Skip to main content
BMC Cancer logoLink to BMC Cancer
. 2026 Jan 31;26:308. doi: 10.1186/s12885-026-15654-7

P300 enhances glycolysis and dox resistance in DLBCL by upregulating HK2 expression through histone lactylation

Xiangxiang Song 1,2, Huazhen Fu 3, Xing Zhong 1,2, Nasha Yu 1,2, Weiming Zhang 1,2,
PMCID: PMC12947486  PMID: 41618236

Abstract

Background

Diffuse large B-cell lymphoma (DLBCL), the most common lymphocytic malignancy, faces treatment challenges due to drug resistance. Glycolysis has been implicated in tumor resistance, whereas P300, an epigenetic regulator, is known to facilitate glycolysis and enhance cancer resistance. However, the underlying mechanisms linking these factors remain unreported.

Methods

Bioinformation analysis of P300 in DLBCL was conducted. P300 was overexpressed or silenced in the Doxorubicin (Dox)-sensitive or Dox-resistant DLBCL cell line, respectively. The cellular function assays were performed, and the expression of apoptosis-related and glycolysis-related proteins was detected to examine the role of P300 in the Dox resistance of DLBCL, which was further validated in vivo using xenograft models. Subsequently, rescue experiments were conducted. Chromatin immunoprecipitation (ChIP) and luciferase experiments were used to explore the underlying mechanism. ChIP was performed to measure histone lactylation levels at the Hexokinase 2 (HK2) promoter. A luciferase reporter assay was used to determine whether P300 activates hypoxia-inducible factor-1 (HIF-1) and to investigate the relationship between HIF-1 and the HK2 promoter.

Results

P300 expression was associated with poor prognosis of DLBCL and P300-related DEGs are mainly enriched in glycolysis, apoptosis, and other related pathways. P300 expression was higher in SU-DHL-2/ADM cells than in SU-DHL-2 cells. P300 overexpression promoted the Dox resistance of the Dox-sensitive DLBCL cell line (SU-DHL-2), while P300 silencing attenuated the Dox resistance both in vitro and in vivo. Besides, we confirmed that P300 expression facilitated glycolysis, which was associated with the Dox resistance of DLBCL. Mechanistically, P300-facilitated glycolysis induced the accumulation of lactate, which contributed to the histone lactylation on the HK2 promoter (fragment of -200 to + 1) and stimulated its transcription by interacting with HIF-1, which further bound to the HK2 promoter.

Conclusion

Dox resistance in DLBCL was mediated by P300-facilitated glycolysis.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12885-026-15654-7.

Keywords: DLBCL, Dox resistance, P300, Glycolysis, Histone lactylation, HK2

Introduction

Diffuse large B-cell lymphoma (DLBCL), the most prevalent lymphocytic malignancy among adults, accounts for approximately 30% of B-cell cancers worldwide [1]. Approximately two-thirds of DLBCL patients have received the R-CHOP regimen and were cured in the past decades [2]. However, drug resistance in DLBCL has become a growing concern as DLBCL relapse and other refractory diseases have occurred in 40% of patients with poor prognosis in recent years [3]. As a vital anti-cancer drug in R-CHOP chemotherapy, Doxorubicin (Dox, also called adriamycin, ADM) has been increasingly researched due to the Dox resistance in DLBCL [4, 5]. As such, there is an urgent need to explore the underlying mechanism of Dox resistance in DLBCL, thus identifying novel therapeutic targets and heightening treatment effects.

Epigenetic alterations are important causes of the malignant development of tumors. As key epigenetic regulatory factors, histone acetyltransferases (HATs) catalyze the invertible lactylation of proteins, which is the primary epigenetic regulatory mechanism related to multiple diseases, including cancer [6]. P300, the HAT paralog, is a vital transcriptional co-activator that participates in diverse physiological and pathological processes by inducing histone lactylation [7]. It has been reported that P300 plays a pro-cancer role in multiple cancers, such as lung cancer, colorectal carcinoma, and so on [8]. In detail, P300 contributes to cell proliferation, migration, survival, and especially, drug resistance in cancers [9]. P300 can also interact with other epigenetic regulators in cancer. For example, in castration-resistant prostate cancer, P300 can form a complex with specificity protein 1 (SP1). P300 mediates the transcriptional up-regulation of methyltransferase like 1 (METTL1) by binding to the promoter region of the METTL1 gene through SP1. Then, METTL1 promotes the progression of castration-resistant prostate cancer by enhancing the stability of cyclin-dependent kinase 14 mRNA through 7-Methylguanosine modification [10]. In addition, in pancreatic cancer, active Src in the nucleus is complexed with P300. The complex is bound to the promoters of high-mobility group at-hook 2 and set and MYND domain-containing protein 3 genes, regulating their expression and promoting the migration and invasiveness of pancreatic tumor cells [11]. In prostate cancer, transcription factor IRF-1 recruits P300 to the CD274 promoter, where P300 promotes cluster of differentiation 274 transcription via histone lactylation, leading to high programmed death-ligand 1 (PD-L1) expression and immune therapy resistance. P300/CBP inhibitors block this interaction, suppress PD-L1 expression, and enhance immunotherapy efficacy [12]. These examples establish P300 as a central epigenetic scaffold—yet its role in coordinating histone lactylation for metabolic drug resistance remains unknown, highlighting the novelty of our DLBCL findings. Additionally, P300 has been proven to upregulate the activities of glycolysis-crucial enzymes, thus promoting glycolysis [13]. Interestingly, enhanced glycolysis confers resistance to anti-cancer therapies in tumors [14, 15]. More importantly, recent research has uncovered specific mechanisms of histone lactylation in glycolysis-mediated drug resistance. A study [16] demonstrated that lactate, as an oncometabolite, promotes breast cancer progression by inducing histone H3K18 lactylation, which directly activates cellular myelocytomatosis oncogene transcription through chromatin remodeling. This process enhances the expression of glycolytic enzymes (e.g., HK2) and multidrug resistance proteins, thereby conferring chemoresistance to Dox. Taken together, the regulatory effect of P300 on cancer resistance may be accomplished through glycolysis, which is a target worthy of in-depth research.

The growth and progression of tumors are dependent on the appropriate microenvironment and can be influenced by diverse metabolites such as lactic acid (LA) [17]. Compared to normal cells, tumor cells tend to obtain energy via glycolysis under aerobic or anaerobic conditions, which induces the accumulation of LA in the tumor microenvironment. It has been reported that HIF-1 often couples to P300 to form an active transcription factor, which activates the hypoxia response and thus promotes glycolysis [18, 19]. As the end product of glycolysis, LA also acts as a substrate of histone lactylation, a novel histone modification that is conducive to the growth, metastasis, and drug resistance of tumors [20]. Hexokinase 2 (HK2), a key glycolytic enzyme [21], is highly expressed in various cancers and strongly linked to tumor cell proliferation, migration, and invasion [22, 23]. Research has shown that the induction of HK2 expression in activated hepatic stellate cells is essential for the histone lactation-mediated gene expression process [24]. In this study, we linked glycolysis and histone lactylation in the Dox resistance of DLBCL, and preliminarily investigated the underlying mechanism.

Materials and methods

Reagent

Roswell Park Memorial Institute (RPMI) 1640 medium (31800105), fetal bovine Serum (FBS, 10099141 C), penicillin/streptomycin (Pen/Strep, 15140122), and Opti-MEM low serum medium (31985070) were obtained from Gibco (Semitic, NY, USA). Adriamycin (ADM, HY-15142 A), 2-Deoxy-D-glucose (2DG, HY-13966), and Fosfructose (HY-106950) were purchased from MedChemExpress (New Jersey, USA). Lipofectamine™ 2000 (Lipo 2000, 11668019) transfection reagent was obtained from Thermo Fisher (Waltham, MA, USA). Puromycin (P8230) was gained from Solarbio (Beijing, China). The MTT reagent (M2128), Dox (D1515), and hematoxylin (H3136) were purchased from Sigma-Aldrich (St. Louis, MO, USA). DMSO (30072418) was obtained from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). The citrate buffer (G1202) and DAB solution (G1212) were obtained from Servicebio (Wuhan, China).

Data download and bioinformation analysis

The Cancer Genome Atlas (TCGA) database (https://www.cancer.gov/about-nci/organization/ccg/research/structural-genomics/tcga) was used to gather RNA-seq data and clinical information about DLBCL. The correlation between P300 and the survival probability and prognostic analysis in DLBCL patients was conducted. Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses and Gene Set Enrichment Analysis (GSEA) were performed to analyse the P300-related differentially expressed genes (DEGs).

Cell culture

The DLBCL cell lines, SU-DHL-2 (YDT-0733), its adriamycin‑resistant strain (SU-DHL-2/ADM cells, YDT-0755), and U-2932 (YDT-0681) were purchased from INDIT Bio-Technology Co., Ltd. (Hangzhou, China). SU-DHL-2 cells and U-2932 cells were cultured in RPMI 1640 medium supplemented with 10% FBS and 1% Pen/Strep in a 37℃ cell incubator with 5% CO2. SU-DHL-2/ADM cells were cultivated under the same conditions, while the medium was supplemented with ADM to a final concentration of 0.5 µg/mL [25].

Transient transfection

pcDNA3.1-P300 and the empty pcDNA3.1 vector, which was purchased from Youbio (Hunan, China) were used to construct the P300 overexpressed and the control SU-DHL-2 cells (P300 transcript: NM_001429). shRNA-P300 and shRNA-NC obtained from Tsingke (Beijing, China) were utilized to construct the P300 silenced and the control SU-DHL-2/ADM cells. According to the manufacturer’s specification, Lipo 2000 and Opti-MEM low-serum medium were used for transient transfection (ShRNA-P300 sense: CAAUUCCGAGACAUCUUGAGA; ShRNA-P300 antisense: UCUCAAGAUGUCUCGGAAUUG).

Construction of P300 stably silenced SU-DHL-2 cells

Lentivirus-mediated shRNA targeting P300 (Lenti-sh-P300) and the corresponding control lentivirus-mediated shRNA (Lenti-sh-control) were obtained from Aikangde Biotechnology Co. LTD (Suzhou, China). SU-DHL-2 cells were seeded into the cell culture flask, cultivated to 60–70% confluence, and then co-incubated with Lenti-sh-P300 or Lenti-sh-control for 48 h. 1 µg/mL puromycin was used to screen the P300 stably silenced SU-DHL-2 cells.

Methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay

The MTT assay was used for cell survival detection under the dose-dependent effect of Dox and cell proliferation detection in SU-DHL-2 and SU-DHL-2/ADM cells. Cell suspensions were seeded into 96-well plates at a density of 2 × 103 cells/well (100 µL per well). For cell proliferation determination, cells were then cultured in an incubator for 0, 24, 48, and 72 h. For the cell survival detection under the dose-dependent effect of Dox, cells were then incubated with Dox respectively at concentrations of 0, 0.5, 1, 2, and 4 µM for 24 h. The subsequent procedures were the same. The liquid supernatant was removed and 1 mg/mL MTT reagent was added (50 µL per well). After 3 h of incubation at 37℃, DMSO was added to the plate (150 µL per well) and the mixture was shaken on a horizontal shaker until the crystallization dissolution was visible. The results were examined using a microplate reader (Molecular Device, California, USA).

Flow cytometry

Flow cytometry was performed to determine the apoptosis of SU-DHL-2 and SU-DHL-2/ADM cells after pretreatment. The procedures of detection were accomplished using an Annexin V-FITC/7-AAD apoptosis detection kit (Procell, Wuhan, China, P-CA-202) according to the manufacturer’s instructions. Shortly, the results were examined using a flow cytometer.

Enzyme-linked immunosorbent assay (ELISA)

ELISA was performed to examine the LA content in the supernatants of SU-DHL-2 and SU-DHL-2/ADM cell culture fluid. The steps of ELISA were conducted in line with the producer’s instructions using an ELISA detection kit (MEIMIAN, Jiangsu, China, 12907). A microplate reader was used to examine the results of ELISA at a wavelength of 450 nm.

Western blotting (WB)

The processes of WB were performed as the published literature [26]. In brief, the total proteins of pretreated SU-DHL-2, SU-DHL-2/ADM cells and U-2932 cells were extracted and the concentration was examined using a BCA Protein Assay kit (Takara, Beijing, China). Then the samples were separated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred onto PVDF membranes. Membranes were incubated in 5% skim milk for 1 h at room temperature. After three times washes, the membranes were successively incubated in the primary antibodies at 4℃ overnight and in the corresponding secondary antibodies at room temperature for 1 h. The protein bands were washed again and visualized using an integrated chemiluminescence imager (Clinx, Shanghai, China, ChemiScope S6). Details of the antibodies used are shown in Table 1.

Table 1.

Information of antibodies

Name Brand Number Dilution rate Applications
β-actin CST #4970 1:5000 WB
P300 affinity AF5360 1:1000 WB, IHC
Mcl-1 CST #5453 1:1000 WB, IHC
Bcl-2 CST #15,071 1:1000 WB
Bcl-XL CST #2764 1:1000 WB
Bax abcam ab32503 1:1000 WB
Bak CST #6947 1:2000 WB
HK2 CST #2867 1:2000 WB, IHC
GLUT1 CST #12,939 1:1000 WB, IHC
Ki67 Santa Cruz sc-376,764 1:50 IHC
H3K18la PTM Bio PTM-1406RM 1:2000/1:50 WB/ChIP

Animal experiments

The experimental steps in this work were in accordance with the principles of the Guiding Principles for the Breeding and Use of Animals in China. All animals were housed in a sterile barrier environment with a 12/12-hour light/dark cycle and ambient temperature maintained at 22 °C. Experiments commenced after a 7 day acclimatization period. To establish the xenograft tumor tissues, 18 BALB/c female nude mice (5-week-old) were purchased from Slaccas (Shanghai, China). The mice were subcutaneously injected with 8 × 10⁶ P300-silenced SU-DHL-2 cells or control SU-DHL-2 cells, respectively, and then dosed with 1.5 mg/kg Dox or not. The mice were divided into three groups: Lenti-sh-control + control (n = 6), Lenti-sh-control + Dox (n = 6), and Lenti-sh-P300 + Dox (n = 6). Once the tumors were grown to 2000 mm3, all experimental mice were humanely euthanized via cervical dislocation following deep anesthesia induced by intraperitoneal injection of pentobarbital sodium (50 mg/kg). The weight and volume of the isolated tumor tissues were measured and recorded. Tumor volume was calculated using the formula V = 1/2 × (length × width2). Tumor dimensions were measured with digital calipers to record the longest diameter (length) and the perpendicular shorter diameter (width).

Immunohistochemistry (IHC)

The expression of P300, Mcl-1, HK2, GLUT1, and Ki67 of the tumor tissues was determined by the IHC assay. The tumor tissues were paraffin-embedded, cut into slices, and then de-paraffinized. Shortly, the slices experienced antigen retrieval with citrate buffer and endogenous peroxidase removal with 3% H2O2. Then the slices were soaked in 3% BSA for 1 h at room temperature. After washing, slices were successively incubated in the primary antibodies overnight and in the corresponding secondary antibodies for 1 h. Then DAB solution and hematoxylin were separately utilized for staining and counterstaining. A microscope was used to observe the staining results.

Terminal deoxynucleotidyl transferase mediated dUTP nick-end labeling (TUNEL) assay

The cell apoptosis of the tumor tissues was detected with the TUNEL assay. After paraffin embedding, the tumor tissues were cut into slices and de-paraffinized. Then a TUNEL cell apoptosis detection kit (Abcam, Cambridge, UK, ab66110), and the procedures of TUNEL were proceeded according to the manufacturer’s directions. A microscope was used to observe the results.

Chromatin immunoprecipitation (ChIP)

The ChIP assay was performed using the ChIP detection kit (Thermo Fisher, Waltham, MA, USA, 26157) according to the manufacturer’s instructions. The DLBCL cells (SU-DHL-2 and U-2932) transfected with pcDNA3.1 (control) or P300-overexpression plasmid (P300-OE) were fixed, lysed, and sonicated at 4 °C to obtain − 1000 to + 200 bp sheared DNA fragments of HK2 promoter. Following pre-clearing, immunoprecipitation was performed overnight at 4 °C using anti-H3K18la antibody (PTM Bio, Hangzhou, China, PTM-1406RM). Complexes were washed, eluted, and reverse-crosslinked at 65 °C overnight. DNA was purified using a DNA Clean-Up Kit (Omega, Norcross, GA, USA, D6296-01) for qPCR to validate and quantify HK2 promoter enrichment. The promoter sequence of HK2 and the specific primer information are provided in supplementary file 1.

Dual-luciferase reporter (DLR) assay

The JASPAR website (https://jaspar.genereg.net/) was utilized for the forecast of the potential binding site of HIF-1 on the HK2 promoter. Then, the 3’UTR region of HK2 mRNA, which contained the putative binding site of HIF-1 (located at -200 to + 1 bp of the HK2 promoter), along with its corresponding mutated sequences, were amplified and subsequently cloned into the blank PGL3 vectors (Promega, Madison, WI, USA), (the wild-type and mutated sequences are provided in supplementary file 1). The generated PGL3-HK2 promoter WT and PGL3-HK2 promoter Mut and the empty PGL3 were respectively transfected into the P300 overexpressed and the control DLBCL cells (SU-DHL-2 and U-2932) utilizing Lipo 2000. After 48 h, cells were lysed, and firefly luciferase activity was measured using a dual-luciferase reporter assay system (Promega, Madison, WI, USA, E2920). Relative luciferase activity was calculated to assess HIF-1-mediated regulation of HK2 promoter activity, with PGL3 as the blank control.

Statistical analysis

The statistical analysis of the representative data was performed utilizing GraphPad Prism 6.0 and are presented as mean ± standard deviation (SD). Statistical comparisons between two groups were assessed by t-test and that of multiple groups was evaluated by one-way ANOVA. **P < 0.01, *P < 0.05 were deemed significant. The results were obtained from at least three independent experiments.

Results

P300 overexpression contributed to the dox resistance and Glycolysis of DLBCL

Given that P300 mediates the resistance of bladder cancer to Dox [27], we wondered whether P300 could also regulate the Dox resistance in DLBCL. Firstly, we used WB analysis to detect the expression of P300 in SU-DHL-2 and SU-DHL-2/ADR cells. As shown in Fig. 1A, the expression of P300 was higher in SU-DHL-2/ADM cells than that in SU-DHL-2 cells (**P < 0.01). To explore the effect of P300 on DLBCL, we constructed the P300 overexpressed SU-DHL-2 cells and P300 silenced SU-DHL-2/ADM cells (Fig. 1B, *P < 0.05, **P < 0.01), and examined the phenotypes of the DLBCL cells. The results showed that overexpressing P300 promoted the cell proliferation and survival (under the dose-dependent impact of Dox) of SU-DHL-2 cells, while silencing P300 inhibited that of SU-DHL-2/ADM cells (Fig. 1C&D, *P < 0.05, **P < 0.01). Additionally, P300 overexpression impaired the Dox-mediated cell apoptosis in SU-DHL-2 cells, whereas P300 silence accelerated the apoptosis of SU-DHL-2/ADM cells (Fig. 1E, *P < 0.05, **P < 0.01). Furthermore, P300 has been reported to enhance glycolysis by upregulating key enzymes [28]. Given that LA is its primary metabolite [29], we determined the expression difference of LA, observing an increase in the P300 overexpressed SU-DHL-2 cells compared to the control one. However, the silenced P300 showed the opposite impact in SU-DHL-2/ADM cells (Fig. 1F, *P < 0.05, **P < 0.01). To delve deeper into the role of P300 in DLBCL, we downloaded the clinical data from the TCGA database and analyzed the clinical correlation of DLBCL mRNA. Bioinformatics analysis of P300 in DLBCL revealed that P300 expression was associated with a poor prognosis (Fig. 2A; Table 2), with DEGs primarily enriched in glycolysis, apoptosis, and other related pathways (Fig. 2B&C). For further validation, we determined the expression difference of indexes and proteins that apoptosis-related (anti-apoptosis proteins: Mcl-1, Bcl-2, and Bcl-XL, pro-apoptosis proteins: Bax and Bak) and glycolysis-related (HK2, and GLUT1). The findings showed that the expression of Mcl-1, Bcl-2, Bcl-XL, HK2, and GLUT1 increased, while that of Bax and Bak decreased in the P300 overexpressed SU-DHL-2 cells compared to the control one. However, the silenced P300 showed the opposite impact in SU-DHL-2/ADM cells (Fig. 2D, *P < 0.05, **P < 0.01).

Fig. 1.

Fig. 1

P300 promoted the resistance of SU-DHL-2 cells to Dox. A The P300 expression of P300 in SU-DHL-2 and SU-DHL-2/ADM cells by WB analysis. B SU-DHL-2 cells were transfected with the P300 overexpressed plasmid or the blank pcDNA3.1 vector, and SU-DHL-2/ADM cells were transfected with shRNA-P300 or shRNA-NC. WB was performed to verify the overexpressing and silencing efficiency. β-actin acted as the internal control. C&D The cell proliferation and cell survival (under the Dox dose-dependent effect) of the P300 overexpressed SU-DHL-2 cells and P300 silenced SU-DHL-2/ADM cells, and their corresponding control cells were detected by the MTT assay. E The cell apoptosis of the P300 overexpressed and the control SU-DHL-2 cells with Dox (2 µM 24 h) treated or not, and that of the P300 silenced and the control SU-DHL-2/ADM cells was determined by flow cytometry. F The expression of LA in the P300 overexpressed SU-DHL-2 cells and P300 silenced SU-DHL-2/ADM cells, as well as their corresponding control cells were separately examined by ELISA kit. All experiments were repeated three times. *P < 0.05, **P < 0.01

Fig. 2.

Fig. 2

Bioinformatics analysis of P300 in DLBCL. A Correlation analysis between P300 expression and survival probability of DLBCL. The enriched pathway of P300-related DEGs analysis was conducted by KEGG (B) and (C) GSEA. D The expression of apoptosis and glycolysis-related proteins in the P300 overexpressed SU-DHL-2 cells and P300 silenced SU-DHL-2/ADM cells, as well as their corresponding control cells were separately examined by WB analysis (n = 3). β-actin acted as the internal control. All experiments were repeated three times. **P < 0.01

Table 2.

The correlation between P300 and prognostic analysis in DLBCL

Character Level Low expression of P300 High expression of P300 P
Age ≤ 65 15 (31.3%) 18 (37.5%) 0.355
>65 9 (18.8%) 6 (12.5%)
Gender Female 12 (32.4%) 14 (37.8%) 0.292
Male 3 (8.1%) 8 (21.6%)
Stage 6 (17.1%) 2 (5.7%) 0.034
6 (17.1%) 9 (25.7%)
1 (2.9%) 2 (5.7%)
2 (5.7%) 7 (20.0%)

Subsequently, we investigated the regulatory effect of P300 on the Dox resistance and glycolysis of DLBCL in vivo. We established the xenograft DLBCL models using the P300 stably silenced and the control SU-DHL-2 cells. As shown in Fig. 3A&B, P300 silence further significantly suppressed Dox-inhibited growth of DLBCL (**P < 0.01). In addition, Dox inhibited the expression of P300, Mcl-1, HK2, GLUT1, and Ki67, and the silenced P300 further promoted the impact of Dox (Fig. 3C, *P < 0.05, **P < 0.01). Not surprisingly, silencing P300 also enhanced the facilitating effect of Dox in apoptosis (Fig. 3D, **P < 0.01). To sum up, P300 exhibited a promoting effect on the Dox resistance and glycolysis in DLBCL both in vitro and in vivo.

Fig. 3.

Fig. 3

P300 facilitated the resistance of DLBCL to Dox in vivo. SU-DHL-2/ADM cells were transfected with Lenti-sh-P300 or Lenti-control, and then subcutaneously injected into the mice (n = 6), combined with Dox treated or not. A The tumor tissues were isolated from the mice after euthanasia. B The volume and weight of the tumors were measured and the results were quantified. C The expression of P300, Mcl-1, HK2, GULT1 and Ki67 was detected by IHC. D The cell apoptosis of the tumor tissues was determined by the TUNEL assay. All experiments were repeated three times. *P < 0.05, **P < 0.01

P300-facilitated dox resistance of DLBCL based on its effect on glycolysis

According to reports, P300 stimulates the activity of glycolysis key enzymes, thus promoting glycolysis and regulating the nutrient balance of colon cancer cells [13]. More intriguingly, glycolysis contributes to the drug resistance of non-Hodgkin lymphoma, as inhibiting glycolysis reverts glycolysis-mediated drug resistance and thus enhances the sensitivity of the tumor to chemotherapy [15]. However, whether glycolysis is involved in the regulation of P300 to the drug resistance of cancers is unknown. In view that P300 promoted the Dox resistance and glycolysis in DLBCL, we wondered whether the facilitating impact of P300 on the Dox resistance was accomplished by regulating glycolysis. Hence, we utilized the glycolysis inhibitor 2DG and activator Fosfructose to perform functional rescue experiments. As shown in Fig. 4A, amp and B, 2DG impaired the overexpressed P300-promoted cell proliferation and survival of SU-DHL-2 cells (*P < 0.05, **P < 0.01). Moreover, 2DG impaired the inhibitory impact of P300 overexpression on apoptosis and its promoting impact on glycolysis (Fig. 4C, D&E, *P < 0.05, **P < 0.01). The results were similar in SU-DHL-2/ADM cells. It’s not difficult to see from Figs. 5A, B, C, D&E that silencing P300 inhibited cell proliferation and glycolysis, but promoted cell apoptosis. Nevertheless, Fosfructose could impair these impacts (*P < 0.05, **P < 0.01). Based on these results, we could conclude that P300 facilitated the activity of glycolysis and therefore reduced the sensitivity of DLBCL to Dox.

Fig. 4.

Fig. 4

2DG impaired the overexpressed P300-promoted Dox resistance and glycolysis in SU-DHL-2 cells. SU-DHL-2 cells were transfected with the P300 overexpressed plasmid or the empty pcDNA3.1 vector, followed by treatment with 2 µM Dox for 24 h in all groups, with or without additional treatment with the glycolysis inhibitor 2DG (2 mM 24 h). A&B The MTT assay was carried out to detect the cell proliferation and the cell survival (under the Dox dose-dependent effect). C The flow cytometry was implemented to determine the cell apoptosis. D ELISA was utilized to examine the LA content in the cellular supernatant. E The expression of Mcl-1, HK2, and GLUT1 was detected by the WB assay. β-actin acted as the internal control. All experiments were repeated three times. *P < 0.05, **P < 0.01

Fig. 5.

Fig. 5

Fosfructose impaired the silenced P300-inhibited Dox resistance and glycolysis in SU-DHL-2/ADM cells. SU-DHL-2/ADM cells were transfected with shRNA-P300 or shRNA-NC, followed by treatment with 2 µM Dox for 24 h in all groups, with or without additional treatment with Fosfructose. A&B The MTT assay was carried out to detect the cell proliferation and the cell survival (under the Dox dose-dependent effect). C The flow cytometry was implemented to determine the cell apoptosis. D ELISA was utilized to examine the LA content in the cellular supernatant. E The expression of apoptosis and glycolysis-related proteins was detected by the WB assay. β-actin acted as the internal control. All experiments were repeated three times. *P < 0.05, **P < 0.01

P300 coupled with HIF-1 promoted HK2 expression by upregulating the H3K18la expression in the form of histone lactylation

The above work validated that P300 propelled DLBCL resistant to Dox, yet the fundamental mechanism needs further investigation. Thus, we wondered whether P300 promoted HK2 expression in the form of histone lactylation. Not surprisingly, overexpressing P300 upregulated the H3K18la expression (Fig. 6A, **P < 0.01). The subsequent ChIP assay showed that P300 overexpression significantly enriched histone lactylation on the HK2 promoter in SU-DHL-2 cells (Fig. 6B, *P < 0.05). Specifically, after transfecting with empty pcDNA3.1 vector (as control), baseline lactylation was detected across all promoter regions. P300 overexpression led to significant enrichment of H3K18la in the proximal − 200 to + 1 bp region of HK2 promoter, and its transcriptional activation of the HK2 promoter was functionally dependent on this same region, consistent with P300 driving targeted hyper-lactylation at the core transcriptional start site. For further exploration, we predicted the potential binding site of HIF-1 to the HK2 promoter (Fig. 6C). The DLR assay (Fig. 6D, *P < 0.05) in SU-DHL-2 cells demonstrated that the transcriptional activation of the HK2 promoter by P300 strictly depended on the predicted HIF-1 binding site within the − 200 to + 1 bp region. The abolition of this activation upon site mutation proves that this predicted HIF-1 binding site is an indispensable mediator for P300 and plays a critical role in P300-mediated regulation of HK2 transcription. Consistently, same effects were observed in U-2932 cells (Fig. 6E-G, *P < 0.05, **P < 0.01). Taken together, P300 coupled with HIF-1 upregulated the H3K18la expression, at least in part promoting HK2 transcription.

Fig. 6.

Fig. 6

P300 coupled with HIF-1 regulated HK2 transcription of SU-DHL-2 cells by upregulating the H3K18la expression. SU-DHL-2 cells and U-2932 cells were transfected with the P300 overexpressed plasmid or the blank pcDNA3.1 vector. A The H3K18la expression was examined in SU-DHL-2 cells by the WB assay. H3 acted as the internal control. B In SU-DHL-2 cells, ChIP assay was performed to investigate the effect of P300 overexpression on the enrichment of H3K18la across different fragments of the HK2 promoter. C The potential binding site of HIF-1 to the HK2 promoter was predicted. D In SU-DHL-2 cells, DLR assay was performed to investigate the effect of P300 overexpression on the transcriptional activity of WT and Mut HK2 promoters (the reverse complementary mutation at the binding site of the transcription factor HIF-1 A). E The H3K18la expression was examined in U-2932 cells by the WB assay. H3 acted as the internal control. F In U-2932 cells, ChIP assay was performed to investigate the effect of P300 overexpression on the enrichment of H3K18la across different fragments of the HK2 promoter. G In U-2932 cells, DLR assay was performed to investigate the effect of P300 overexpression on the transcriptional activity of WT and Mut HK2 promoters (a mutation in the reverse complement of the HIF-1 A binding site). All experients were repeated three times. *P < 0.05, **P < 0.01

Discussion

As the most frequently diagnosed and aggressive NHL, DLBCL has resulted in an enormous health burden worldwide. Although the appliance of immunochemotherapy, R-CHOP has brought great improvement to the survival rate of DLBCL patients, approximately 40% of them still suffer poor treatment response or worrying relapse, and the main reason is drug resistance [30]. The underlying mechanisms of drug resistance were completely complex and in detail, metabolic alterations, genetic mutations, the increased expression of drug efflux transporters and anti-apoptotic proteins, and the promoted DND repair contribute to the occurrence of drug resistance [31]. Among them, metabolic alterations serve a role that is hard to ignore, as various biochemical reactions need the support of cellular energy. Glycolysis is one type of cancer cell metabolism, different from oxidative phosphorylation, which is more efficient, glycolysis is an anaerobic fermentation process and always results in lactate and pyruvate accumulation [32]. More importantly, glycolysis is utilized by tumor cells even with oxygen participating in, as such, the accumulated lactate induces an acidic tumor microenvironment, which deeply contributes to cancer cell motility and tumor metastasis, ultimately [33, 34]. Mounting studies have indicated that glycolysis is involved in the drug resistance of multiple cancers. For example, the inhibition of HIF-1α/PPAR-γ/PKM2-mediated glycolysis is helpful for simvastatin to re-promote the sorafenib sensitization of hepatocellular carcinoma cells [35], similarly, it has been reported that the resistance to 5-Fu of colorectal cancer cells can be abrogated by kaempferol via suppressing PKM2-mediated glycolysis [36]. Moreover, some reports have demonstrated that the enhancement of glycolysis is involved in the drug resistance of DLBCL [37, 38]. However, the mechanism underlying needs deeper exploration.

Nowadays, epigenetics has been proven to be promising for anti-tumor therapy. P300, a histone acetyltransferase, is a critical modulator of epigenetics [39]. It has been proved that the regulation of glycolysis is associated with P300 via P300-mediated lysine 2-hydroxyisobutyrylation [13], and Cai et al. have demonstrated that P300 is engaged in the regulation of glycolysis-related metabolic enzymes [40]. Besides, Wang et al. pointed out that the malignant progression of lung cancer can be promoted by uridine phosphorylase 1 (UPP1) via epigenetic modulation of glycolysis [41]. In addition to lactylation modification, P300 is also involved in catalyzing various protein modification types, including lactylation [8]. Furthermore, P300 is always overexpressed in multiple tumor types, and that has been indicated to be correlated with worse prognosis [4245]. However, the role of P300 in the malignant progression of DLBCL, especially in its drug resistance, has not been well studied up to now. In this study, we found that the overexpression of P300 contributed to the Dox resistance of DLBCL, indeed, as P300 overexpression suppressed the cell apoptosis of SU-DHL-2 (the Dox-sensitive DLBCL cell line) while silencing P300 facilitated the cell apoptosis of SU-DHL-2/ADM (the Dox-resistant DLBCL cell line). Besides, we found that P300 overexpression stimulated glycolysis. These results were further proved at the animal level. Subsequently, we confirmed that the P300-mediated Dox resistance of DLBCL was addressed via stimulating glycolysis by the rescue experiments. Furthermore, we determined that P300 overexpression induced an increase in histone lactylation level based on the up-regulation of H3K18la. More interestingly, the histone lactylation occurred on the HK2 promoter (fragment of -200 ~ + 1). Hence, we speculated that the Dox resistance of DLBCL was mediated by P300-mediated histone lactylation on the HK2 promoter, at least partially. Beyond the canonical lactylation-HK2 axis, P300 likely orchestrates resistance through synergistic crosstalk with other epigenetic modifiers. Specifically, as a versatile epigenetic modifier, P300-mediated histone lactylation may exhibit crosstalk with lactylation. For instance, P300-catalyzed H3K27ac can enhance chromatin accessibility, thereby establishing an accessible platform for H3K18la modification [17]. Furthermore, the cooperative action of the cofactor CBP with P300 may potentiate histone lactylation indirectly by enhancing lactate dehydrogenase activity to promote lactate accumulation [9]. Concurrently, repressive marks such as H3K9me3 may compete with H3K18la for binding at the HK2 promoter. Notably, P300 may counteract this repression by recruiting demethylases [20].

Histone posttranslational modifications are extensively related to cancer progression since gene expression is modulated partially by histone modification [46]. Histone lactylation is a novel epigenetic modification derived from lactate, and it is reported to have carcinogenic significance in cancer progression. For example, Yu et al. have revealed that YTH domain family protein 2 (YTHDF2) can be activated by histone lactylation, as such, reminding us that histone lactylation is a novel therapeutic target [47]. Recently, it has been reported that lactate accumulation up-regulates methyltransferase-like 3 in TIMs, which plays an indispensable role in tumor immune escape, via H3K18la [48]. Wang et al. have indicated that P300/CBP-mediated histone lactylation induces a significant inflammatory response [49]. Moreover, the occurrence of histone lactylation promotes gene transcription [46], and this is the reason why P300 overexpression induced the up-regulation of HK2 expression, which further inhibited cell death. Our study also demonstrated that there is a binding site of HIF-1 on the HK2 promoter, which was also located at the fragment of -200 ~ + 1. This result was significant, as it might explain the mechanism by which P300 regulated histone lactylation on the HK2 promoter. Recent studies have indicated that P300 is involved in the activation of the HIF-1 signaling pathway, and ultimately, HIF-1-initiated hypoxic responses [50].

Beyond epigenetic regulation, glycolytic reprogramming likely promotes chemoresistance through multiple molecular circuits. First, elevated ATP production from enhanced glycolysis may fuel ATP-dependent drug efflux pumps (e.g., P-glycoprotein/ABCB1), actively extruding Dox from DLBCL cells [51]. Second, glycolytic intermediates such as NADPH support reDox homeostasis by maintaining reduced glutathione levels, thereby countering Dox-induced oxidative stress and apoptosis [52]. Third, HK2 itself can bind to mitochondrial voltage-dependent anion channels (VDACs), blocking cytochrome c release and inhibiting intrinsic apoptosis [53]. We postulate that P300-HK2 axis orchestrates these resistance mechanisms: Histone lactylation-driven HK2 expression not only accelerates glycolytic flux but also directly suppresses mitochondrial apoptosis, while concomitantly providing energy for drug efflux and antioxidants for redox balance. Future studies should delineate the relative contributions of these pathways in P300-mediated chemoresistance. Notably, this study has a limitation that we focused primarily on HK2 as the target of P300-mediated histone lactylation, while other potential targets remain unexplored. This is indeed critical for comprehensively understanding the global impact of P300-mediated lactylation on cancer metabolic reprogramming. Our study focuses on the mechanism of the H3K18la-HK2 axis in DLBCL drug resistance, primarily based on HK2 as the rate-limiting enzyme in the first step of glycolysis. Its overexpression directly promotes the Warburg effect in tumors. Notably, this study found overlapping sites of H3K18la modification and HIF-1 binding within the HK2 promoter region (-200 ~ + 1), suggesting that this region may serve as a key node for metabolic-epigenetic cross-regulation. We fully recognize that histone lactylation may regulate other metabolic targets. Recent research has shown histone lactylation’s diverse functions. For example, in hepatocellular carcinoma, non-histone proteins like AK2 are lactylated, affecting cell metabolism [54]. In the future, we will explore whether similar non-HK2 targets are affected by P300-mediated histone lactylation in DLBCL, which would provide critical insights into the hierarchical organization of metabolic-epigenetic networks. Such investigations may uncover hidden layers of metabolic plasticity driving chemoresistance, potentially revealing novel compensatory pathways that emerge upon HK2-targeted interventions. Integrating these findings with our current HK2-centric model will ultimately establish a unified framework for targeting lactylation-driven metabolic adaptation in refractory lymphomas. Collectively, our findings establish P300-driven histone lactylation at the HK2 promoter as a novel epigenetic mechanism underlying Dox resistance in DLBCL, with HIF-1 binding site co-localization providing mechanistic insight into microenvironmental regulation. While our findings highlight the P300/H3K18la/HK2 axis as a therapeutic target, translating these insights to the clinic faces notable challenges. First, therapeutic targeting of P300 faces specificity concerns, as its broad involvement in epigenetic regulation may cause off-target effects in normal tissues.

While our findings establish the P300-H3K18la-HK2 axis as a key mediator of Dox resistance in DLBCL, clinical translation faces notable challenges. First, the ubiquitous role of P300 in epigenetic regulation raises concerns about on-target toxicity, necessitating the development of lymphoid-specific delivery systems or PROTAC-based degradation strategies [55]. Second, the metabolic plasticity of DLBCL may lead to compensatory pathways upon HK2 inhibition [56], suggesting that combinatorial targeting of both glycolysis and mitochondrial metabolism may be required. Importantly, the dynamic regulation of histone lactylation by fluctuating lactate levels underscores the need for real-time metabolic imaging to monitor therapeutic response [57]. Despite these challenges, our mechanistic findings suggest actionable clinical strategies. Pharmacological P300 inhibition (e.g., A-485) could disrupt the P300/H3K18la/HK2 axis in DLBCL subtypes with high glycolytic activity, potentially reversing chemoresistance. Complementarily, targeting HK2 with compounds like 3-BrPA nanoparticles may suppress histone lactylation, synergizing with P300-targeted therapy. Biomarker-driven patient selection—combining P300 IHC scoring with FDG-PET SUVmax—could identify candidates most likely to benefit. Future trials should explore intermittent dosing schedules to mitigate toxicity while evaluating these approaches in relapsed/refractory DLBCL, particularly in ABC-subtypes where P300 dependency is pronounced. To accelerate clinical translation, future investigations will pursue an integrated strategy combining clinical correlation analyses of patient-derived samples [58] with preclinical validation of P300/HK2 inhibitors in molecularly stratified patient-derived xenograft models [59], complemented by spatial metabolomic profiling of glycolytic inhibitor engagement in relapsed DLBCL biopsies. This multidisciplinary approach will systematically bridge fundamental mechanistic discoveries with therapeutic development, significantly enhancing the translational potential of our findings while establishing a robust framework for subsequent research in this field.

Future studies should prioritize ABC-subtype DLBCL models where P300 dependency is most pronounced, and explore pharmacodynamic biomarkers such as circulating H3K18la levels to guide patient stratification. This study confirmed the mechanism by which P300 regulates HK2 expression through histone lactonylation to promote Dox resistance in DLBCL, but limitations remain. First, although P300 silencing/overexpression experiments minimized off-target effects by strict sequence comparison (no ≥ 16 nt off-target matches for shRNAs and NM_001429 transcripts for overexpression), functional redundancy of P300 with the homologous protein CBP may still trigger compensatory mechanisms. Secondly, systemic inhibition of P300, a widely expressed epigenetic regulator, may cause off-target effects such as cardiotoxicity, and the high structural similarity of P300/CBP makes the development of selective inhibitors difficult. Strategies such as tissue-specific delivery systems or PROTAC degraders need to be explored to enhance the feasibility of targeted therapies in the future. While our study establishes the P300-H3K18la-HK2 axis as a novel epigenetic mechanism in Dox resistance, we acknowledge the limitations of using artificial overexpression models. Isogenic wild-type and clinically derived resistant cell pairs would better recapitulate the polygenic nature of drug resistance. However, such models require extended development timelines and specialized infrastructure currently beyond our scope. Future work will validate these findings in patient-derived xenografts and clinical specimens. Additionally, future work will employ P300 inhibitors (C646/A-485) and shRNA knockdown to directly test this axis, complemented by HIF-1α rescue experiments. These steps will clarify P300’s role in HIF-1-dependent HK2 regulation and strengthen our model.

Supplementary Information

Supplementary Material 1. (15.3KB, docx)
Supplementary Material 2. (31.1KB, docx)
Supplementary Material 3. (369.9KB, pdf)

Acknowledgements

Not applicable.

Authors’ contributions

XS performed visualization, conceptualization, methodology, and wrote the original draft. HF contributed to visualization and conceptualization. NY carried out investigation, formal analysis, and validation. XZ participated in data curation and software development. WZ contributed to visualization and manuscript review/editing. All authors read and approved the final manuscript.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. The full uncropped gels and blot images in the article can be found in supplementary file 2.

Declarations

Ethics approval and consent to participate

The animal experiments were conducted following the “Guiding Principles in the Care and Use of Animals” (China) and approved by the Laboratory Animal Ethics Committee of Zhejiang Cancer Hospital (NO. 2024ky218).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Martelli M, Ferreri AJ, Agostinelli C, Di Rocco A, Pfreundschuh M, Pileri SA. Diffuse large B-cell lymphoma. Crit Rev Oncol/Hematol. 2013;87(2):146–71. [DOI] [PubMed] [Google Scholar]
  • 2.Stegemann M, Denker S, Schmitt CA. DLBCL 1L-What to expect beyond R-CHOP? Cancers (Basel). 2022;14(6):1453. [DOI] [PMC free article] [PubMed]
  • 3.Wang L, Li LR. R-CHOP resistance in diffuse large B-cell lymphoma: biological and molecular mechanisms. Chin Med J (Engl). 2020;134(3):253–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Chen Z, Wang T, Li C, Zhang W, Huang W, Xue J, Wang J, Li S. FOXP1-GINS1 axis promotes DLBCL proliferation and directs doxorubicin resistance. J Cancer. 2023;14(12):2289–300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lu X, Zhang Q, Xie Y. TCFL5 knockdown sensitizes DLBCL to doxorubicin treatment via regulation of GPX4. Cell Signal. 2023;110:110831. [DOI] [PubMed] [Google Scholar]
  • 6.Tessarz P, Kouzarides T. Histone core modifications regulating nucleosome structure and dynamics. Nat Rev Mol Cell Biol. 2014;15(11):703–8. [DOI] [PubMed] [Google Scholar]
  • 7.Lasko LM, Jakob CG, Edalji RP, Qiu W, Montgomery D, Digiammarino EL, Hansen TM, Risi RM, Frey R, Manaves V, et al. Discovery of a selective catalytic p300/CBP inhibitor that targets lineage-specific tumours. Nature. 2017;550(7674):128–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zeng Q, Wang K, Zhao Y, Ma Q, Chen Z, Huang W. Effects of the acetyltransferase p300 on tumour regulation from the novel perspective of posttranslational protein modification. Biomolecules. 2023;13(3):417. [DOI] [PMC free article] [PubMed]
  • 9.Chen Q, Yang B, Liu X, Zhang XD, Zhang L, Liu T. Histone acetyltransferases CBP/p300 in tumorigenesis and CBP/p300 inhibitors as promising novel anticancer agents. Theranostics. 2022;12(11):4935–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Zhang M, Kan D, Zhang B, Chen X, Wang C, Chen S, Gao W, Yang Z, Li Y, Chen Y, et al. P300/SP1 complex mediating elevated METTL1 regulates CDK14 mRNA stability via internal m7G modification in CRPC. J Exp Clin Cancer Res. 2023;42(1):215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Paladino D, Yue P, Furuya H, Acoba J, Rosser CJ, Turkson J. A novel nuclear Src and p300 signaling axis controls migratory and invasive behavior in pancreatic cancer. Oncotarget. 2016;7(6):7253–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Liu J, He D, Cheng L, Huang C, Zhang Y, Rao X, Kong Y, Li C, Zhang Z, Liu J, et al. p300/CBP Inhibition enhances the efficacy of programmed death-ligand 1 Blockade treatment in prostate cancer. Oncogene. 2020;39(19):3939–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Huang H, Tang S, Ji M, Tang Z, Shimada M, Liu X, Qi S, Locasale JW, Roeder RG, Zhao Y, et al. : p300-Mediated lysine 2-Hydroxyisobutyrylation regulates Glycolysis. Mol Cell. 2018;70(5):984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Pelicano H, Martin DS, Xu RH, Huang P. Glycolysis Inhibition for anticancer treatment. Oncogene. 2006;25(34):4633–46. [DOI] [PubMed] [Google Scholar]
  • 15.Xu L, Xu M, Tong X. [Effects of aerobic Glycolysis on pathogenesis and drug resistance of non-Hodgkin lymphoma]. Zhejiang Da Xue Xue Bao Yi Xue Ban. 2019;48(2):219–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Pandkar MR, Sinha S, Samaiya A, Shukla S. Oncometabolite lactate enhances breast cancer progression by orchestrating histone lactylation-dependent c-Myc expression. Transl Oncol. 2023;37:101758. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Xie Y, Hu H, Liu M, Zhou T, Cheng X, Huang W, Cao L. The role and mechanism of histone lactylation in health and diseases. Front Genet. 2022;13:949252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Wei J, Yang Y, Lu M, Lei Y, Xu L, Jiang Z, Xu X, Guo X, Zhang X, Sun H, et al. Recent advances in the discovery of HIF-1α-p300/CBP inhibitors as Anti-Cancer agents. Mini Rev Med Chem. 2018;18(4):296–309. [DOI] [PubMed] [Google Scholar]
  • 19.Rajendran R, Garva R, Ashour H, Leung T, Stratford I, Krstic-Demonacos M, Demonacos C. Acetylation mediated by the p300/CBP-associated factor determines cellular energy metabolic pathways in cancer. Int J Oncol. 2013;42(6):1961–72. [DOI] [PubMed] [Google Scholar]
  • 20.Liberti MV, Locasale JW. Histone lactylation: A new role for glucose metabolism. Trends Biochem Sci. 2020;45(3):179–82. [DOI] [PubMed] [Google Scholar]
  • 21.Ju HQ, Zhan G, Huang A, Sun Y, Wen S, Yang J, Lu WH, Xu RH, Li J, Li Y, et al. ITD mutation in FLT3 tyrosine kinase promotes Warburg effect and renders therapeutic sensitivity to glycolytic Inhibition. Leukemia. 2017;31(10):2143–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Palmieri D, Fitzgerald D, Shreeve SM, Hua E, Bronder JL, Weil RJ, Davis S, Stark AM, Merino MJ, Kurek R, et al. Analyses of resected human brain metastases of breast cancer reveal the association between up-regulation of hexokinase 2 and poor prognosis. Mol Cancer Res. 2009;7(9):1438–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Rho M, Kim J, Jee CD, Lee YM, Lee HE, Kim MA, Lee HS, Kim WH. Expression of type 2 hexokinase and mitochondria-related genes in gastric carcinoma tissues and cell lines. Anticancer Res. 2007;27(1a):251–8. [PubMed] [Google Scholar]
  • 24.Rho H, Terry AR, Chronis C, Hay N. Hexokinase 2-mediated gene expression via histone lactylation is required for hepatic stellate cell activation and liver fibrosis. Cell Metab. 2023;35(8):1406–e14231408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Fang S, Peng B, Wen Y, Yang J, Wang H, Wang Z, Qian K, Wei Y, Jiao Y, Gao C, et al. Transcriptome-Wide analysis of RNA N(6)-Methyladenosine modification in Adriamycin-Resistant acute myeloid leukemia cells. Front Genet. 2022;13:833694. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Taylor SC, Berkelman T, Yadav G, Hammond M. A defined methodology for reliable quantification of Western blot data. Mol Biotechnol. 2013;55(3):217–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Takeuchi A, Shiota M, Tatsugami K, Yokomizo A, Tanaka S, Kuroiwa K, Eto M, Naito S. p300 mediates cellular resistance to doxorubicin in bladder cancer. Mol Med Rep. 2012;5(1):173–6. [DOI] [PubMed] [Google Scholar]
  • 28.Huang H, Tang S, Ji M, Tang Z, Shimada M, Liu X, Qi S, Locasale JW, Roeder RG, Zhao Y, et al. : p300-Mediated lysine 2-Hydroxyisobutyrylation regulates Glycolysis. Mol Cell. 2018;70(4):663–e678666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Li X, Yang Y, Zhang B, Lin X, Fu X, An Y, Zou Y, Wang JX, Wang Z, Yu T. Lactate metabolism in human health and disease. Signal Transduct Target Ther. 2022;7(1):305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Klener P, Klanova M. Drug resistance in Non-Hodgkin lymphomas. Int J Mol Sci. 2020;21(6):2081. [DOI] [PMC free article] [PubMed]
  • 31.Pi M, Kuang H, Yue C, Yang Q, Wu A, Li Y, Assaraf YG, Yang DH, Wu S. Targeting metabolism to overcome cancer drug resistance: A promising therapeutic strategy for diffuse large B cell lymphoma. Drug Resist Updat. 2022;61:100822. [DOI] [PubMed] [Google Scholar]
  • 32.Bhattacharya B, Mohd Omar MF, Soong R. The Warburg effect and drug resistance. Br J Pharmacol. 2016;173(6):970–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Geschwind JF, Georgiades CS, Ko YH, Pedersen PL. Recently elucidated energy catabolism pathways provide opportunities for novel treatments in hepatocellular carcinoma. Expert Rev Anticancer Ther. 2004;4(3):449–57. [DOI] [PubMed] [Google Scholar]
  • 34.Hirschhaeuser F, Sattler UG, Mueller-Klieser W. Lactate: a metabolic key player in cancer. Cancer Res. 2011;71(22):6921–5. [DOI] [PubMed] [Google Scholar]
  • 35.Feng J, Dai W, Mao Y, Wu L, Li J, Chen K, Yu Q, Kong R, Li S, Zhang J, et al. Simvastatin re-sensitizes hepatocellular carcinoma cells to Sorafenib by inhibiting HIF-1alpha/PPAR-gamma/PKM2-mediated Glycolysis. J Exp Clin Cancer Res. 2020;39(1):24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Wu H, Du J, Li C, Li H, Guo H, Li Z. Kaempferol can reverse the 5-Fu resistance of colorectal cancer cells by inhibiting PKM2-Mediated Glycolysis. Int J Mol Sci. 2022;23(7):3544. [DOI] [PMC free article] [PubMed]
  • 37.Lim SK, Peng CC, Low S, Vijay V, Budiman A, Phang BH, Lim JQ, Jeyasekharan AD, Lim ST, Ong CK, et al. Sustained activation of non-canonical NF-kappaB signalling drives glycolytic reprogramming in doxorubicin-resistant DLBCL. Leukemia. 2023;37(2):441–52. [DOI] [PubMed] [Google Scholar]
  • 38.Jiang D, Mo Q, Sun X, Wang X, Dong M, Zhang G, Chen F, Zhao Q. Pyruvate dehydrogenase kinase 4-mediated metabolic reprogramming is involved in rituximab resistance in diffuse large B-cell lymphoma by affecting the expression of MS4A1/CD20. Cancer Sci. 2021;112(9):3585–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Inagaki Y, Shiraki K, Sugimoto K, Yada T, Tameda M, Ogura S, Yamamoto N, Takei Y, Ito M. Epigenetic regulation of proliferation and invasion in hepatocellular carcinoma cells by CBP/p300 histone acetyltransferase activity. Int J Oncol. 2016;48(2):533–40. [DOI] [PubMed] [Google Scholar]
  • 40.Cai LY, Chen SJ, Xiao SH, Sun QJ, Ding CH, Zheng BN, Zhu XY, Liu SQ, Yang F, Yang YX, et al. Targeting p300/CBP attenuates hepatocellular carcinoma progression through epigenetic regulation of metabolism. Cancer Res. 2021;81(4):860–72. [DOI] [PubMed] [Google Scholar]
  • 41.Wang X, Wang Z, Huang R, Lu Z, Chen X, Huang D. UPP1 promotes lung adenocarcinoma progression through epigenetic regulation of Glycolysis. Aging Dis. 2022;13(5):1488–503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Chen MK, Cai MY, Luo RZ, Tian X, Liao QM, Zhang XY, Han JD. Overexpression of p300 correlates with poor prognosis in patients with cutaneous squamous cell carcinoma. Br J Dermatol. 2015;172(1):111–9. [DOI] [PubMed] [Google Scholar]
  • 43.Li M, Luo RZ, Chen JW, Cao Y, Lu JB, He JH, Wu QL, Cai MY. High expression of transcriptional coactivator p300 correlates with aggressive features and poor prognosis of hepatocellular carcinoma. J Transl Med. 2011;9:5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Li Y, Yang HX, Luo RZ, Zhang Y, Li M, Wang X, Jia WH. High expression of p300 has an unfavorable impact on survival in resectable esophageal squamous cell carcinoma. Ann Thorac Surg. 2011;91(5):1531–8. [DOI] [PubMed] [Google Scholar]
  • 45.Liao ZW, Zhou TC, Tan XJ, Song XL, Liu Y, Shi XY, Huang WJ, Du LL, Tu BJ, Lin XD. High expression of p300 is linked to aggressive features and poor prognosis of nasopharyngeal carcinoma. J Transl Med. 2012;10:110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Audia JE, Campbell RM. Histone modifications and cancer. Cold Spring Harb Perspect Biol. 2016;8(4):a019521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Yu J, Chai P, Xie M, Ge S, Ruan J, Fan X, Jia R. Histone lactylation drives oncogenesis by facilitating m(6)A reader protein YTHDF2 expression in ocular melanoma. Genome Biol. 2021;22(1):85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Xiong J, He J, Zhu J, Pan J, Liao W, Ye H, Wang H, Song Y, Du Y, Cui B, et al. Lactylation-driven METTL3-mediated RNA m(6)A modification promotes immunosuppression of tumor-infiltrating myeloid cells. Mol Cell. 2022;82(9):1660–77. e1610. [DOI] [PubMed] [Google Scholar]
  • 49.Sun QY, Zhou Y, Du LJ, Zhang MK, Wang JL, Ren YY, Liu F. Analysis between macrophage-related genes with prognosis and tumor microenvironment in non-small cell lung cancer. Yi Chuan. 2023;45(8):684–99. [DOI] [PubMed] [Google Scholar]
  • 50.Wei J, Yang Y, Lu M, Lei Y, Xu L, Jiang Z, Xu X, Guo X, Zhang X, Sun H, et al. Recent advances in the discovery of HIF-1alpha-p300/CBP inhibitors as Anti-Cancer agents. Mini Rev Med Chem. 2018;18(4):296–309. [DOI] [PubMed] [Google Scholar]
  • 51.Gottesman MM, Fojo T, Bates SE. Multidrug resistance in cancer: role of ATP-dependent transporters. Nat Rev Cancer. 2002;2(1):48–58. [DOI] [PubMed] [Google Scholar]
  • 52.Schafer FQ, Buettner GR. Redox environment of the cell as viewed through the redox state of the glutathione disulfide/glutathione couple. Free Radic Biol Med. 2001;30(11):1191–212. [DOI] [PubMed] [Google Scholar]
  • 53.Ichas F, Mazat JP. From calcium signaling to cell death: two conformations for the mitochondrial permeability transition pore. Switching from low- to high-conductance state. Biochim Biophys Acta. 1998;1366(1–2):33–50. [DOI] [PubMed] [Google Scholar]
  • 54.Yang Z, Yan C, Ma J, Peng P, Ren X, Cai S, Shen X, Wu Y, Zhang S, Wang X, et al. Lactylome analysis suggests lactylation-dependent mechanisms of metabolic adaptation in hepatocellular carcinoma. Nat Metab. 2023;5(1):61–79. [DOI] [PubMed] [Google Scholar]
  • 55.Wu T, Hu J, Zhao X, Zhang C, Dong R, Hu Q, Xu H, Shen H, Zhang X, Zhang Y, et al. Discovery of a promising CBP/p300 degrader XYD129 for the treatment of acute myeloid leukemia. J Med Chem. 2024;67(11):9194–213. [DOI] [PubMed] [Google Scholar]
  • 56.Yang Y, Liu Q, Wang M, Li L, Yu Y, Pan M, Hu D, Chu B, Qu Y, Qian Z. Genetically programmable cell membrane-camouflaged nanoparticles for targeted combination therapy of colorectal cancer. Signal Transduct Target Ther. 2024;9(1):158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Ma Y, Zhang Z, Cao X, Guo D, Huang S, Xie L, Wu M, Li J, Li C, Chu Y, et al. Semaphorin 6A phase separation sustains a histone lactylation-dependent lactate buildup in pathological angiogenesis. Proc Natl Acad Sci U S A. 2025;122(16):e2423677122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Li J, Zheng C, Mai Q, Huang X, Pan W, Lu J, Chen Z, Zhang S, Zhang C, Huang H, et al. Tyrosine catabolism enhances genotoxic chemotherapy by suppressing translesion DNA synthesis in epithelial ovarian cancer. Cell Metab. 2023;35(11):2044–59. e2048. [DOI] [PubMed] [Google Scholar]
  • 59.Xu S, Zhou T, Doh HM, Trinh KR, Catapang A, Lee JT, Braas D, Bayley NA, Yamada RE, Vasuthasawat A, et al. An HK2 antisense oligonucleotide induces synthetic lethality in HK1(-)HK2(+) multiple myeloma. Cancer Res. 2019;79(10):2748–60. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1. (15.3KB, docx)
Supplementary Material 2. (31.1KB, docx)
Supplementary Material 3. (369.9KB, pdf)

Data Availability Statement

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. The full uncropped gels and blot images in the article can be found in supplementary file 2.


Articles from BMC Cancer are provided here courtesy of BMC

RESOURCES