–52. [DOI] [PubMed] [Google Scholar]
  • 12.Li L, Zhang Z, Yao Z, Wang H, Wang H, An H, Yao J. The impact of laryngeal mask versus other airways on perioperative respiratory adverse events in children: A systematic review and meta-analysis of randomized controlled trials. Int J Surg (London England). 2019;64:40–8. [DOI] [PubMed] [Google Scholar]
  • 13.Ngo TH, Tran SK. Role of polymorphisms and MicroRNA levels in predicting cardiovascular events in patients with acute myocardial infarction. World J Cardiol. 2025;17(10):109961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Yu Y, Park S, Lee H, Kwon EJ, Park HR, Kim YH, Lee SG. Exosomal hsa-miR-335-5p and hsa-miR-483-5p are novel biomarkers for rheumatoid arthritis: A development and validation study. Int Immunopharmacol. 2023;120:110286. [DOI] [PubMed] [Google Scholar]
  • 15.Regli A, von Ungern-Sternberg BS. Diagnosis and management of respiratory adverse events in the operating room. Curr Anesthesiology Rep. 2015;5(2):156–67. [Google Scholar]
  • 16.Barosova H, Drasler B, Petri-Fink A, Rothen-Rutishauser B. Multicellular human alveolar model composed of epithelial cells and primary immune cells for hazard assessment. J Visualized Experiments: JoVE 2020;(159):e61090. [DOI] [PubMed]
  • 17.Drasler B, Karakocak BB, Tankus EB, Barosova H, Abe J, Sousa de Almeida M, Petri-Fink A, Rothen-Rutishauser B. An inflamed human alveolar model for testing the efficiency of Anti-inflammatory drugs in vitro. Front Bioeng Biotechnol. 2020;8:987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.de Santana Lemos C, de Brito Poveda V. Adverse events in anesthesia: an integrative review. J Perianesthesia Nursing: Official J Am Soc PeriAnesthesia Nurses. 2019;34(5):978–98. [DOI] [PubMed] [Google Scholar]
  • 19.Hii J, Templeton TW, Sommerfield D, Sommerfield A, Matava CT, von Ungern-Sternberg BS. Risk assessment and optimization strategies to reduce perioperative respiratory adverse events in pediatric anesthesia-Part 1 patient and surgical factors. Paediatr Anaesth. 2022;32(2):209–16. [DOI] [PubMed] [Google Scholar]
  • 20.Kim EH, Lee SH, Kim JK, Park YH, Kang P, Park JB, Ji SH, Jang YE, Lee JH, Kim JT, et al. Effect of tulobuterol patch versus placebo on the occurrence of respiratory adverse events in children undergoing tonsillectomies: A randomized controlled trial. Anesth Analg. 2023;136(6):1067–74. [DOI] [PubMed] [Google Scholar]
  • 21.Zhu H, Liang H, Gao Z, Zhang X, He Q, He C, Cai C, Chen J. MiR-483-5p downregulation alleviates ox-LDL induced endothelial cell injury in atherosclerosis. BMC Cardiovasc Disord. 2023;23(1):521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Wang F, Zhang X, Zhong X, Zhang M, Guo M, Yang L, Li Y, Zhao J, Yu S. Effect of miR-483-5p on apoptosis of lung cancer cells through targeting of RBM5. Int J Clin Exp Pathol. 2018;11(6):3147–56. [PMC free article] [PubMed] [Google Scholar]
  • 23.Kiekkas P, Stefanopoulos N, Bakalis N, Kefaliakos A, Konstantinou E. Perioperative adverse respiratory events in Overweight/Obese children: systematic review. J Perianesthesia Nursing: Official J Am Soc PeriAnesthesia Nurses. 2016;31(1):11–22. [DOI] [PubMed] [Google Scholar]
  • 24.Ulrici J, Hempel G, Sasse M, Vollrath J, Höhne C. [Perioperative adverse respiratory events in overweight and obese children]. Anaesthesist. 2016;65(12):911–6. [DOI] [PubMed] [Google Scholar]
  • 25.Tao S, Zhang T, Wang K, Xie F, Ni L, Mei Z, Song S. Identification of the risk factors in perioperative respiratory adverse events in children under general anesthesia and the development of a predictive model. Translational Pediatr. 2021;10(7):1877–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Xará D, Mendonça J, Pereira H, Santos A, Abelha FJ. Adverse respiratory events after general anesthesia in patients at high risk of obstructive sleep apnea syndrome. Brazilian J Anesthesiology (Elsevier). 2015;65(5):359–66. [DOI] [PubMed] [Google Scholar]
  • 27.Kamassai JD, Aina T, Hendrix JM. Anesthesia Management in Patients with Asthma. In: StatPearls. edn. Treasure Island (FL) ineligible companies. Disclosure: Titilopemi Aina declares no relevant financial relationships with ineligible companies. Disclosure: Joseph Maxwell Hendrix declares no relevant financial relationships with ineligible companies.: StatPearls Publishing Copyright © 2025, StatPearls Publishing LLC.; 2025. [PubMed]
  • 28.Kim SY, Kim JM, Lee JH, Kang YR, Jeong SH, Koo BN. Perioperative respiratory adverse events in children with active upper respiratory tract infection who received general anesthesia through an orotracheal tube and inhalation agents. Korean J Anesthesiology. 2013;65(2):136–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Budhathoki A, Wu Y. Negative pressure pulmonary edema: A case report. JNMA. 2020;58(227):491–3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Hui S, Fowler AJ, Cashmore RMJ, Fisher TJ, Schlautmann J, Body S, Lan-Pak-Kee V, Webb M, Kyriakides M, Ng JY, et al. Routine postoperative noninvasive respiratory support and pneumonia after elective surgery: a systematic review and meta-analysis of randomised trials. Br J Anaesth. 2022;128(2):363–74. [DOI] [PubMed] [Google Scholar]
  • 31.Shen K, Wang X, Wang Y, Jia Y, Zhang Y, Wang K, Luo L, Cai W, Li J, Li S, et al. miR-125b-5p in adipose derived stem cells exosome alleviates pulmonary microvascular endothelial cells ferroptosis via Keap1/Nrf2/GPX4 in sepsis lung injury. Redox Biol. 2023;62:102655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Zhao P, Zhu J, Bai L, Ma W, Li F, Zhang C, Zhao L, Wang L, Zhang S. Neutrophil extracellular traps induce pyroptosis of pulmonary microvascular endothelial cells by activating the NLRP3 inflammasome. Clin Exp Immunol. 2024;217(1):89–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Jarraya A, Kammoun M, Ammar S, Feki W, Kolsi K. Predictors of perioperative respiratory adverse events among children with upper respiratory tract infection undergoing pediatric ambulatory ilioinguinal surgery: a prospective observational research. World J Pediatr Surg. 2023;6(2):e000524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Li J, Mao N, Wang Y, Deng S, Chen K. Novel insights into the ROCK-JAK-STAT signaling pathway in upper respiratory tract infections and neurodegenerative diseases. Mol Therapy: J Am Soc Gene Therapy. 2025;33(1):32–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Lv Y, Qi R, Xu J, Di Z, Zheng H, Huo W, Zhang L, Chen H, Gao X. Profiling of serum and urinary MicroRNAs in children with atopic dermatitis. PLoS ONE. 2014;9(12):e115448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Cabral BCA, Hoffmann L, Bottaro T, Costa PF, Ramos ALA, Coelho HSM, Villela-Nogueira CA, Ürményi TP, Faffe DS, Silva R. Circulating MicroRNAs associated with liver fibrosis in chronic hepatitis C patients. Biochem Biophys Rep. 2020;24:100814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Liu Y, Mei Q, Yang J, Shen Q, Zou M, Li J, Li H, Zhang L, Xiang W. hsa-miR-320a-3p and hsa-miR-483-5p levels in human granulosa cells: promising bio-markers of live birth after IVF/ICSI. Reproductive Biology Endocrinology: RB&E. 2022;20(1):160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wu J, Wang Y, Liu G, Jia Y, Yang J, Shi J, Dong J, Wei J, Liu X. Characterization of air-liquid interface culture of A549 alveolar epithelial cells. Brazilian J Med Biol Res = Revista Brasileira De Pesquisas Medicas E Biologica. 2017;51(2):e6950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.T’Jonck W, Bain CC. The role of monocyte-derived macrophages in the lung: it’s all about context. Int J Biochem Cell Biol. 2023;159:106421. [DOI] [PubMed] [Google Scholar]
  • 40.Qu C, Brinck-Jensen NS, Zang M, Chen K. Monocyte-derived dendritic cells: targets as potent antigen-presenting cells for the design of vaccines against infectious diseases. Int J Infect Diseases: IJID : Official Publication Int Soc Infect Dis. 2014;19:1–5. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analyzed during this study are included in this article. Further enquiries can be directed to the corresponding author.


Articles from BMC Pediatrics are provided here courtesy of BMC

RESOURCES