ABSTRACT
This short‐term study evaluated the effects of dietary betaine supplementation over 4 weeks on feed intake, milk production, nutrient digestibility, blood metabolites, and ruminal microbial communities in heat‐stressed Holstein cows. Thirty lactating cows were randomly divided into a control group and a treatment group supplemented with 80 g/day of natural betaine extract for 4 weeks during summer. Betaine supplementation significantly increased dry matter intake (21.0 vs. 18.7 kg/day; p ≤ 0.05) and milk yield (35.4 vs. 31.2 kg/day; p ≤ 0.05) compared to the control. Milk composition, including fat and protein content, also improved (p ≤ 0.05). Cows receiving betaine had lower rectal temperatures (p = 0.02) and respiration rates (p = 0.01), indicating reduced heat stress. Serum concentrations of inflammatory markers—ceruloplasmin, haptoglobin, and serum amyloid A—were significantly lower in the betaine group by Week 4 (p ≤ 0.05). Plasma and rumen amino acid profiles, particularly lysine and methionine, were better preserved in the betaine group (p ≤ 0.05). Ruminal concentrations of volatile fatty acids increased (p ≤ 0.05), and the abundance of beneficial microbial species, such as Fibrobacter succinogenes, Butyrivibrio proteoclasticus, and Megasphaera elsdenii, was enhanced (p ≤ 0.05). These findings suggest that betaine supplementation is an effective nutritional strategy to improve dairy cow performance, reduce inflammation, and stabilise ruminal microbiota during heat stress.
Keywords: betaine, blood metabolites, dairy cows, heat stress, nutrient digestibility, ruminal bacteria
Short‐term betaine supplementation (80 g/day for 4 weeks) improved thermoregulation, ruminal fermentation, and nutrient utilisation in heat‐stressed dairy cows. These effects enhanced feed intake, milk yield, and metabolic stability by modulating rumen microbiota and reducing inflammatory and oxidative stress responses.

Abbreviations
- BET
betaine‐supplemented group
- BW
body weight
- Ca
calcium
- CV
coefficient of variation
- DM
dry matter
- EDTA
ethylenediaminetetraacetic acid
- FMOC‐CI
9‐fluorenyl methyl chloroformate
- HCA
hierarchical cluster analysis
- Hcy
homocysteine
- HPLC
high‐performance liquid chromatography
- Mg
magnesium
- Na
sodium
- OM
organic matter
- OPA
o‐phthalaldehyde
- PCA
principal component analysis
- Ph
phosphorus
- SAA
serum amyloid A
- SPSS
Statistical Package for the Social Sciences
- THF
tetrahydrofolate
- THI
temperature–humidity index
- TMR
total mixed ration
- TVFA
total volatile fatty acid
- VFA
volatile fatty acid
1. Introduction
Dairy cows are especially vulnerable to heat stress, which arises when external factors elevate the effective ecological temperatures beyond the animal's thermoneutral zone (Sammad et al. 2020). Heat stress can significantly affect animal homeostasis, and researchers have utilised physiological variables, such as hormone levels, body temperature, and respiratory rate, to analyse these effects (Grünwaldt et al. 2005). Reduced milk production due to heat stress has negative financial consequences for the dairy sector. Additionally, heat stress increases the risks of metabolic‐related health issues, such as rumen acidosis mortality (Hou et al. 2021).
Furthermore, sluggish heifer growth is another consequence of heat stress. Lastly, heat stress can lead to diminished reproductive effectiveness, irregular estrous cycles, reduced conception rates, and decreased milk production in dairy cows. In response to heat injury, dairy cows employ self‐adaptation mechanisms to mitigate the effects (Bernabucci and Mele 2014). These mechanisms include reducing daily dry matter intake, suppressing rumen fermentation activities, minimising physical exertion, decreasing milk yield, and altering the composition of milk components such as fats, proteins, and lactose (Bernabucci and Mele 2014).
Betaine (BT) is a choline oxidation by‐product or a trimethyl derivative of glycine. Betaine is an important osmolyte in many animals and is required to synthesise homocysteine and create 5‐methyl tetrahydrofolate (THF). It also provides methyl groups needed to regenerate methionine from homocysteine (Hcy) (Davidson et al. 2008). Many studies have shown that betaine stimulates the proliferation of ruminal microbes and enzyme activity in dairy and beef cattle (Shah et al. 2020). This, in turn, leads to an increase in the formation of total volatile fatty acids (VFAs) in the rumen and an apparent improvement in the digestibility of nutrients from the whole tract (Wang et al. 2020). It may help reduce heat stress and increase milk supply in nursing cows (Cronje 2016). One component of hyperosmotic stress responses is a sodium‐coupled transporter that helps move betaine across cell membranes (Perez et al. 2011). Because of its neutral charge and polar areas, betaine can retain intracellular water molecules even with a concentration gradient (Dunshea et al. 2019). This osmolyte activity of betaine lowers the energy requirements for ion pumping, which minimises animal basal heat output (Al‐Qaisi et al. 2020).
Recent evidence indicates that betaine supplementation can significantly modulate rumen microbial populations and their metabolic activity, particularly under heat‐stressed conditions. Betaine functions as an effective osmolyte that stabilises microbial cell membranes and maintains intracellular water balance, thereby preserving microbial viability and enzymatic activity during thermal stress (Shah et al. 2020). This osmoprotective effect supports the proliferation and functionality of key fibrolytic bacteria, including Fibrobacter succinogenes and Butyrivibrio proteoclasticus, which are essential for fibre degradation and volatile fatty acid production in the rumen (Wang et al. 2020). In addition, betaine serves as a methyl‐group donor, contributing to microbial protein synthesis and enhancing ruminal nitrogen utilisation, which further promotes microbial growth and fermentation efficiency (Ren et al. 2022). Recent studies have also shown that betaine supplementation improves the abundance and activity of lactate‐utilising bacteria, such as Megasphaera elsdenii, thereby stabilising ruminal fermentation and reducing the risk of ruminal dysbiosis under heat‐stressed conditions (Ren et al. 2022). Collectively, these mechanisms demonstrate that dietary betaine supplementation enhances rumen microbial resilience, fermentation efficiency, and nutrient digestibility, which may ultimately translate into improved animal performance during periods of thermal challenge.
Although betaine exerts measurable effects within the rumen, it is well established that a substantial proportion of dietary betaine (approximately 70%–80%) escapes ruminal degradation and is absorbed in the small intestine, where it exerts systemic physiological effects (Buonaiuto et al. 2025). Post‐ruminally, betaine functions as a potent osmolyte and methyl‐group donor, supporting cellular hydration, stabilising protein structure, and reducing energy expenditure associated with ion transport during heat stress (Saeed et al. 2017). These systemic actions contribute to improved thermoregulation, reduced oxidative stress, and attenuation of inflammatory responses in heat‐stressed dairy cows (Abdelmegeid 2025). Concurrently, the fraction of betaine available in the rumen enhances microbial stability and fermentation efficiency by protecting ruminal microbes against osmotic and thermal stress, thereby supporting fibre degradation and volatile fatty acid production (Mahmood et al. 2020). Collectively, these ruminal and extra‐ruminal mechanisms highlight the dual role of betaine in mitigating heat stress through coordinated effects on rumen microbial function and whole‐body metabolic and physiological resilience.
This study aimed to examine the effects of betaine supplementation on ruminal fermentation, blood metabolites, lactating dairy cow performance, and the number of ruminal bacteria in cows subjected to hot and humid environments.
2. Materials and Methods
2.1. Animals, Diets, and Betaine Supplement
This experiment was conducted as a short‐term feeding trial lasting 4 weeks during the hot and humid summer period. During the hot and humid period, the study featured 30 healthy lactating Holstein cows chosen from a commercial dairy farm in Egypt ……. . (August–September 2019). A total of 30 healthy lactating Holstein cows were selected from a commercial dairy farm for the study. At the beginning of the experiment, cows had an average of 120 ± 15 days in milk, an average body weight of 620 ± 30 kg, and an average parity of 2.3 ± 0.5. Cows were housed in a naturally ventilated free‐stall barn equipped with shade and fans. Animals were managed under the same housing, feeding, and milking conditions throughout the experimental period. Cows were fed a total mixed ration (TMR) twice daily at approximately 06:00 and 18:00 h, with ad libitum access to feed and fresh water. Feed bunks were cleaned daily to minimise refusals. Cows were milked twice daily in a conventional milking parlour at approximately 05:00 and 17:00 h. Cows were randomly allocated into two groups balanced for days in milk, body weight, milk production, and parity. The cows were randomly assigned to a control group (n = 15, no betaine) and a betaine group (n = 15, receiving 80 g/day betaine for 4 weeks).
In powdered form, betaine was mixed with 50 mL of cane molasses to ensure uniform distribution and applied as a top dressing on feed to promote intake (Table 1). The daily betaine dose was divided into two portions of 40 g to enhance bioavailability, administered with the morning and evening diets. The control group received the same amount of cane molasses without betaine, following the same administration technique as the betaine group. Dietary betaine was supplemented at a dose of 80 g/day per cow. The betaine source was a natural sugar beet extract (Betafin S1, DuPont Nutrition & Biosciences, Marlborough, United Kingdom). The product was provided in a non‐rumen‐protected form and was manually top‐dressed onto the total mixed ration (TMR) immediately before feeding. Individual dry matter intake (DMI) was determined daily by recording the amount of feed offered and refusals for each cow, with DMI calculated as the difference between feed offered and feed refused on a dry matter basis.
TABLE 1.
Basal diet composition and nutrient levels (DM basis, %).
| Ingredients | Nutrient levels | ||
|---|---|---|---|
| Ingredient | Contents | Item | Contents |
| Corn silage | 36.80 | NEg (MJ/kg) b | 5.48 |
| Alfalfa hay | 3.45 | CP | 14.88 |
| Chinese wildrye | 6.01 | NDF | 43.15 |
| Corn | 16.67 | ADF | 25.20 |
| Soybean meal | 3.85 | Ca | 0.89 |
| Beet pulp | 4.28 | P | 0.58 |
| Brewer's grains | 16.55 | ||
| DDGS | 3.44 | ||
| Cottonseed meal | 3.48 | ||
| Molasses | 3.66 | ||
| Limestone | 0.35 | ||
| CaHPO4 | 0.40 | ||
| Na2CO3 | 0.53 | ||
| NaCl | 0.33 | ||
| Premix a | 0.20 | ||
| Total | 100 | ||
Abbreviations: ADF, acid detergent fibre; CP, crude protein; DDGS, distillers dried grains with soluble; NDF, neutral detergent fibre.
aThe premix provided the following per kg of the diet: VA 7500 IU, VD 1300 IU, VE 50 IU, Cu (as copper sulphate) 10 mg, Fe (as ferrous sulphate) 100 mg, Mn (as manganese sulphate) 40 mg, Zn (as zinc sulphate) 60 mg, I (as potassium iodide) 0.50 mg, Se (as sodium selenite) 0.3 mg, and Co (as cobalt chloride) 0.1 mg.
bNEg was calculated according to the Nutrient Requirements of Dairy Cattle. The premix provides a per kg diet [1].
2.2. Environmental Conditions and Heat‐Stressed Assessment
Ambient temperature and relative humidity were recorded daily using an on‐site meteorological station throughout the experimental period. The temperature–humidity index (THI) was calculated to assess heat‐stressed conditions using the equation described by Ekine‐Dzivenu et al. (2020). Cows were considered heat‐stressed when THI values exceeded 72. A summary of ambient temperature and THI trends during the study is presented in Figure S1.
THI = (1.8 × T + 32) − [(0.55 − 0.0055 × RH) × (1.8 × T − 26.8)] (Ekine‐Dzivenu et al. 2020), where T is the ambient temperature (°C), and RH is the relative humidity (%).
Rectal temperature and respiration rate were recorded twice weekly (every 3–4 days) at approximately 10:00 a.m. to 4:00 p.m., when environmental heat load was typically highest. These measurements were used to confirm the physiological heat‐stressed status of the cows. Rectal temperature was measured using a digital veterinary thermometer inserted 8–10 cm into the rectum, and respiration rate was determined by visually counting flank movements over 60 s using a stopwatch.
2.3. Blood Sampling and Analysis
Blood samples were collected at Weeks 0 (baseline), 2, and 4 to evaluate early and cumulative physiological responses to betaine supplementation while minimising stress associated with frequent handling during heat‐stressed conditions. Blood samples were collected from the tail vein using 10 mL vacutainers under sterile conditions. Plasma was collected in K3‐EDTA vacutainers, while serum was obtained in plain vacutainers and clotted at a refrigerated temperature for 10 min before centrifugation. Plasma samples were centrifuged immediately at 1500 × g for 10 min, while serum samples were centrifuged using the same protocol after clotting (Ghanem et al. 2018). All plasma and serum aliquots were stored at –20°C until further analysis. Serum concentrations of ceruloplasmin, haptoglobin, and serum amyloid A were measured using commercial ELISA kits from MyBioSource (San Diego, CA, USA).
Ceruloplasmin levels were determined using kit Catalog #MBS038143, with an intra‐assay coefficient of variation (CV) of 5.2% and an inter‐assay CV of 7.0%.
Haptoglobin concentrations were measured using kit Catalog #MBS2880006, with an intra‐assay CV of 4.8% and an inter‐assay CV of 6.5%.
Serum amyloid A was analysed using kit Catalog #MBS041375, with an intra‐assay CV of 5.5% and an inter‐assay CV of 7.2%. Haptoglobin (g/L), amyloid A (mg/mL), and ceruloplasmin (µmol/L) were assessed using methods described by Bertoni et al. (2008), modified for ILAB 600 conditions. Serum minerals and selected heavy metals were analysed via atomic absorption spectrometry (SensAA, GBC Scientific Equipment) following Kaneko et al. (2008)
2.4. Milk Sampling and Analysis
Throughout the experimental period, cows were milked twice daily in a conventional milking parlour, approximately at 05:00 and 17:00 h. Milk samples were collected twice weekly during morning and evening milking sessions. After collection, samples were refrigerated at 4°C and frozen for subsequent milk composition analysis. An infrared milk analyser (Milkoscan FT 6000; Foss Electric, Hillerød, Denmark) was used to check the milk samples' fat, protein, and lactose levels (Analytical 2008).
2.5. Ruminal Sample Collection
Rumen contents were collected using a stomach tube at W0, W2, and W4. The initial 150 mL of ruminal fluid was discarded, and the next 100 mL was retained for analysis. The pH of the retained ruminal fluid was measured using a portable pH meter (PHB‐4, Shanghai Precision Scientific Instrument Co., Ltd). The sample was then filtered through four layers of cheesecloth. A 5 mL portion of the filtrate was mixed with 1 mL of 250 g/L meta‐phosphoric acid for volatile fatty acid (VFA) analysis. Another 5 mL of the filtrate, reserved for microbial DNA extraction, was immediately frozen in liquid nitrogen, transported to the laboratory, and stored at –80°C until DNA extraction and analysis (Elolimy et al. 2018). Total volatile fatty acids (TVFAs) were determined using the steam distillation method described by Warner and Stacy (1965).
Plasma and rumen amino acids were analysed using High‐Performance Liquid Chromatography (HPLC) based on the protocol (Cohen and Michaud 1993) following acidic hydrolysis. Amino acids were derivatised using the AccQ‐Tag Ultra amino acid standard (Waters, WAT088122, USA) according to the manufacturer's guidelines (AccQ‐Tag Ultra Waters, No. 186003836, USA). Plasma samples were separated from whole blood by centrifugation at 1500 × g for 10 min, deproteinised with 5% sulphosalicylic acid to remove proteins, and the supernatant was derivatised with o‐phthalaldehyde (OPA) for fluorescence detection.
Rumen fluid was collected via stomach tubing, centrifuged at 10,000 × g for 15 min to remove debris, and the supernatant was derivatised with 9‐fluorenyl methyl chloroformate (FMOC‐CI) for enhanced detection sensitivity. Separation was performed using a C18 reversed‐phase column with a gradient of acetonitrile and sodium acetate buffer, with detection at 340 nm excitation and 450 nm emission wavelengths. Quantification was based on calibration curves prepared with standard amino acid solutions (Sigma‐Aldrich, USA) to ensure accuracy and sensitivity. Tryptophan was quantified after alkaline hydrolysis of proteins in 5 mL NaOH for 36 h, following ISO 13904 guidelines (Wu and Tanoue 2001). Analysis used a PDA detector to analyse an AccQ‐Tag Ultra Column (2.1 × 100 mm, Waters, No. 186003837, USA) with a custom‐phase gradient and detection at λ = 260 nm. Data processing was performed using LabSolutions software (Shimadzu, Tokyo, Japan). Free amino acids were analysed using the HPLC‐based PICO‐Tag analysis system (Waters, Milford, MA, USA) described by Pappa and Sotirakoglou (2008). For extraction, 1 g of fermented milk was treated with 10 mL of 0.1 M HCl containing an internal standard, and concentrations were determined by comparison with reference standards. Serum concentrations of calcium (Ca), phosphorus (Ph), magnesium (Mg), sodium (Na), potassium (K), and chloride (Cl) were measured spectrophotometrically using commercial kits from Human Gesellschaft für Biochemica und Diagnostica mbH (Germany) following Warner and Stacy (1965).
2.6. Real‐Time PCR Amplification and Bacterial DNA Extraction
Genomic DNA was extracted from ruminal contents using the QIAamp PowerFecal DNA Kit (Qiagen, USA) following the manufacturer's protocol. The quantity and quality of the extracted DNA were assessed using a NanoDrop spectrophotometer (ND 1000, NanoDrop Technologies Inc.) at 260 nm. Primers targeted ten key ruminal bacterial species, and two universal primers were selected for amplification. Negative controls (without template DNA), standards, and all samples were analysed in duplicate on the same plate. Real‐time PCR was performed on the CFX96 Real‐Time System (BIORAD). The relative abundances of bacterial species were determined using the geometric mean of two universal primers (eubacterial primer 1 and eubacterial primer 2, Table 2) and calculated with the efficiency‐corrected Δ‐CT method as described by Fliegerova et al. (2016).
TABLE 2.
Species‐specific primers for the quantification of 10 key ruminal bacteria by quantitative RT‐PCR assay for the assessment of the relative abundance of microbial species in mixed ruminal fluid from Holstein cows fed a control diet (CON) or CON supplemented with betaine (BET).
| Target bacterial species | Primer sequence (5′–3′) | Reference | qPCR efficiency a (%) | |
|---|---|---|---|---|
| Anaerovibrio lipolytica |
F: b R: c |
GAAATGGATTCTAGTGGCAAACG ACATCGGTCATGCGACCAA |
Al‐Qaisi et al. 2020 | 98.17 |
| Butyrivibrio proteoclasticus |
F: R: |
GGGCTTGCTTTGGAAACTGTT CCCACCGATGTTCCTCCTAA |
Al‐Qaisi et al. 2020 | 100.68 |
| Eubacterium ruminantium |
F: R: |
CTCCCGAGACTGAGGAAGCTTG GTCCATCTCACACCACCGGA |
Analytical 2008 | 100.02 |
| Fibrobacter succinogenes |
F: R: |
GCGGGTAGCAAACAGGATTAGA CCCCCGGACACCCAGTAT |
Analytical 2008 | 104.04 |
| Megaspheara elsdenii |
F: R: |
AGATGGGGACAACAGCTGGA CGAAAGCTCCGAAGAGCCT |
Analytical 2008 | 97.70 |
| Prevotella bryantii |
F: R: |
AGCGCAGGCCGTTTGG GCTTCCTGTGCACTCAAGTCTGAC |
Analytical 2008 | 104.36 |
| Selenomonas ruminantium |
F: R: |
CAATAAGCATTCCGCCTGGG TTCACTCAATGTCAAGCCCTGG |
Analytical 2008 | 96.25 |
| Succinimonas amylolytica |
F: R: |
CGTTGGGCGGTCATTTGAAAC CCTGAGCGTCAGTTACTATCCAGA |
Bernabucci and Mele 2014 | 101.73 |
| Streptococcus bovis |
F: R: |
TTCCTAGAGATAGGAAGTTTCTTCGG ATGATGGCAACTAACAATAGGGGT |
Analytical 2008 | 99.23 |
| Succinivibrio dextrinosolvens |
F: R: |
TAGGAGCTTGTGCGATAGTATGG CTCACTATGTCAAGGTCAGGTAAGG |
Bernabucci and Mele 2014 | 99.95 |
| Bacteria general 1 |
F: R: |
GGATTAGATACCCTGGTAGT CACGACACGAGCTGACG |
Bertoni et al. 2008 | 97.96 |
| Bacteria general 2 |
F: R: |
GTGSTGCAYGGYTGTCGTCA ACGTCRTCCMCACCTTCCTC |
Buonaiuto et al. 2025 | 102.35 |
Measured efficiencies of the primers in the qPCR reactions.
F = forward primer.
R = reverse primer.
2.7. Statistical Analysis
The data were shown as the average plus or minus the standard error. When checking for data normality, the Shapiro–Wilk test was utilised, and when checking for variance homogeneity, the Brown–Forsythe test was used. With nearly similar variances, all variables displayed normal distributions. Comparisons between the two groups were conducted using an independent sample t‐test. Data were analysed using two‐way repeated‐measure ANOVA to assess the effects of treatment (control vs. betaine), time (Week 0, 2, and 4), and their interaction. The analysis was performed using IBM SPSS Statistics (Version 29.0; IBM Corp., 2023), and significance was declared at p ≤ 0.05 (Statistics 2013). The sample size was based on previous studies investigating dietary supplementation under heat stress in dairy cows, where group sizes typically ranged from 10 to 15 animals per treatment group (Hall et al. 2016; Perfield II et al. 2004; Zom et al. 2011). Thus, enrolling 15 cows per group in the current study ensured adequate power while accounting for biological variability.
3. Results
3.1. Production Performance Data
The production performance of heat‐stressed lactating cows with Betaine supplementation revealed significant improvements over time (Table 3). In Week 2, the impact of Betaine supplementation became evident, as substantial improvements (p ≤ 0.05) were observed across multiple production metrics. Cows in the betaine group consumed more feed (21.0 kg/day) than those in the control group, reflecting enhanced nutrient uptake. This increased intake translated to a significantly higher milk yield in the betaine group compared to the control group, as shown in Table 3. Furthermore, milk composition improved significantly, with higher milk fat and protein content in the betaine group (Table 3). The differences were even more pronounced by Week 4, highlighting the cumulative benefits of betaine supplementation. Feed intake in the betaine group surged significantly, surpassing the control group. The milk yield also showed a remarkable increase, with the betaine group compared to the control group. Milk composition metrics favoured the betaine group, with higher fat content (Table 3).
TABLE 3.
Effects of betaine supplementation on feed intake, rumen fermentation, and milk production parameters in heat‐stressed dairy cows.
| Week | Metric | Control | Betaine | SEM | p‐value |
|---|---|---|---|---|---|
| Week 0 | Feed intake (kg/day) | 20.0 | 21.0 | 0.50 | 0.06 |
| Rumen pH | 6.8 | 6.7 | 0.05 | 0.07 | |
| Total VFAs (mmol/L) | 120.0 | 121.0 | 5.00 | 0.08 | |
| Milk yield (L/day) | 25.0 | 24.0 | 0.80 | 0.06 | |
| Milk fat (%) | 3.8 | 3.7 | 0.02 | 0.06 | |
| Milk protein (%) | 3.2 | 3.3 | 0.01 | 0.07 | |
| Week 2 | Feed intake (kg/day) | 19.0 | 21.0 | 0.60 | 0.03 |
| Rumen pH | 6.7 | 6.9 | 0.04 | 0.03 | |
| Total VFAs (mmol/L) | 115.0 | 130.0 | 6.00 | 0.03 | |
| Milk yield (L/day) | 24.0 | 27.0 | 0.90 | 0.03 | |
| Milk fat (%) | 3.7 | 4.0 | 0.03 | 0.03 | |
| Milk protein (%) | 3.1 | 3.4 | 0.02 | 0.03 | |
| Week 4 | Feed intake (kg/day) | 18.0 | 22.0 | 0.70 | 0.01 |
| Rumen pH | 6.6 | 7.0 | 0.03 | 0.01 | |
| Total VFAs (mmol/L) | 110.0 | 140.0 | 7.00 | 0.01 | |
| Milk yield (L/day) | 22.0 | 30.0 | 1.00 | 0.01 | |
| Milk fat (%) | 3.6 | 4.1 | 0.04 | 0.01 | |
| Milk protein (%) | 3.0 | 3.5 | 0.03 | 0.01 |
Note: Statistical comparisons were performed using two‐way repeated measure ANOVA with significance declared at p ≤ 0.05.
SEM = pooled standard error of means.
3.2. Effect of Betaine Supplementation on Physiological Indicators of Heat Stress in Dairy Cows
Rectal temperature and respiration rate measurements confirmed the presence of heat stress in all cows at the start of the trial, with no significant differences between groups. However, from Week 2 onward, cows receiving dietary betaine supplementation showed significantly lower rectal temperatures (p = 0.03 and p = 0.02) and reduced respiration rates (p = 0.02 and p = 0.01) compared to the control group. While the control group exhibited increasing signs of heat stress over time, the betaine group demonstrated a consistent downward trend in both parameters (Figures S2 and S3).
3.3. Serum Acute‐Phase Proteins and Amino Acid Profiling
The effects of dietary betaine supplementation on inflammatory mediators in heat‐stressed dairy cows are presented in Table 4. In addition to the time‐dependent increases observed under heat stress, betaine supplementation exerted an apparent treatment effect on acute‐phase proteins. Compared with the control group, betaine‐supplemented cows exhibited significantly lower concentrations of ceruloplasmin, haptoglobin, and serum amyloid A (SAA) at Weeks 2 and 4. In the control group, ceruloplasmin concentrations increased markedly by Week 4 (approximately 50% above baseline), whereas betaine‐treated cows showed only a modest increase (approximately 15%). Similarly, haptoglobin levels in control cows increased nearly threefold over the experimental period, while the rise in betaine‐treated cows was substantially lower (approximately 1.6‐fold). Serum amyloid A concentrations showed a pronounced increase in the control group (approximately 3.3‐fold), whereas betaine supplementation limited this increase to approximately 1.6‐fold (Table 4). A significant time × treatment interaction (p ≤ 0.05) was observed for all inflammatory markers, indicating that the progression of systemic inflammatory responses differed between control and betaine‐treated cows throughout the heat‐stressed period. The effects of betaine supplementation on plasma amino acid profiles are summarised in Table 5. Plasma amino acid concentrations were influenced by both sampling time and dietary treatment. Over time, cows in the control group exhibited a marked decline in several essential amino acids, including lysine and methionine, by Week 4. In contrast, betaine‐supplemented cows showed better preservation of plasma amino acid concentrations, with only slight reductions in lysine and relatively stable methionine levels throughout the experimental period. Overall, cows receiving betaine maintained significantly higher concentrations of both essential and non‐essential amino acids compared with control cows, In heat‐stressed cows, calcium, phosphorus, and magnesium levels decreased markedly over time in the control group, while betaine supplementation largely prevented these declines as shown in Table 6.
TABLE 4.
Inflammatory mediator levels (ceruloplasmin, haptoglobin, and serum amyloid A) in control and betaine‐treated groups at Weeks 0, 2, and 4 under heat‐stressed conditions.
| Acute‐phase protein | Group | Week 0 | Week 2 | Week 4 | Significance (within group p‐value) | Time × Treatment interaction (p‐value) |
|---|---|---|---|---|---|---|
| Ceruloplasmin (µmol/L) | Control | 2.10 ± 0.2 | 2.5 ± 0.3 | 3.0 ± 0.3 | 0.04 | 0.03 |
| Betaine‐treated | 2.05 ± 0.2 | 2.2 ± 0.2 | 2.3 ± 0.2 | 0.03 | ||
| Haptoglobin (g/L) | Control | 0.51 ± 0.1 | 1.0 ± 0.2 | 1.5 ± 0.2 | 0.01 | 0.01 |
| Betaine‐treated | 0.52 ± 0.1 | 0.7 ± 0.1 | 0.8 ± 0.1 | 0.02 | ||
| Amyloid A (mg/mL) | Control | 0.32 ± 0.1 | 0.7 ± 0.2 | 1.0 ± 0.2 | 0.01 | 0.01 |
| Betaine‐treated | 0.31 ± 0.1 | 0.4 ± 0.1 | 0.5 ± 0.1 | 0.01 |
Note: Values are presented as mean ± SE. Statistical significance for treatment (control vs. betaine), time (Weeks 0, 2, and 4), and their interaction (Time × Treatment) was assessed using two‐way repeated‐measures ANOVA. Significance was declared at p ≤ 0.05.
TABLE 5.
Plasma amino acid profiling (mg/dL).
| Amino acid | Group | Week 0 | Week 2 | Week 4 | p‐value |
|---|---|---|---|---|---|
| Lysine (Lys) | Control | 119.25 ± 5 | 100 ± 4 | 90 ± 3 | 0.04 |
| Betaine‐treated | 120 ± 5 | 110 ± 4 | 105 ± 3 | 0.04 | |
| Methionine (Met) | Control | 79.1 ± 3 | 70 ± 2 | 60 ± 2 | 0.03 |
| Betaine‐treated | 80 ± 3 | 75 ± 2 | 73 ± 2 | 0.03 | |
| Threonine (Thr) | Control | 151.2 ± 6 | 130 ± 5 | 120 ± 4 | 0.01 |
| Betaine‐treated | 150 ± 6 | 145 ± 5 | 140 ± 4 | 0.01 | |
| Valine (Val) | Control | 61.25 ± 3 | 50 ± 2 | 40 ± 2 | 0.01 |
| Betaine‐treated | 60 ± 3 | 55 ± 2 | 50 ± 2 | 0.01 | |
| Leucine (Leu) | Control | 51 ± 2 | 45 ± 2 | 35 ± 2 | 0.01 |
| Betaine‐treated | 50 ± 2 | 48 ± 2 | 45 ± 2 | 0.01 | |
| Isoleucine (Ile) | Control | 35.24± 2 | 30 ± 1 | 25 ± 1 | 0.01 |
| Betaine‐treated | 35 ± 2 | 33 ± 1 | 32 ± 1 | 0.01 | |
| Histidine (His) | Control | 69.25 ± 3 | 60 ± 2 | 55 ± 2 | 0.04 |
| Betaine‐treated | 70 ± 3 | 65 ± 2 | 60 ± 2 | 0.04 | |
| Phenylalanine (Phe) | Control | 39.88 ± 2 | 35 ± 1 | 30 ± 1 | 0.04 |
| Betaine‐treated | 40 ± 2 | 38 ± 1 | 36 ± 1 | 0.04 | |
| Tryptophan (Trp) | Control | 31.25 ± 2 | 25 ± 1 | 20 ± 1 | 0.04 |
| Betaine‐treated | 30 ± 2 | 28 ± 1 | 25 ± 1 | 0.04 | |
| Arginine (Arg) | Control | 82.15 ± 4 | 70 ± 3 | 65 ± 2 | 0.01 |
| Betaine‐treated | 80.01 ± 4 | 75 ± 3 | 70 ± 3 | 0.01 | |
| Cysteine (Cys) | Control | 25.2 ± 2 | 20 ± 1 | 18 ± 1 | 0.04 |
| Betaine‐treated | 25 ± 2 | 23 ± 1 | 22 ± 1 | 0.04 |
Note: Values are presented as mean ± SE. Statistical significance for treatment (control vs. betaine), time (Weeks 0, 2, and 4), and their interaction (Time × Treatment) was assessed using two‐way repeated‐measures ANOVA. Significance was declared at p ≤ 0.05.
TABLE 6.
Plasma mineral levels (mg/dL) in control and betaine‐treated groups at Weeks 0, 2, and 4 under heat‐stressed conditions.
| Mineral | Group | Week 0 | Week 2 | Week 4 | p‐value |
|---|---|---|---|---|---|
| Calcium (Ca) | Control | 9.02 ± 0.3 | 8.5 ± 0.2 | 7.5 ± 0.3 | 0.04 |
| Betaine‐treated | 9.5 ± 0.3 | 9.0 ± 0.3 | 8.8 ± 0.3 | 0.02 | |
| Phosphorus (P) | Control | 4.12 ± 0.2 | 4.0 ± 0.2 | 3.5 ± 0.2 | 0.01 |
| Betaine‐treated | 4.5 ± 0.2 | 4.3 ± 0.2 | 4.1 ± 0.2 | 0.02 | |
| Magnesium (Mg) | Control | 2.12 ± 0.1 | 1.8 ± 0.1 | 1.5 ± 0.1 | 0.03 |
| Betaine‐treated | 2.2 ± 0.1 | 2.0 ± 0.1 | 1.9 ± 0.1 | 0.04 | |
| Sodium (Na) | Control | 135.01 ± 2 | 128 ± 3 | 120 ± 3 | 0.01 |
| Betaine‐treated | 135 .02± 2 | 130 ± 3 | 128 ± 3 | 0.02 | |
| Potassium (K) | Control | 4.58 ± 0.2 | 4.0 ± 0.2 | 3.5 ± 0.2 | 0.02 |
| Betaine‐treated | 4.9 ± 0.2 | 4.5 ± 0.2 | 4.3 ± 0.2 | 0.01 | |
| Chloride (Cl) | Control | 101.2 ± 3 | 90 ± 3 | 80 ± 3 | 0.02 |
| Betaine‐treated | 100 ± 3 | 95 ± 3 | 92 ± 3 | 0.02 | |
| Iron (Fe) | Control | 102.15 ± 5 | 85 ± 4 | 70 ± 4 | 0.01 |
| Betaine‐treated | 100 ± 5 | 95 ± 4 | 90 ± 4 | 0.03 | |
| Zinc (Zn) | Control | 1.21 ± 0.1 | 1.0 ± 0.1 | 0.8 ± 0.1 | 0.04 |
| Betaine‐treated | 1.14 ± 0.1 | 1.1 ± 0.1 | 1.0 ± 0.1 | 0.02 | |
| Copper (Cu) | Control | 0.9 ± 0.1 | 0.6 ± 0.1 | 0.5 ± 0.1 | 0.03 |
| Betaine‐treated | 0.8 ± 0.1 | 0.7 ± 0.1 | 0.7 ± 0.1 | 0.01 |
Note: Values are presented as mean ± SE. Statistical significance for treatment (control vs. betaine), time (Weeks 0, 2, and 4), and their interaction (Time × Treatment) was assessed using two‐way repeated‐measures ANOVA. Significance was declared at p ≤ 0.05.
3.4. Ruminal Amino Acid Profile
Betaine supplementation positively influenced ruminal amino acid profiles in heat‐stressed dairy cows (Table 7). Rumen amino acid concentrations were significantly affected by dietary treatment in addition to sampling time. Compared with control cows, betaine‐supplemented cows maintained higher ruminal concentrations of several amino acids throughout the experimental period, with more pronounced differences observed at Week 4, indicating an apparent treatment effect on ruminal amino acid availability under heat‐stressed conditions. In the control group, ruminal lysine and methionine concentrations declined markedly by Week 4. In contrast, cows receiving betaine supplementation exhibited a milder reduction in lysine concentrations and only slight decreases in methionine levels over time, reflecting improved preservation of ruminal amino acids relative to the control group. Ruminal mineral concentrations were also significantly influenced by dietary treatment in addition to sampling time (Table 8). In the control group, calcium concentrations decreased sharply by Week 4, whereas betaine‐supplemented cows maintained higher calcium levels throughout the experimental period. Phosphorus and magnesium showed similar patterns, with pronounced declines in control cows and more moderate reductions in the betaine‐treated group. Consequently, cows receiving betaine supplementation exhibited consistently higher concentrations of calcium, phosphorus, magnesium, and electrolytes at Weeks 2 and 4 compared with control cows, demonstrating an apparent treatment effect on ruminal mineral balance under heat‐stressed conditions.
TABLE 7.
Rumen fluid analysis (mg/dL).
| Amino acid | Group | Week 0 | Week 2 | Week 4 | p‐value |
|---|---|---|---|---|---|
| Lysine (Lys) | Control | 41.1 ± 2 | 30 ± 1 | 25 ± 1 | 0.04 |
| Betaine‐treated | 40 ± 2 | 35 ± 1 | 30 ± 1 | 0.02 | |
| Methionine (Met) | Control | 30 ± 1 | 25 ± 1 | 20 ± 1 | 0.04 |
| Betaine‐treated | 32.2 ± 1 | 28 ± 1 | 25 ± 1 | 0.03 | |
| Threonine (Thr) | Control | 51.24 ± 3 | 40 ± 2 | 35 ± 2 | 0.01 |
| Betaine‐treated | 50 ± 3 | 45 ± 2 | 40 ± 2 | 0.02 | |
| Valine (Val) | Control | 40.21 ± 2 | 30 ± 1 | 25 ± 1 | 0.02 |
| Betaine‐treated | 40 ± 2 | 35 ± 1 | 30 ± 1 | 0.01 | |
| Leucine (Leu) | Control | 46.25 ± 2 | 35 ± 1 | 30 ± 1 | 0.02 |
| Betaine‐treated | 45 ± 2 | 40 ± 2 | 35 ± 2 | 0.04 | |
| Isoleucine (Ile) | Control | 25.2 ± 2 | 20 ± 1 | 18 ± 1 | 0.01 |
| Betaine‐treated | 25 ± 2 | 23 ± 1 | 22 ± 1 | 0.02 | |
| Histidine (His) | Control | 35.2 ± 2 | 30 ± 1 | 25 ± 1 | 0.03 |
| Betaine‐treated | 35 ± 2 | 33 ± 1 | 30 ± 1 | 0.04 | |
| Phenylalanine (Phe) | Control | 19.5 ± 1 | 15 ± 1 | 12 ± 1 | 0.04 |
| Betaine‐treated | 20 ± 1 | 18 ± 1 | 16 ± 1 | 0.02 | |
| Tryptophan (Trp) | Control | 11.25 ± 1 | 8 ± 0.5 | 6 ± 0.5 | 0.01 |
| Betaine‐treated | 10.25 ± 1 | 9 ± 0.5 | 8 ± 0.5 | 0.03 | |
| Arginine (Arg) | Control | 49.25 ± 3 | 40 ± 2 | 35 ± 2 | 0.01 |
| Betaine‐treated | 50 ± 3 | 45 ± 2 | 40 ± 2 | 0.01 | |
| Cysteine (Cys) | Control | 16.25 ± 1 | 12 ± 1 | 10 ± 1 | 0.02 |
| Betaine‐treated | 15 ± 1 | 13 ± 1 | 12 ± 1 | 0.01 |
Note: Values are presented as mean ± SE. Statistical significance for treatment (control vs. betaine), time (Weeks 0, 2, and 4), and their interaction (Time × Treatment) was assessed using two‐way repeated‐measures ANOVA. Significance was declared at p ≤ 0.05.
TABLE 8.
Rumen mineral levels (mg/dL).
| Mineral | Group | Week 0 | Week 2 | Week 4 | p‐value |
|---|---|---|---|---|---|
| Calcium (Ca) | Control | 59.2 ± 3 | 50 ± 3 | 40 ± 2 | 0.04 |
| Betaine‐treated | 60 ± 3 | 55 ± 3 | 50 ± 3 | 0.02 | |
| Phosphorus (P) | Control | 19.25 ± 1 | 15 ± 1 | 12 ± 1 | 0.01 |
| Betaine‐treated | 20 ± 1 | 18 ± 1 | 16 ± 1 | 0.04 | |
| Magnesium (Mg) | Control | 31.2 ± 2 | 25 ± 2 | 20 ± 1 | 0.02 |
| Betaine‐treated | 30 ± 2 | 28 ± 2 | 26 ± 2 | 0.03 | |
| Sodium (Na) | Control | 402.1 ± 10 | 350 ± 15 | 300 ± 15 | 0.01 |
| Betaine‐treated | 400 ± 10 | 380 ± 10 | 370 ± 10 | 0.01 | |
| Potassium (K) | Control | 199.2 ± 5 | 170 ± 5 | 150 ± 5 | 0.02 |
| Betaine‐treated | 200 ± 5 | 190 ± 5 | 180 ± 5 | 0.02 | |
| Chloride (Cl) | Control | 299.2 ± 10 | 250 ± 10 | 200 ± 10 | 0.03 |
| Betaine‐treated | 300 ± 10 | 280 ± 10 | 260 ± 10 | 0.04 |
Note: Values are presented as mean ± SE. Statistical significance for treatment (control vs. betaine), time (Weeks 0, 2, and 4), and their interaction (Time × Treatment) was assessed using two‐way repeated‐measures ANOVA. Significance was declared at p ≤ 0.05.
3.5. Ruminal Bacteria Profiles
The relative abundance of 10 key ruminal bacterial species in Holstein cows fed either a control diet (CON) or a betaine‐supplemented diet (BET) during a heat‐stressed trial is presented in Table 9 and Figure 1. Betaine supplementation significantly increased the abundance of B. proteoclasticus (p = 0.04), F. succinogenes (p = 0.02), M. elsdenii (p = 0.04), and S. dextrinosolvens (p = 0.03). Additionally, several bacterial species exhibited significant weak effects, including A. lipolytica (p = 0.02), E. ruminantium (p = 0.01), M. elsdenii (p ≤ 0.01), p. bryantii (p ≤ 0.01), S. amylolytica (p ≤ 0.01), and S. bovis (p ≤ 0.01).
TABLE 9.
Relative abundance of microbial species in mixed ruminal fluid from Holstein cows fed a control diet (CON) or a betaine‐supplemented diet (BET) at Weeks 0, 2, and 4.
| Species | Week × Treatment | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Treatment | Week | CON | BET | p‐value 1 | ||||||||||
| CON | BET | Week 0 | Week 2 | Week 4 | Week 0 | Week 2 | Week 4 | Week 0 | Week 2 | Week 4 | Trt | Wk | TXW | |
| A. lipolytica | −3.42 | −2.921 | −4.075a | −3.616b | −2.466b | −4.075 | −3.616 | −2.466 | −4.091 | −3.959 | −1.788 | 0.25 | 0.02 | 0.53 |
| B. proteoclasticus | −0.431 | −0.281 | −1.077a | −1.133b | 0.037c | −1.077 | −1.133 | 0.037 | −1.077 | −1.028 | 0.255 | 0.04 | 0.06 | 0.98 |
| E. ruminantium | 0.066 | 0.064 | 0.565 | 0.426 | 0.025 | 0.565A | 0.426B | 0.025C | 0.565B | 0.442B | 0.250C | 0.13 | <0.01 | 0.80 |
| F. succinogenes | −1.674 | −1.344 | −2.620 | −2.854 | −1.537 | −2.620 | −2.854 | −1.537 | −2.620 | −2.854 | −0.770 | 0.02 | 0.07 | 0.53 |
| M. elsdenii | −3.699 | −3.022 | −4.439b | −4.333a | −2.733c | −4.439b | −4.333 | −2.733 | −4.439 | −4.324 | −2.521 | 0.04 | <0.01 | 0.92 |
| P. bryantii | −0.157 | −0.167 | −1.704 | −1.526 | 0.453 | −1.703 | −1.526 | 0.453 | −1.703 | −1.682 | 0.358 | 0.21 | <0.01 | 0.85 |
| S. ruminantium | −0.372 | −0.397 | 1.568 | 1.431 | 1.279 | 1.568 | 1.431 | 1.279 | 1.568 | 1.447 | 1.418 | 0.68 | 0.06 | 0.41 |
| S. amylolytica | −0.81 | −0.75 | −0.199c | −0.135b | −1.009a | −0.199D | −0.135C | −1.009A | −0.199D | −0.135 | −1.088B | 0.59 | <0.01 | 0.55 |
| S. bovis | −4.523 | −4.523 | −3.665b | −3.936c | −5.294a | −3.666BC | −3.936F | −5.294A | −3.666C | −3.900D | −4.513B | 0.05 | <0.01 | 0.32 |
| S. dextrinosolvens | −0.886 | −0.52 | −0.561 | −0.757 | −1.780 | −0.561 | −0.757 | −1.780 | −0.561 | −0.733 | −0.493 | 0.03 | 0.29 | 0.06 |
Note: Values are presented as means. p‐values were obtained from a two‐way ANOVA.
Trt = treatment effect (control vs. betaine), Wk = week effect (Weeks 0, 2, and 4), T × W = treatment × week interaction.
abMeans within a row with different letters differ significantly for the overall treatment or weak effect (p < 0.05).
A–CMeans that within a row with different letters differ significantly for the interaction between treatment and week (p < 0.05).
FIGURE 1.

Relative abundance of microbial species over time in control (CON) and treatment (BET) groups.
A more detailed analysis (Table 2) showed that A. lipolytica was significantly affected by week (p = 0.02), although neither the therapy nor its interaction with week had any discernible impact. In the case of B. proteoclasticus, betaine supplementation led to a significant increase in its relative abundance (p = 0.04), with a trend toward a weak effect (p = 0.06) but no significant interaction between treatment and week.
For E. ruminantium, a significant week effect was observed (p ≤ 0.01), though treatment and interaction effects were not significant. F. succinogenes abundance was extensively elevated in the BET group (p = 0.02), with a trend for a week effect (p = 0.07), but no significant interaction between treatment and week was observed. The result also revealed that M. elsdenii was influenced by both treatment (p = 0.04) and weak (p ≤ 0.01), although the interaction effect was not significant. A weak influence was monitored for P. bryantii (p ≤ 0.01), but treatment and interaction effects were insignificant. Similarly, S. ruminantium showed a trend toward a weak effect (p = 0.06), with no significant treatment or interaction effects. The abundance of S. amylolytica was highly influenced by week (p ≤ 0.01), though treatment and interaction effects were insignificant. For S. bovis, significant effects were observed for both treatment (p ≤ 0.05) and week (p ≤ 0.01), while the interaction was not significant. Lastly, S. dextrinosolvens was significantly affected by betaine supplementation (p ≤ 0.05), although neither the weak effect (p = 0.29) nor the interaction (p = 0.06) reached significance.
The Hierarchical Cluster Analysis (HCA) dendrogram showed clear differences between the control and betaine groups based on feed intake, rumen pH, VFAs, milk yield, and milk composition. The betaine groups, especially in Weeks 2 and 4, formed distinct clusters, indicating that betaine supplementation significantly impacted these metrics. As the study progressed, the differences between the control and betaine groups became more pronounced, reflecting improvements in milk production and rumen conditions for the betaine group. Overall, the analysis highlighted the positive effects of betaine supplementation compared to the control (Figure 2). The enhanced principal component analysis (PCA) plot demonstrated the separation between the Control and betaine groups, with distinct clustering patterns along the principal components (PC1 and PC2), which explained most of the data variance. The betaine‐treated group showed a progressive shift, particularly from Week 0 to Week 4, indicating a distinct response to supplementation over time. The separation along PC1 primarily reflected changes in feed intake, milk yield, and rumen parameters, while PC2 captured variations in milk composition and VFAs. This clustering highlighted the significant impact of betaine supplementation in improving production and rumen metrics compared to the control (Figure 3). The heatmaps showed clear trends in inflammatory markers, microbial species, and rumen minerals over time between the control and betaine groups. Betaine treatment consistently reduced inflammatory markers like ceruloplasmin and haptoglobin compared to the control, indicating a positive anti‐inflammatory effect. Microbial species such as B. proteoclasticus and M. elsdenii increased abundance with betaine, reflecting its impact on rumen microbial dynamics. Rumen minerals like calcium, phosphorus, and potassium were better maintained in the betaine group, suggesting improved nutrient status and metabolic support. These results highlighted the beneficial effects of betaine supplementation on inflammation, microbial balance, and mineral levels (Figure 4).
FIGURE 2.

Hierarchical clustering dendrogram (HCA).
FIGURE 3.

PCA: principal component analysis with enhanced representation.
FIGURE 4.

Heatmap of rumen mineral levels over time.
4. Discussion
The current study reflects short‐term physiological, metabolic, and ruminal microbial responses to betaine supplementation under heat‐stressed conditions in mitigating heat‐stressed effects on lactating dairy cows, improving their performance, ruminal fermentation, and blood metabolite profiles, and effectively mitigating hyperthermia and respiratory distress. These findings align with previous research and provide deeper insights into the mechanisms underlying betaine's efficacy as a dietary intervention. Betaine supplementation significantly enhanced feed intake, milk yield, and milk composition in heat‐stressed cows. This finding aligns with Wang et al. (2010), who demonstrated that betaine improves feed efficiency and milk production in dairy cows. Similarly, Dunshea et al. (2019) found that betaine supplementation stabilised milk yield and components in grazing dairy cows under high temperatures.
The increase in feed intake observed in the current study may be attributed to betaine's osmolyte properties, which stabilise cellular function, protect proteins from denaturation, and reduce energy expenditure for thermoregulation during heat stress (Ratriyanto et al. 2009). The positive effect of betaine on milk composition, particularly increases in milk fat and protein, corroborates (Davidson et al. 2008), who reported that betaine supports methyl group and energy metabolism critical during heat stress. Enhanced nutrient utilisation and energy efficiency likely contributed to the observed production improvements. Reducing oxidative stress and systemic inflammation with betaine supplementation, as evidenced by lower acute‐phase protein levels (ceruloplasmin, haptoglobin, and serum amyloid A), demonstrates its systemic protective effects. These results are consistent with Bernabucci and Mele (2014), who highlighted the exacerbation of oxidative damage and inflammatory responses in dairy cows under heat stress.
Betaine's role as a methyl donor likely enhances antioxidant pathways and reduces oxidative load (Ratriyanto et al. 2009). The preservation of plasma amino acids, particularly lysine and methionine, further supports findings by Wang et al. (2020), who noted enhanced amino acid utilisation with betaine supplementation. This preservation is essential for protein synthesis, repair, and maintenance of metabolic functions under stress conditions, providing resilience against the adverse effects of heat. The significant changes observed in the ruminal microbial community in this study underscore the role of betaine supplementation in enhancing microbial stability and fermentation efficiency under heat‐stressed conditions. Increased abundances of fibrinolytic bacteria such as Fibrobacter succinogenes and Butyrivibrio proteoclasticus, along with lactate‐utilising species like Megasphaera elsdenii and Selenomonas dextrinosolvens, highlight betaine's capacity to modulate the ruminal ecosystem, promoting feed efficiency and nutrient digestion.
Betaine supplementation significantly increased the abundance of key fibrinolytic bacteria, including F. succinogenes and B. proteoclasticus. These bacteria are critical for breaking down complex plant fibres, contributing to energy availability and overall efficiency in ruminant diets. F. succinogenes, a Gram‐negative anaerobic bacterium, is a primary cellulose degrader in the rumen, playing an essential role in digesting plant fibres and optimising forage‐based diets (Flint et al. 1990). Similarly, B. proteoclasticus, a Gram‐positive bacterium with fibrinolytic and proteolytic capabilities, contributes to the degradation of polysaccharides such as cellulose and hemicellulose, enhancing nutrient availability (Wallace et al. 2006).
The observed increase in these bacterial populations supports findings by Wang et al. (2020), who reported that betaine supplementation enhanced fibrinolytic microbial abundance, potentially due to its osmoprotective properties. These properties help stabilise microbial cells under heat stress, allowing for more efficient fibre digestion and nutrient absorption (Loest et al. 2002).
The increase in M. elsdenii, a key lactate‐utilising bacterium, further emphasises betaine's role in maintaining rumen stability. This bacterium converts lactic acid to volatile fatty acids (VFAs) such as propionate, acetate, and butyrate, which are critical for energy metabolism. Stabilising lactic acid levels prevents the occurrence of acidosis, a common risk under high‐grain diets or heat‐stressed conditions (Su et al. 2022). The enhanced abundance of M. elsdenii suggests that betaine improves fibre digestion and facilitates the management of rapid fermentation and lactate accumulation, contributing to a stable ruminal environment.
Betaine supplementation influenced a balance between fibrinolytic bacteria like F. succinogenes and B. proteoclasticus and lactate‐utilising species like M. elsdenii and S. dextrinosolvens. This balance is critical for optimal fermentation and nutrient utilisation, particularly under heat stress when microbial activity can be compromised. The potential interaction between F. succinogenes and B. proteoclasticus observed in this study aligns with Wang et al. (2020), who suggested that betaine provides nitrogen and methyl groups necessary for microbial growth and activity, enhancing fibre degradation.
Additionally, S. dextrinosolvens, known for its role in carbohydrate metabolism, showed a significant increase with betaine supplementation. This bacterium contributes to the fermentation of starch and soluble carbohydrates, supporting the overall efficiency of the ruminal microbial ecosystem (Li et al. 2013). The dynamic shifts in microbial populations suggest that betaine modulates the ruminal environment to support fibre and starch digestion, which are critical under heat stress when feed intake often decreases. The increase in total VFAs, particularly acetate and propionate, indicates enhanced ruminal fermentation. Acetate is a precursor for milk fat synthesis, while propionate is an essential glucose precursor, supporting energy metabolism (Wang et al. 2020). These improvements in fermentation efficiency and nutrient digestibility align with previous studies demonstrating betaine's role in increasing dry matter (DM), organic matter (OM), and fibre fraction digestibility (Wang et al. 2020). The increase in dry matter intake (DMI) observed with betaine supplementation can be explained by its combined effects on ruminal digestibility and systemic heat‐stressed alleviation. At the rumen level, betaine enhances microbial stability and activity by acting as an osmoprotectant, thereby supporting fibrolytic bacteria and improving fibre degradation, volatile fatty acid production, and overall fermentation efficiency (Mahmood et al. 2020). Improved ruminal fermentation increases nutrient availability and reduces the accumulation of fermentation by‐products that can suppress feed intake during heat stress. Concurrently, post‐ruminally absorbed betaine contributes to improved cellular hydration and reduced metabolic heat production by lowering the energy costs associated with ion pumping and osmotic regulation (Figueroa‐Soto and Valenzuela‐Soto 2018). These systemic effects attenuate hyperthermia, oxidative stress, and inflammatory responses, as evidenced by reduced rectal temperature and respiration rate, thereby improving cow comfort and appetite (Al‐Qaisi et al. 2020). Collectively, these ruminal and extra‐ruminal mechanisms explain how betaine supplementation facilitates greater DMI, which in turn supports higher milk yield in heat‐stressed dairy cows. Betaine's osmoprotective properties likely contributed to these effects by stabilising microbial activity and reducing the energy costs of ion transport and water regulation in rumen cells (Csonka 1989). The improved nutrient digestibility observed in this study reflects the ability of betaine to enhance ruminal nutrient degradation and post‐rumen absorption. Dynamic changes in bacterial populations over the study period, particularly in species like S. amylolytica, S. bovis, and P. bryantii, suggest that the ruminal microbial community adapts to betaine supplementation and heat‐stressed conditions. S. amylolytica plays a significant role in starch digestion, a critical process during heat stress when energy requirements are altered. In contrast, S. bovis, known for its rapid starch fermentation and lactic acid production, exhibited shifts in abundance, likely reflecting a metabolic interplay with lactate‐utilising bacteria such as M. elsdenii and P. bryantii. This interaction underscores betaine's importance in maintaining a balanced ruminal ecosystem to prevent acidosis and optimise fermentation processes.
The environmental conditions during the experimental period confirmed sustained heat stress, as temperature–humidity index (THI) values frequently exceeded the critical threshold of 72 (Figure S1). Under such conditions, dairy cows typically exhibit adaptive physiological responses, including elevated rectal temperature and increased respiration rate, aimed at dissipating excess body heat. In the present study, cows in the control group showed a progressive increase in both rectal temperature and respiration rate as heat stress persisted, reflecting limited capacity to cope with the thermal load.
In contrast, cows receiving betaine supplementation exhibited significantly lower rectal temperatures and respiration rates throughout the experimental period (Figures S2 and S3), indicating improved thermoregulatory efficiency. These responses suggest that betaine enhanced heat‐stressed adaptation by reducing metabolic heat production and improving cellular hydration through its osmoprotective properties (Monika et al. 2025). By lowering the energetic cost of ion transport and maintaining intracellular osmotic balance, betaine likely alleviated systemic heat load, thereby attenuating hyperthermia and excessive respiratory effort (Willingham 2021). The observed physiological responses are consistent with the reduced inflammatory markers and improved feed intake in betaine‐supplemented cows (Buonaiuto et al. 2025), highlighting a coordinated adaptive response that contributed to enhanced heat‐stressed tolerance.
The consistent effects of betaine on microbial populations and fermentation throughout the heat‐stressed period highlight its potential as an effective dietary intervention. These findings align with Sharma et al. (2009), who noted that betaine stabilises cellular functions, reducing thermal strain and improving productivity under challenging conditions. Betaine's role in mitigating inflammation and oxidative stress further supports its systemic benefits, as observed in reduced acute‐phase protein levels in the current study.
Elevated total VFAs in the betaine‐supplemented group, particularly acetate and propionate, indicate enhanced ruminal fermentation and nutrient utilisation. These results align with Wang et al. (2010), who observed increased VFA concentrations and improved digestibility with betaine supplementation. Acetate is a key precursor for milk fat synthesis, while propionate is a glucose precursor, providing energy for metabolic processes. Betaine's role in maintaining cellular hydration and microbial activity is likely contributed to these improvements, as osmoprotective effects reduce energy costs associated with ion transport and water regulation in ruminal cells (Csonka 1989). These benefits extended to apparent total‐tract digestibility, with increased DM, OM, NDF, and ADF digestibility reflecting betaine's role in enhancing ruminal nutrient digestibility, degradation, and post‐rumen absorption. The increased abundance of Selenomonas dextrinosolvens and other fibrinolytic bacteria suggests betaine's influence on carbohydrate metabolism and protein degradation, which is critical during heat stress when protein metabolism is impaired (Li et al. 2013).
The dynamic shifts in S. amylolytica and S. bovis indicate betaine's regulatory role in starch fermentation and lactate production. The interaction between F. succinogenes and B. proteoclasticus, as noted by Wang et al. (2020), highlights betaine's ability to enhance nitrogen and methyl group availability, facilitating microbial growth and fibre digestion. This interplay likely contributes to the observed microbial stability and nutrient utilisation improvements. Betaine supplementation demonstrated consistent effects on microbial populations, throughout the heat‐stressed period. These findings align with Loest et al. (2002), who reported that higher doses of betaine bypass ruminal degradation and are absorbed in the small intestine, thereby improving nutrient digestibility and overall metabolic efficiency.
While the current study highlights the multifaceted benefits of betaine supplementation, additional research is required to understand its long‐term effects on ruminal microbiota and how these alterations influence animal performance. Investigating how betaine interacts with other dietary nutrients and examining its synergistic impact with different feeding strategies could enhance its efficacy in managing heat stress. Furthermore, exploring the molecular mechanisms by which betaine modulates rumen microbial ecology over time will provide deeper insights into its role as a dietary intervention, particularly in optimising feeding strategies for dairy cows under heat‐stressed conditions.
5. Conclusions
In conclusion, short‐term dietary supplementation of betaine at 80 g/day per cow for 4 weeks effectively mitigated heat stress–induced impairments in lactating dairy cows. Betaine enhanced thermoregulatory responses and ruminal fermentation by increasing volatile fatty acid production, stabilising ruminal microbial populations—particularly fibrolytic and lactate‐utilising bacteria—and improving nutrient utilisation and energy metabolism. These effects were accompanied by increased feed intake, milk yield, and improved milk composition, as well as preservation of plasma and rumen amino acid profiles and stabilisation of plasma mineral levels. Additionally, betaine reduced oxidative stress and inflammatory responses, likely through its osmoprotective properties, thereby alleviating metabolic strain and supporting overall productivity and health. Nevertheless, further studies are warranted to evaluate the long‐term effects, optimal supplementation levels, and underlying molecular mechanisms of betaine under prolonged heat‐stressed conditions.
Author Contributions
Mohamed Abdelmegeid: conceptualization, data curation, formal analysis, investigation, methodology, project administration, supervision, writing – original draft. Walaa Elhendawy: conceptualization, data curation, formal analysis, investigation, methodology, project administration, writing – original draft. Helmy Kamal Elnafarawy: conceptualization, funding acquisition, methodology, project administration, supervision, writing – original draft. Mohamed Zeineldin: conceptualization, funding acquisition, methodology, project administration, supervision, writing – original draft. Rabiha Seboussi: conceptualization, funding acquisition, methodology, project administration, supervision, writing – original draft. Mustafa Shukry: conceptualization, funding acquisition, methodology, project administration, supervision, writing – original draft. Mohamed Donia: conceptualization, investigation, methodology, project administration, supervision, writing – original draft. Aboma Zewude: conceptualization, investigation, methodology, project administration, supervision, writing – original draft. Gobena Ameni: conceptualization, investigation, methodology, project administration, supervision, writing – original draft. Hazim O. Khalifa: conceptualization, investigation, methodology, project administration, supervision, writing – original draft. Naglaa Gomaa: conceptualization, methodology, supervision, writing – original draft. Ahmed A. Elolimy: conceptualization, methodology, supervision, writing – original draft. Midhat Nassif: conceptualization, methodology, supervision, writing – original draft.
Funding
This work was supported by the Deanship of Scientific Research, Vice Presidency for Graduate Research, King Faisal University, Saudi Arabia (Grant No. KFU260549).
Ethics Statement
The authors confirm that the ethical policies of the journal, as noted on the journal's author guidelines page, have been adhered to and the appropriate ethical review committee approval has been received. The US National Research Council's guidelines for the Care and Use of Laboratory Animals were followed the research committee of the College of Veterinary Medicine at Kafr‐Elsheikh University in Kafr El‐Shaikh, Egypt, approved this work (KFS‐IACUC/95/2019). The study received approval from the institutional ethical review board, and all necessary permissions for the use of animals in the farm setting were obtained. The animals were handled by trained personnel, and efforts were made to minimise distress and discomfort during the study.
Conflicts of Interest
The authors declare no conflicts of interest.
Supporting information
Supporting Figure 1: Ambient temperature and temperature–humidity index (THI) during the experimental period.
Supporting Figure 2: Changes in rectal temperature (°C) of heat‐stressed dairy cows fed either a control diet (CON) or a betaine‐supplemented diet (BET) over the 4‐week experimental period. Rectal temperature was measured twice weekly. Values are presented as mean ± SE.
Supporting Figure 3: Changes in respiration rate (breaths/min) of heat‐stressed dairy cows fed either a control diet (CON) or a betaine‐supplemented diet (BET) over the 4‐week experimental period. Respiration rate was recorded twice weekly. Values are presented as mean ± SE.
Data Availability Statement
Data supporting this study are available from the corresponding author upon request.
References
- Abdelmegeid, M. K. 2025. “Effects of Betaine Supplementation on Heat Stress‐Associated Blood Metabolites, Antioxidant Profiles and Milk Production in Dairy Cows.” Egyptian Journal of Veterinary Sciences 56, no. 4: 779–789. [Google Scholar]
- Al‐Qaisi, M. , Horst E. A., Kvidera S. K., et al. 2020. “Effects of Dietary Electrolytes, Osmolytes, and Energetic Compounds on Body Temperature Indices in Heat‐Stressed Lactating Cows.” Research in Veterinary Science 132: 42–48. [DOI] [PubMed] [Google Scholar]
- Analytical, F. 2008. MilkoScan 6000 FT+: Operator's Manual . FOSS Analytical.
- Bernabucci, U. , and Mele M.. 2014. “Effect of Heat Stress on Animal Production and Welfare: The Case of a Dairy Cow.” Agrochimica 58, no. 1: 53–60. [Google Scholar]
- Bertoni, G. , Trevisi E., Han X., and Bionaz M.. 2008. “Effects of Inflammatory Conditions on Liver Activity in Puerperium Period and Consequences for Performance in Dairy Cows.” Journal of Dairy Science 91, no. 9: 3300–3310. [DOI] [PubMed] [Google Scholar]
- Buonaiuto, G. , Federiconi A., Vecchiato C. G., Benini E., and Mordenti A. L.. 2025. “Betaine Dietary Supplementation: Healthy Aspects in Human and Animal Nutrition.” Antioxidants 14, no. 7: 771. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cohen, S. A. , and Michaud D. P.. 1993. “Synthesis of a Fluorescent Derivatizing Reagent, 6‐Aminoquinolyl‐N‐Hydroxysuccinimidyl Carbamate, and Its Application for the Analysis of Hydrolysate Amino Acids via High‐Performance Liquid Chromatography.” Analytical Biochemistry 211, no. 2: 279–287. [DOI] [PubMed] [Google Scholar]
- Cronje, P. 2016. “Essential Role of Methyl Donors in Animal Productivity.” Animal Production Science 58, no. 4: 655–665. [Google Scholar]
- Csonka, L. N. 1989. “Physiological and Genetic Responses of Bacteria to Osmotic Stress.” Microbiological Reviews 53, no. 1: 121–147. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Davidson, S. , Hopkins B., Odle J., Brownie C., Fellner V., and Whitlow L.. 2008. “Supplementing Limited Methionine Diets With Rumen‐Protected Methionine, Betaine, and Choline in Early Lactation Holstein Cows.” Journal of Dairy Science 91, no. 4: 1552–1559. [DOI] [PubMed] [Google Scholar]
- Dunshea, F. R. , Oluboyede K., DiGiacomo K., Leury B. J., and Cottrell J. J.. 2019. “Betaine Improves Milk Yield in Grazing Dairy Cows Supplemented With Concentrates at High Temperatures.” Animals 9, no. 2: 57. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ekine‐Dzivenu, C. C. , Mrode R., Oyieng E., et al. 2020. “Evaluating the Impact of Heat Stress as Measured by Temperature‐Humidity Index (THI) on Test‐Day Milk Yield of Small Holder Dairy Cattle in a Sub‐Sahara African Climate.” Livestock Science 242: 104314. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Elolimy, A. A. , Abdelmegeid M. K., McCann J. C., Shike D. W., and Loor J. J.. 2018. “Residual Feed Intake in Beef Cattle and Its Association With Carcass Traits, Ruminal Solid‐Fraction Bacteria, and Epithelium Gene Expression.” Journal of Animal Science and Biotechnology 9: 1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Figueroa‐Soto, C. G. , and Valenzuela‐Soto E. M.. 2018. “Glycine Betaine Rather Than Acting Only as an Osmolyte Also Plays a Role as Regulator in Cellular Metabolism.” Biochimie 147: 89–97. [DOI] [PubMed] [Google Scholar]
- Fliegerova, K. , Mura E., Mrázek J., and Moniello G.. 2016. “A Comparison of Microbial Profiles of Different Regions of the Equine Hindgut.” Livestock Science 190: 16–19. [Google Scholar]
- Flint, H. J. , McPherson C. A., Avgustin G., and Stewart C. S.. 1990. “Use of a Cellulase‐Encoding Gene Probe to Reveal Restriction Fragment Length Polymorphisms Among Ruminal Strains of Bacteroides succinogenes .” Current Microbiology 20: 63–67. [Google Scholar]
- Ghanem, M. , Zeineldin M., Eissa A., El Ebissy E., Mohammed R., and Abdelraof Y.. 2018. “The Effects of Saline Water Consumption on the Ultrasonographic and Histopathological Appearance of the Kidney and Liver in Barki Sheep.” Journal of Veterinary Medical Science 80, no. 5: 741–748. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Grünwaldt, E. , Guevara J., Estevez O., et al. 2005. “Biochemical and Haematological Measurements in Beef Cattle in Mendoza Plain Rangelands (Argentina).” Tropical Animal Health and Production 37: 527–540. [DOI] [PubMed] [Google Scholar]
- Hall, L. , Dunshea F., Allen J., et al. 2016. “Evaluation of Dietary Betaine in Lactating Holstein Cows Subjected to Heat Stress.” Journal of Dairy Science 99, no. 12: 9745–9753. [DOI] [PubMed] [Google Scholar]
- Hou, Y. , Zhang L., Dong R., et al. 2021. “Comparing Responses of Dairy Cows to Short‐Term and Long‐Term Heat Stress in Climate‐Controlled Chambers.” Journal of Dairy Science 104, no. 2: 2346–2356. [DOI] [PubMed] [Google Scholar]
- IBM Corp. 2013. “IBM SPSS Statistics for Windows, Version 22.0.” IBM Corp.
- Kaneko, J. J. , Harvey J. W., and Bruss M. L.. 2008. Clinical Biochemistry of Domestic Animals. Academic Press. [Google Scholar]
- Li, Z. P. , Liu H. L., Li G. Y., et al. 2013. “Molecular Diversity of Rumen Bacterial Communities From Tannin‐Rich and Fiber‐Rich Forage Fed Domestic Sika Deer (Cervus nippon) in China.” BMC Microbiology 13: 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Loest, C. , Titgemeyer E., Van Metre G. S.‐J. D., and Smith J.. 2002. “Methionine as a Methyl Group Donor in Growing Cattle.” Journal of Animal Science 80, no. 8: 2197–2206. [DOI] [PubMed] [Google Scholar]
- Mahmood, M. , Petri R. M., Gavrău A., Zebeli Q., and Khiaosa‐ard R.. 2020. “Betaine Addition as a Potent Ruminal Fermentation Modulator Under Hyperthermal and Hyperosmotic Conditions In Vitro.” Journal of the Science of Food and Agriculture 100, no. 5: 2261–2271. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Monika, M. , Rokade J., Gopi M., et al. 2025. “Mitigation of Heat Stress in Broiler Chickens During Hot Summer Seasons Through Betaine Hydrochloride Osmoprotectant Intervention.” Indian Journal of Animal Research 1: 7. [Google Scholar]
- Pappa, E. C. , and Sotirakoglou K.. 2008. “Changes of Free Amino Acid Content of Teleme Cheese Made With Different Types of Milk and Culture.” Food Chemistry 111, no. 3: 606–615. [Google Scholar]
- Perez, C. , Koshy C., Ressl S., Nicklisch S., Krämer R., and Ziegler C.. 2011. “Substrate Specificity and Ion Coupling in the Na+/Betaine Symporter BetP.” The EMBO Journal 30, no. 7: 1221–1229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Perfield J. II, Sæbø A., and Bauman D.. 2004. “Use of Conjugated Linoleic Acid (CLA) Enrichments to Examine the Effects of Trans‐8, Cis‐10 CLA, and Cis‐11, Trans‐13 CLA on Milk‐Fat Synthesis.” Journal of Dairy Science 87, no. 5: 1196–1202. [DOI] [PubMed] [Google Scholar]
- Ratriyanto, A. , Mosenthin R., Bauer E., and Eklund M.. 2009. “Metabolic, Osmoregulatory and Nutritional Functions of Betaine in Monogastric Animals.” Asian‐Australasian Journal of Animal Sciences 22, no. 10: 1461–1476. [Google Scholar]
- Ren, G. , Hao X., Zhang X., Liu S., and Zhang J.. 2022. “Effects of Guanidinoacetic Acid and Betaine on Growth Performance, Energy and Nitrogen Metabolism, and Rumen Microbial Protein Synthesis in Lambs.” Animal Feed Science and Technology 292: 115402. [Google Scholar]
- Saeed, M. , Babazadeh D., Naveed M., Arain M. A., Hassan F. U., and Chao S.. 2017. “Reconsidering Betaine as a Natural Anti‐Heat Stress Agent in Poultry Industry: A Review.” Tropical Animal Health and Production 49, no. 7: 1329–1338. [DOI] [PubMed] [Google Scholar]
- Sammad, A. , Wang Y. J., Umer S., et al. 2020. “Nutritional Physiology and Biochemistry of Dairy Cattle Under the Influence of Heat Stress: Consequences and Opportunities.” Animals 10, no. 5: 793. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shah, A. M. , Ma J., Wang Z., Zou H., Hu R., and Peng Q.. 2020. “Betaine Supplementation Improves the Production Performance, Rumen Fermentation, and Antioxidant Profile of Dairy Cows in Heat Stress.” Animals 10, no. 4: 634. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sharma, S. K. , Christen P., and Goloubinoff P.. 2009. “Disaggregating Chaperones: An Unfolding Story.” Current Protein and Peptide Science 10, no. 5: 432–446. [DOI] [PubMed] [Google Scholar]
- Su, M. , Wang H., Shi H., et al. 2022. “Yeast Products Mediated Ruminal Subenvironmental Microbiota, and Abnormal Metabolites and Digestive Enzymes Regulated Rumen Fermentation Function in Sheep.” Animals 12, no. 22: 3221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wallace, R. J. , Chaudhary L. C., McKain N., et al. 2006. “ Clostridium proteoclasticum: A Ruminal Bacterium That Forms Stearic Acid From Linoleic Acid.” Fems Microbiology Letters 265, no. 2: 195–201. [DOI] [PubMed] [Google Scholar]
- Wang, C. , Liu C., Zhang G., et al. 2020. “Effects of Rumen‐protected Folic Acid and Betaine Supplementation on Growth Performance, Nutrient Digestion, Rumen Fermentation and Blood Metabolites in Angus Bulls.” British Journal of Nutrition 123, no. 10: 1109–1116. [DOI] [PubMed] [Google Scholar]
- Wang, C. , Liu Q., Yang W., et al. 2010. “Effects of Betaine Supplementation on Rumen Fermentation, Lactation Performance, Feed Digestibilities and Plasma Characteristics in Dairy Cows.” The Journal of Agricultural Science 148, no. 4: 487–495. [Google Scholar]
- Warner, A. , and Stacy B.. 1965. “Solutes in the Rumen of the Sheep.” Quarterly Journal of Experimental Physiology and Cognate Medical Sciences: Translation and Integration 50, no. 2: 169–184. [DOI] [PubMed] [Google Scholar]
- Willingham, B. D. 2021. “The Effects of Pre‐Loaded Betaine Supplementation on Fluid Balance and Thermoregulation in the Heat.” Doctoral Thesis, The Florida State University.
- Wu, F. , and Tanoue E.. 2001. “Sensitive Determination of Dissolved Tryptophan in Freshwater by Alkaline Hydrolysis and HPLC.” Analytical Sciences 17, no. 9: 1063–1066. [DOI] [PubMed] [Google Scholar]
- Zom, R. , Van Baal J., Goselink R., Bakker J., De Veth M., and Van Vuuren A.. 2011. “Effect of Rumen‐Protected Choline on Performance, Blood Metabolites, and Hepatic Triacylglycerols of Periparturient Dairy Cattle.” Journal of Dairy Science 94, no. 8: 4016–4027. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supporting Figure 1: Ambient temperature and temperature–humidity index (THI) during the experimental period.
Supporting Figure 2: Changes in rectal temperature (°C) of heat‐stressed dairy cows fed either a control diet (CON) or a betaine‐supplemented diet (BET) over the 4‐week experimental period. Rectal temperature was measured twice weekly. Values are presented as mean ± SE.
Supporting Figure 3: Changes in respiration rate (breaths/min) of heat‐stressed dairy cows fed either a control diet (CON) or a betaine‐supplemented diet (BET) over the 4‐week experimental period. Respiration rate was recorded twice weekly. Values are presented as mean ± SE.
Data Availability Statement
Data supporting this study are available from the corresponding author upon request.
