Protocol for KAT8 conditional knockout mice generation and its application in 4NQO-induced esophageal tumor model

Summary

4-Nitroquinoline 1-oxide (4NQO), a quinoline derivative, induces tumor formation in mice following a multi-stage pattern analogous to human tumors, mimicking the natural carcinogenesis process. Here, we present a protocol for inducing esophageal squamous cell carcinoma (ESCC) in mice using 4NQO. We detail the acquisition of KAT8 esophagus-specific knockout mice, the establishment of 4NQO-induced ESCC, and the validation of the model via western blotting (WB), hematoxylin and eosin (H&E) staining, and immunohistochemistry (IHC).

For complete details on the use and execution of this protocol, please refer to Zhang et al.¹

Graphical abstract

Highlights

• •Step-by-step guide for breeding of esophageal-specific KAT8 knockout mice
• •Protocol for 4NQO-induced esophagus tumorigenesis in KAT8-specific knockout mice
• •Details to verify model construction via H&E staining and IHC techniques

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

4-Nitroquinoline 1-oxide (4NQO), a quinoline derivative, induces tumor formation in mice following a multi-stage pattern analogous to human tumors, mimicking the natural carcinogenesis process. Here, we present a protocol for inducing esophageal squamous cell carcinoma (ESCC) in mice using 4NQO. We detail the acquisition of KAT8 esophagus-specific knockout mice, the establishment of 4NQO-induced ESCC, and the validation of the model via western blotting (WB), hematoxylin and eosin (H&E) staining, and immunohistochemistry (IHC).

Before you begin

Innovation

Esophageal cancer is one of the most common malignant tumors of the digestive system, encompassing two histological types: esophageal adenocarcinoma and esophageal squamous cell carcinoma (ESCC).^2,3 Owing to the insidious early symptom and the lack of effective therapeutic targets for esophageal cancer to date, the treatment outcomes remain suboptimal, with a very low 5-year survival rate. Although it is known that the prognosis of ESCC largely depends on tumor stage, the molecular mechanisms driving the transformation from normal tissue to chronic inflammation, precancerous lesions, and ultimately invasive cancer remain largely elusive.

This protocol integrates Cre-LoxP-mediated conditional knockout technology with 4NQO-induced chemical carcinogenesis, establishing an esophageal squamous cell carcinoma (ESCC) model with esophagus-specific KAT8 ablation. Compared to conventional models, it achieves tissue-specific gene silencing (validated by WB/IHC), avoiding the interference of gene knockout in other tissues on the experimental results. We adopt the 4NQO administration regimen (100 μg/mL for 16 weeks followed by 12-week tap water) and standardized sample processing, confirming the successful establishment of the model. This integrated workflow faithfully recapitulates human ESCC multistage progression while enabling mechanistic analysis of KAT8, offering a reliable tool for studying tissue-specific gene functions in esophageal carcinogenesis and drug development.

Institutional permissions

All animal experiments were approved by the Ethics Committee of China-US (Henan) Hormel Cancer Institute (CUHCI2021042). The housing and care of mice strictly adhered to Guide for the Care and Use of Laboratory Animals. Mice are housed in a specific pathogen-free (SPF) facility under controlled conditions (22 ± 2°C, 55 ± 10% relative humidity, 12-h light/dark cycle). Sterilized food and filtered water are available ad libitum. Cage bedding is changed twice weekly, and mice are monitored daily for health status. Euthanasia is performed when mice reached experimental endpoints or showed signs of moribundity.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Mouse monoclonal anti-KAT8 (dilution ratio: 1:1000 for WB; 1:100 for IHC)	Santa Cruz	Cat#81163; RRID: AB_1126484
Ki67 (dilution ratio: 1:100)	HUABIO	HA721115
Rabbit monoclonal anti-Acetyl-Histone (Lys16) (dilution ratio: 1:100)	Cell Signaling Technology	Cat#13534; RRID: AB_2687581
Chemicals, peptides, and recombinant proteins
Cas9 protein	New England Biolabs	M0646
PMSG	Ningbo Sansheng Biotechnology Co., Ltd.	N/A
HCG	Ningbo Sansheng Biotechnology Co., Ltd.	N/A
hyaluronidase	Sigma-Aldrich	H4272
M16 medium	Sigma-Aldrich	M7292
1.25% Avertin	TargetMol	C0183
Tolfedine	Vetoquinol	N/A
Pentobarbital sodium	Sigma-Aldrich	P3761
4NQO	Sigma-Aldrich	N8141; Cas:56-57-5
2×Taq Master Mix (Dye Plus)	Vazyme	P222
Agrose	Sigma-Aldrich	A9539
formaldehyde	Sigma-Aldrich	F8775
ethanol	Tianjin ZhiYuan Reagent Co., Ltd	N/A
xylene	Tianjin ZhiYuan Reagent Co., Ltd	N/A
paraplast	Leica	39601006
hematoxylin	BASO	BA4041
1% hydrochloric acid alcohol differentiation solution	BASO	BA4025C
lithium carbonate	Sigma-Aldrich	431559
eosin	BASO	BA4024
neutral balsam	Shanghai Specimen and Model Factory	S3006
citric acid	Sigma-Aldrich	251275
sodium citrate	Sigma-Aldrich	C3674
Tris	VWR	VWRCBRGT497
EDTA.2Na	Solarbio	E8030
NaCl	Sigma-Aldrich	S9888
KCl	Sigma-Aldrich	P5405
KH2PO4	Sigma-Aldrich	P0662
Na2HPO4.12H2O	Sigma-Aldrich	71649
Critical commercial assays
Genomic DNA kit	Tiangen	Cat#DP-304-03
SPlink Detection Kits(anti-rabbit)	Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd	SP-9001
3% H2O2 solution	Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd	SP-9001
goat serum working solution	Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd	SP-9001
biotin-labeled goat anti-rabbit IgG	Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd	SP-9001
horseradish peroxidase-labeled streptavidin working solution	Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd	SP-9001
SPlink Detection Kits(anti-mouse)	Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd	SP-9002
3% H2O2 solution	Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd	SP-9002
goat serum working solution	Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd	SP-9002
biotin-labeled goat anti-mouse IgG	Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd	SP-9002
horseradish peroxidase-labeled streptavidin working solution	Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd	SP-9002
Experimental models: organisms/strains
C57BL/6JCya-KAT8em1flox/Cya: male and female, 4 weeks old	Cyagen Biosciences	S-CKO-13871
C57BL/6J-ED-L2: male, 4 weeks old	GemPharmatech Co.,Ltd	T005634
Software and algorithms
Image J	NIH	N/A
GraphPad Prism v.7	GraphPad	N/A
Other
PCR instrument	Eppendorf	Mastercycler nexus
Microscope	Olympus	BX43
Automatic tissue dehydrator	LEICA	ASP6025
Paraffin embedding machine	LEICA	EG1150 H+C
sliding microtome	LEICA	SM 2010R
Tissue automatic staining machine	LEICA	Autostainer XL
microinjection needles	Sutter	BF100-78-15
fixation needles	Sutter	Sutter B100-75-15
injection dish	Greiner	627160
heating pad	Yuyan instruments	YAN-20350
Embedding cassettes	Citotest	80106-1100-16
Adhesion microscope slides	Citotest	80312-0001

Materials and equipment

0.01 mol/L sodium citrate solution

Reagent	Final concentration	Amount
citric acid	0.21%	2.1g
sodium citrate	0.294%	2.94g
ddH2O	-	900mL
regulate PH=6
Total	-	up to 1L

Storage: 23°C ± 2°C for 1 week maximum.

1mM Tris-EDTA buffer

Reagent	Final concentration	Amount
Tris	0.121%	1.21g
EDTA-2Na	0.037%	0.37g
ddH2O	-	980mL
regulate PH=9.0
Total	-	up to 1L

Storage: 23°C ± 2°C for 1 week maximum.

PBS solution

Reagent	Final concentration	Amount
NaCl	0.8%	8g
KCl	0.02%	0.2g
KH2PO4	0.024%	0.24g
Na2HPO4・12H2O	0.349%	3.49g
ddH2O	-	up to 1L
Total	-	1L

Storage: 23°C ± 2°C for 1 week maximum.

Step-by-step method details

Generation of esophagus-specific KAT8 conditional knockout mice

Timing: ∼10 months

Here, we describe steps for how to generate homozygous esophagus-specific KAT8 conditional knockout mice.

Note: KAT8 heterozygous recombinant mice were purchased from Cyagen Biosciences, with the genotyping strategy illustrated in Figure 1. Following receipt of the founder mice from the company, we initiate mouse breeding starting from step 8. All mice are housed under specific pathogen-free (SPF) conditions, with a 12-h light/dark cycle, a controlled temperature of 22 ± 2°C, and a relative humidity of 55 ± 10%.

• 1.Guide RNA (gRNA) design.

Note: Design the gRNAs via the web-based platform CRISPOR (http://crispor.tefor.net/). The targeting sequences for KAT8 gene knockout are as follows:

Figure 1.

Genotyping strategy for KAT8 conditional knockout mice

The loxP sequences are inserted into the flanks of the key exons of KAT8 gene via the homologous recombination system to generate floxed mice, which are then crossed with Cre mice to achieve the precise knockout of the KAT8 gene in tissues.

gRNA-forward (5′-3′): CTGTGGCCAGCATTACATAGTGG.

gRNA-reverse (5′-3′): GATCGTCCAGTGCTCGGCGTGGG.

• 2.Donor vector construction^4,5
  Perform the construction procedure following the sequential steps.

  • a.
    Amplify fragments using PCR (5′ arm + CKO sequence + 3′ arm).
  • b.
    Ligate the vector backbone and the insert fragment using a DNA ligase.
  • c.
    Transform the ligation product into DH5α competent cells.
  • d.
    Select positive clones.
  • e.
    Prepare plasmid.
• 3.
  sgRNA synthesis.

  • a.
    Mix crRNA and tracrRNA at equimolar concentrations.

    Note: Synthesize crRNA through GenScript company; purchase tracrRNA from Integrated DNA Technologies company.

  • b.
    Prepare the RNP complex on ice according to the reaction system detailed below:

    Reagent	Final concentration	Amount
    sgRNA (50 pmol/ul)	4 pmol/ul	0.4 ul
    Cas9 protein (30 ng/ul)	1.2 ng/ul	0.2 ul
    RNase-free water	-	4.4 ul
    Total	-	5 ul

  • c.
    After thorough mixing, keep the mixture on ice pending injection.
• 4.
  Preparation of zygote.

  • a.
    Select 3-4-weeks-old female C57BL/6J mice.
  • b.
    At 11:00 a.m., administer pregnant mare serum gonadotropin (PMSG) intraperitoneally at a dose of 5 IU per mouse.
  • c.
    After 46-48 h (at 10:00 a.m. on the third day), inject human chorionic gonadotrophin (HCG) intraperitoneally at a dose of 7.5 IU per mouse to induce superovulation.
  • d.
    At 4:00 p.m. on the same day as HCG injection, cage the treated female mice with sexually mature, fertile male mice for mating.
  • e.
    Next day (24 h after HCG injection), humanely euthanize the female mice.

    • i.
      Dissect cumulus-oocyte complexes from the ampulla region of the oviducts and transfer them into the culture medium.
    • ii.
      Add hyaluronidase (at a final concentration of 0.3 mg/mL) to the medium for enzymatic digestion.
    • iii.
      Finally collect the zygotes and put the zygotes in a humidified incubator maintained at 37°C with 5% CO₂.

For detailed operational information, refer to Greaney et al.⁶

• 5.
  Prokaryotic microinjection.

  • a.
    Prepare microinjection needles and fixation needles. Draw the injection needles and holding needles using a needle puller and forge using a needle forge.
  • b.
    Load the prepared mRNA injection solution into the microinjection needle.
  • c.
    Select morphologically intact zygotes with two distinct, large, and clear pronuclei as well as smooth and plump cytoplasm, and transfer them to the injection dish.
  • d.
    Under an inverted microscope at 200–400x magnification, microinject the exogenous gene delivery mixture (RNP complex + constructed plasmid) into the nucleus of the selected zygotes.

    Note: The injection needle has a diameter of 0.78 mm. The injection pressure is 100–200 kpa, and the injection volume is 1–2 pL.

  • e.
    Transfer the injected zygotes to M16 culture medium and incubate them in a humidified 37°C incubator with 5% CO₂ for 0.5–1 h prior to embryo transfer.

    Optional: Alternatively, culture the zygotes to the 2-cell stage and subject them to embryo transfer on the following day.

• 6.
  Pseudopregnant female mice preparation and embryo transfer.

  • a.
    Select fertile female mice of appropriate age and mate them with vasectomized male mice.

    Note: This step is to induce a pseudopregnant state in the female mice.

  • b.
    Weigh the pseudopregnant female mice and then anesthetize them via intraperitoneal injection of 2.5% Avertin (tribromoethanol) at a dose of 0.02 mL/g.

    • i.
      Immediately after induction of anesthesia, administer postoperative analgesia to the mice by subcutaneous injection of carprofen at a dose of 2.5–5 mg/kg.
    • ii.
      On the day a vaginal plug is observed, transfer the KAT8-flox gene-injected zygotes into the oviducts of the pseudopregnant female mice.
  • c.
    After transplantation, place pseudopregnant female mice in a clean cage and using a heating pad to maintain their body temperature until they regain consciousness.
  • d.
    Put the mice back into the cages for routine feeding.
  • e.
    Following successful oviductal transplantation, female mice will give birth 19–20 days after the surgery.
  • f.
    One week after birth, identify the offspring via ear tagging or electronic microchipping (mouse identification methods may vary across the world).
  • g.
    Three weeks after birth, wean the mice (this is the standard weaning period for mice) and house them individually in separate cages for independent feeding.

    Note: All experimental procedures comply with the standards outlined in the Guidelines for Ethical Review of Laboratory Animal Welfare.

• 7.
  Genotyping of founder mice.

  • a.
    Collect tail or toe tissue samples from 1–2-week juvenile mice.
  • b.
    Lyse the tissues and extract genomic DNA.

    Note: Prepare genomic DNA from mouse tail samples strictly following the manufacturer’s instructions for the TIANamp Genomic DNA Kit (TIANGEN Biotech, Lot# DP304, https://www.tiangen.com/content/details_40_21533.html).

  • c.
    Perform PCR amplification and agarose gel electrophoresis to screen out the progeny with successful exogenous gene integration.

    Note: The PCR primers and reaction parameters are identical to those described in Step 8.

    Note: Designate mice with confirmed exogenous gene integration as founder mice, which can be used for subsequent breeding.

• 8.
  Breeding and generation of transgenic mice.

  • a.
    Mate KAT8-flox mice with non-transgenic C57BL/6J mice.
  • b.
    Identify the F1 progeny via genotyping of genomic DNA extracted from mice tail samples.
  • c.
    Use the following primers for PCR amplification:

    PCR primers	5′–3′	Annealing temperature	Expected band size
    Forward primer (F1)	TGTTCTCTCACAGTAAGGAAACGG	62.0°C	Mutanttype:263bp; wildtype:191bp
    Reverse primer (R1)	CTCCTCATACACAAAACCAAGGAT

  • d.
    Perform PCR in a 20μL reaction volume for 35 cycles under standard conditions, with all primers listed above included in each reaction.

    CRITICAL: Incorporate two controls in the PCR genotyping assay: a wildtype control (genomic DNA from wildtype C57BL/6J mice) and a no-template control (sterile water instead of DNA template).

    PCR reaction master mix

    Reagent	Final concentration	Amount
    Mouse tail genomic DNA	2.5∼5 ng/μL	1 μL
    Forward primer (10 μM)	0.5 μM	1 μL
    Reverse primer (10 μM)	0.5 μM	1 μL
    2xTaq Master Mix (Dye Plus)	50%	10 μL
    ddH2O	-	7 μL
    Total	-	20 μL

    PCR cycling conditions

    Steps	Temperature	Time	Cycles
    Initial denaturation	95°C	3 min	1
    Denaturation	95°C	15 sec	35 cycles
    Annealing	62°C	15 sec
    Extension	72°C	30 sec
    Final extension	72°C	5 min	1
    Hold	4°C	Forever

    Note: Adjust the annealing temperature according to the Tm value of the primers, generally setting it at 3 ∼5°C below the Tm value of the primers; For complex templates, it is necessary to optimize the annealing temperature and extension time to achieve efficient amplification.

    Note: Common issues associated with PCR include the following: no amplified band, emergence of non-specific band, band smearing and false positive amplification signals (see troubleshooting, problem 1).

• 9.Generation of KAT8 ^flox/flox homozygous mice.

Inter cross KAT8-flox heterozygous mice to generate KAT8^flox/flox homozygous mice.

Note: The theoretical probability of obtaining homozygous offspring is 25% among the F2 offspring.

Representative PCR genotyping results for KAT8 wild-type, homozygous, and heterozygous mice are presented in Figure 2A.

• 10.Mate KAT8^flox/flox homozygous mice with Ed-l2-Cre transgenic mice.

Note: This step is to generate offspring that are heterozygous for KAT8-flox allele and either hemizygous or heterozygous for the Ed-l2-Cre transgene.⁷

• 11.Genotypic identification of Ed-l2-Cre-positive mice. Use the following primers for genotyping:

PCR primers 2 (Annealing Temperature 56.0°C):

PCR primers	5′–3′	Annealing temperature	Expected band size
Forward primer (F2)	TGAATCCAAATGTGTATTGGCAC	56.0°C	Ed-l2+:300bp; Ed-l2-: no band
Reverse primer (R2)	TTTCAAAACAAGGGGAAAGGAG

Figure 2.

The expression of KAT8 is detected by PCR, WB and IHC

(A) Representative results of PCR genotyping for KAT8 wild-type, homozygous, and heterozygous mice. PCR Primers 1 are used for genotyping. Homozygous: one band with 263bp; Heterozygous: two bands with 263bp and 191bp; WT: one band with 191bp.

(B) Representative results of PCR genotyping for Ed-l2-Cre-positive and Ed-l2-Cre-negative mice. PCR Primers 2 are used for genotyping screening.

(C) KAT8 protein expression levels in various tissues are verified using western blotting.

(D) The expression levels of KAT8 in various tissues are verified using immunohistochemistry (IHC).

(E) The expression levels of KAT8 and H4K16ace in esophageal epithelial tissue are detected by immunohistochemistry (IHC), data represent the statistical results shown in the right panel. Data are presented as mean ± SD. ∗∗∗p < 0.001. Significance is determined using a two-tailed Student’s t test.

Perform PCR in a 20μL volume for 35 cycles under standard conditions, with all the aforementioned primers included in each reaction.

CRITICAL: Incorporate two controls in the PCR genotyping assay: a positive control (genomic DNA from Ed-l2-Cre-positive mouse tails) and a no-template control (sterile water in place of DNA template).

Note: PCR results are susceptible to false positive, so it is essential to select appropriate positive control for each experiment. Ed-l2-Cre transgenic mice cannot be distinguished as homozygous or heterozygous via PCR genotyping, so PCR identification must be performed for each batch of progeny.

Representative PCR genotyping results for Cre-positive and Cre-negative mice are presented in Figure 2B.

• 12.
  Intercross heterozygous, Cre-positive mice to generate homozygous, Cre-positive mice.

  Note: In the offspring, homozygous, Cre-positive mice and homozygous, Cre-negative mice each theoretically account for 12.5% of the total population. The pups can be screened using the identical genotyping assay described above.

  • a.
    After obtaining the homozygous mice, check KAT8 protein levels in esophageal epithelial tissue and control tissues (including kidney, spleen, liver and colon) via western blotting and immunohistochemistry (IHC).

    Note: The ED-L2 promoter is specifically expressed primarily in squamous epithelial cells, with core tissues including oral mucosa, esophagus, and forestomach. Compared with wild-type (WT) mice, no differences are observed in these organs in esophagus-specific KAT8 conditional knockout mice. As shown in Figures 2C–2E, KAT8 is specifically knocked out in esophageal epithelial tissue.

  • b.
    Detect the protein level of H4K16ace in esophageal epithelial tissue from wild-type (WT) and knockout groups using IHC (sample size: 10 mice per group).

    Note: Compared with the control group, the protein levels of both KAT8 and H4K16ace are repressed in esophageal epithelial tissue (Figure 2E).

    Note: C57BL/6J mice typically reach sexual maturity at 6–8 weeks of age. To ensure age-matching between the experimental and control groups, we house maternal male and female mice together only when all individuals reach 8 weeks of age. This practice guarantees the accuracy and reliability of experimental results and minimizes confounding effects of physiological differences induced by age variation among mice.

Use 4NQO to induce esophageal tumors

Timing: ∼10 months

Here, we describe steps for how to induce esophageal tumors in mice using 4NQO.

• 13.Randomly allocate all 8–10-week-old KAT8^flox/flox and Ed-l2^creKAT8^flox/flox mice to the water/4-Nitroquinoline N-oxide (4NQO) group (KAT8^flox/flox+water; KAT8^flox/flox+4NQO; Ed-l2^creKAT8^flox/flox+water; Ed-l2^creKAT8^flox/flox+4NQO; each cohort contains an equal number of male and female mice, Figure 3).

Note: Sample size is determined using Prism Cloud power analysis to compare esophageal cancer incidence between KAT8 conditional knockout and wild-type (WT) mice following 4NQO induction. Based on our preliminary experimental data, a 96% esophageal cancer incidence in 4NQO-treated C57BL/6 WT mice, we hypothesize a 70% tumor incidence in KAT8-CKO mice. For a two-tailed significance level (α) of 0.05 and statistical power (1-β) of 0.8, the power analysis indicates a minimum requirement of 20 mice per group.

• 14.
  Prepare the 4NQO solution following the manufacturer’s protocol.

  • a.
    Dissolve 400 mg of 4NQO in 3.6 mL of dimethyl sulfoxide (DMSO).
  • b.
    Dilute the mixture to a final volume of 4 L with drinking water to yield a working concentration of 100 μg/mL.

Note: Under this regimen, the 4NQO solution is provided ad libitum, each mouse consumes approximately 20–35 mg/kg/day of the 4NQO solution.⁸

4-NQO stability

Reagent purity	≥98%
Stable Storage Temperature	−20°C
Core Physicochemical Parameters	Molecular weight: 190.16; Melting point: 154–156°C
Stable Storage Period	6 months - 1 year
Enzyme Activity Ratio (Zero-concentration Condition)	activity ratio of β-galactosidase to alkaline phosphatase

Figure 3.

Schematic diagram for 4NQO administration

Mice in the control group are given sterilized tap water for 28 weeks. Mice in the 4NQO group are given 100 μg/mL 4NQO for 16 weeks, followed by sterilized tap water for the remaining period.

Note: Store 4NQO in a separate, dedicated cabinet designated for carcinogens, with strict protection from light. When preparing the reagent and replacing the drinking water for mice, appropriate personal protective equipment (including protective gown, safety goggles, nitrile gloves, gas mask and so on) must be worn, and conduct all operations in a fume hood. To ensure complete dissolution of 4NQO, the prepared 4NQO solution can be placed in an ultrasonic water bath to accelerate dissolution (shaking the solution every 10 min until the 4NQO powder dissolves completely).

• 15.Mice in the 4NQO group receive drinking water containing 100 μg/mL 4NQO for 16 consecutive weeks, followed by 12 weeks of sterile tap water administration.⁹ Mice in the H₂O control group are supplied with sterile tap water for the entire experimental period (Figure 3).

Note: Replace drinking bottles weekly, and measure mice body weight once every 2 weeks.

Note: A 16-week exposure to 4NQO solution in mice recapitulates the multi-stage development process of human esophageal squamous cell carcinoma (ESCC); this exposure duration is equivalent to 10–15 years of carcinogen exposure in humans and matches the time course of multistage carcinogenesis.

• 16.
  Euthanize mice at 8–12 weeks after 4NQO treatment, and dissect the mice immediately after sacrifice.⁹

  • a.
    Euthanize mice via intraperitoneal or intravenous injection of an excessive dose of pentobarbital sodium (typically 150–200 mg/kg body weight).
  • b.
    After confirming successful euthanasia, immediately place the mouse in a supine position on a sterile dissection table, then spray 75% alcohol over the entire body surface for disinfection.
  • c.
    Use dissecting scissors to incise the skin and abdominal muscles upward along the midabdominal line, starting from the area below the sternum, to expose the thoracic and abdominal cavities.
  • d.
    Carefully separate thoracic organs (e.g., heart and lungs) while avoiding esophageal damage, then identify the upper esophageal end (connect to the pharynx) and the lower esophageal end (connect to the gastric cardia).
  • e.
    Clamp the upper esophageal end with forceps, gently pull it, and simultaneously use dissecting scissor to cut off the connections between the esophagus and surrounding tissues.

    Note: Take care to avoid blood vessels to minimize bleeding and tissue contamination, thereby completely isolating the esophagus from the pharynx to the gastric cardia.

  • f.
    Promptly transfer the excised esophagus into pre-chilled sterile normal saline.
  • g.
    Gently rinse its surface to remove residual blood and tissue debris, and strip off excess adipose and connective tissues.
  • h.
    Take photos of the isolated mouse esophageal tissues (Figure 4A) and quantify tumor count, tumor volume, tumor incidence and mice survival rate.

    Note: Our results demonstrate that WT mice develop more and larger tumors than KAT8-knock out mice of both sexes after 4NQO treatment; knockout of KAT8 markedly attenuate tumor formation and growth (tumor volume: male, 3.9 ± 0.55 vs. 1.9 ± 0.53 mm³; female, 4.4 ± 0.73 vs. 2.4 ± 0.45 mm³). Notably, this inhibitory effect is more pronounced in male mice than in female mice (Figures 4B–4E).

    CRITICAL: The timing of mice euthanasia is determined on a case-by-case basis (see troubleshooting, problem 2). The standard formula for calculating esophageal tumor volume in mice is as follows: V = (m × n²) / 2, where:

    m: The longest diameter of the tumor (unit: mm);

    n: The shortest diameter of the tumor (unit: mm).

    To enhance the accuracy of measurements, we measure each tumorrepeatedly 2–3 times, calculate the mean values of m and n, and then substitute these values into the formula for volume calculation. We typically use a digital vernier caliper in the laboratory for precise diameter quantification.

    Note: When calculating survival rates, the criteria for censoring events are as follows: Mice are censored if they are euthanized for experimental sampling purposes, died from causes unrelated to esophageal cancer (e.g., accidental injury, infection), or survive until the end of the 24-week observation period without reaching the humane endpoint.

    CRITICAL: Mice are humanely euthanized if they meet any of the following: (1) ≥20% body weight loss for 3 consecutive days; (2) esophageal tumor-induced dysphagia, bleeding, or perforation; (3) tumor volume >1500 mm³ or ulcerated infection; (4) labored breathing, cyanosis, or organ failure; (5) other distress approved by the Institutional Animal Care and Use Committee. All procedures followed institutional ethical guidelines.

    Note: All animal experiments are performed in strict accordance with the regulations of the Animal Ethics Committee and investigators are blinded during endpoint assessment to avoid subjective bias affecting the experimental results.

• 17.Bisect the esophagus longitudinally: store one half at −80°C for subsequent molecular assays, and fix the other half in 4% paraformaldehyde for 24∼48 h for hematoxylin-eosin (HE) staining and immunohistochemistry (IHC).

Note: It is recommended that comprehensive sample information (e.g., mouse ID, sex, and euthanasia time) be clearly labeled during sample processing to avoid misidentification. Ensure that the esophageal tissue is fully stretched prior to fixation in 4% paraformaldehyde (see troubleshooting, problem 3).

Figure 4.

Knockout of KAT8 reduces the incidence of esophageal tumors and prolongs the survival of mice

(A) Representative images of the 4NQO-induced esophageal tumor model.

(B) Average tumor counts in female and male groups post-4NQO induction.

(C) Average volume of tumors in female and male groups after 4NQO induction.

(D) The tumor incidence rate in each group.

(E) The survival analysis of each group, statistical significance is determined using the Log-rank test. Graphpad Prism v.7 is used for graph generation.

Data represent mean ± SD. ∗p < 0.05. Significance is determined using a two-tailed Student’s t test.

Tissue dehydration

Timing: ∼1 day

Here, we describe steps for tissue dehydration. Thoroughly removing moisture from tissues provides structural support for subsequent paraffin embedding and sectioning, while preserving tissue morphology and antigen integrity. Tissue dehydration is a critical prerequisite step for preparing paraffin sections. We perform dehydration by using the LEICA ASP6025 automatic tissue dehydrator.

The procedure is as follows (steps 18–27):

• 18.rinse the tissues under running water for 2 h.
• 19.Immerse the tissues in 75% ethanol for 20 min.
• 20.Immerse the tissues in 85% ethanol for 20 min.
• 21.Immerse the tissues in 95% ethanol for 20 min.
• 22.Immerse the tissues in 100% ethanol for 40 min.
• 23.Immerse the tissues in 100% ethanol for 40 min.
• 24.Immerse the tissues in xylene for 30 min.
• 25.Immerse the tissues in xylene for 30 min.
• 26.Immerse the tissues in molten paraffin at 65°C for 30 min.
• 27.Immerse the tissues in molten paraffin at 65°C for 30 min.

Paraffin-embedded tissues

Timing: ∼2 h

Here, we describe steps of paraffin embedding, which aims to provide structural support for tissue samples, enable long-term preservation, and lay a high-quality foundation for subsequent sectioning, staining, and molecular detection.

Perform this procedure using a paraffin embedding machine (LEICA EG 1150 H+C).

• 28.Prepare an embedding cassette and pour a small volume of molten paraffin into the cassette to form a bottom layer.
• 29.Use sterile forceps to place the paraffin-imbibed tissue into the embedding cassette and adjust the tissue to the desired orientation.
• 30.Fill the embedding cassette with molten paraffin, transfer it onto an ice tray for cooling, and allow the paraffin to solidify rapidly.
• 31.Trim the excess paraffin surrounding the embedding cassette to yield a well-shaped paraffin block.

Tissue sectioning

Timing: ∼2 h

Here, we describe steps to cut bulk tissue into thin, intact sections, preparing them for subsequent HE and IHC staining.

• 32.Cut the paraffin-embedded tissue into 3 μm sections using a LEICA SM 2010R sliding microtome.
• 33.Gently lift the cut paraffin ribbon with a fine brush and float it on the surface of a 42°C water bath to allow the ribbon to flatten completely.
• 34.Retrieve the flattened section using an adhesion microscope slide (Citotest), center the tissue sample precisely on the slide, and air-dry the slide at 23 ± 2°C for more than 20 h.

Note: To obtain intact tissue sections, the following prerequisites should be met before sectioning: Select an appropriate blade type and verify that the blade is sharp and free of chips or nicks; Ensure the paraffin-embedded tissue block is sufficiently frozen to achieve a moderate hardness and contains no air bubbles; Confirm that the tissue is embedded in a perfectly flat orientation within the paraffin block.

H&E staining of tissue sections

Timing: ∼2 h

Here, we describe steps for HE staining, which specifically stains cell nuclei and cytoplasm to clearly visualize cellular morphology, tissue structure, and pathological changes, thereby providing intuitive morphological evidence for disease diagnosis and research.

Perform this protocol using a LEICA Autostainer XL. Alternatively, we can complete these steps manually by placing the reagents in sealable lidded containers and carrying out the operations in a fume hood.

The procedure is as follows:

• 35.Bake the slides at 65°C for 2 h to enhance tissue adherence to the slides.
• 36.Soak the tissue sections in xylene for 5 min to deparaffinize.
• 37.Repeat Step 36.
• 38.Soak the tissue sections in 100% ethanol for 1 min to initiate rehydration.
• 39.Repeat Step 38.
• 40.Soak the tissue sections in 95% ethanol for 1 min.
• 41.Soak the tissue sections in 75% ethanol for 1 min.
• 42.Soak the tissue sections in distilled water for 1 min.
• 43.Immerse the rehydrated sections in hematoxylin staining solution and incubate for 5 min.
• 44.Rinse the tissue sections with tap water for 1 min to remove residual hematoxylin staining solution.
• 45.Immerse the tissue sections in 1% hydrochloric acid-ethanol differentiation solution for 3 s to achieve appropriate nuclear staining intensity.
• 46.Rinse the tissue sections with tap water for 1 min to terminate differentiation.
• 47.Soak the tissue sections in saturated lithium carbonate solution for 40 s.
• 48.Rinse the tissue sections with tap water for 1 min.
• 49.Soak the tissue sections in eosin staining solution for 40 s to stain cytoplasmic components.
• 50.Soak the tissue sections in 95% ethanol for 10 s.
• 51.Repeat Step 50.
• 52.Soak the tissue sections in 100% ethanol for 1 min.
• 53.Repeat Step 52.
• 54.Soak the tissue sections in xylene for 1 min.
• 55.Repeat Step 54.
• 56.Mount the sections with neutral balsam and cover with coverslips for microscopic observation.

Representative images of the esophagus are presented in Figure 5.

Figure 5.

Detect the expression level of Ki67

Esophageal tissues from all groups are harvested and subjected to hematoxylin and eosin (H&E) staining and immunohistochemistry (IHC), representative images are shown in the figures (100x; Scale bar: 50 μm). Data represent mean ± SD. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. Significance is determined using a two-tailed Student’s t test.

IHC staining of tissue sections

Timing: ∼2 days

Here, we describe steps for IHC, which enables precise localization and quantitative analysis of target protein expression in tissues or cells through antigen-antibody specific binding reactions.

Typically, the IHC technique is used to detect Ki67, the target protein and its downstream proteins in esophageal tissue.

For IHC staining, we adopt the SPlink Detection Kits (Biotin-Streptavidin HRP Detection Systems, Beijing Zhongshan Golden Bridge Biotechnology Co. Ltd, SP-9001 or SP-9002).

Note: Drying of the slices is likely to lead to false positive results (see troubleshooting, problem 4).

Finish deparaffinization and hydration using a LEICA Autostainer XL. The procedure is as follows:

• 57.Bake tissue sections at 65°C for 2 h to enhance tissue adherence to the slides.
• 58.Soak the tissue sections in xylene for 7 min.
• 59.Repeat Step 58.
• 60.Soak the tissue sections in 100% ethanol for 5 min.
• 61.Repeat Step 60.
• 62.Soak the tissue sections in 95% ethanol for 3 min.
• 63.Repeat Step 62.
• 64.Soak the tissue sections in 75% ethanol for 3 min.
• 65.Soak the tissue sections in distilled water for 20 min.
• 66.
  Antigen retrieval.

  • a.
    Pour 0.01 mol/L sodium citrate solution (pH 6.0) into a pressure cooker.

    Note: Ensure the buffer submerges the specimens completely.

  • b.
    Place the pressure cooker on an induction cooker.
  • c.
    After boiling for 90 s, flush it with tap water until it cools down.
  • d.
    Take out the specimens.

Optional: For antigens with severe masking caused by prolonged fixation time (e.g., more than 48 h), severe tissue fibrosis, or complex antigen epitope structures (e.g., certain nuclear antigens, transmembrane proteins), alkaline antigen retrieval solutions (1mM Tris-EDTA buffer, pH 9.0) are recommended.

Note: Different antibodies require different antigen retrieval solutions. When you select a retrieval solution, you can refer to the antibody instruction manual, which usually recommends suitable antigen retrieval methods and retrieval solutions. If no relevant instructions are available, you can perform preliminary experiments to compare the staining effects after treatment with different retrieval solutions. Then you should select the solution that enables optimal antibody-antigen binding - that is, the one yielding high signal intensity with minimal background noise.

• 67.Rinse the tissue sections with distilled water for 5 min.
• 68.Wipe off excess water around the tissue sections with filter paper.
• 69.Add 3% H₂O₂ solution dropwise and incubate the samples at 23 ± 2°C for 5 min under light-protected conditions.
• 70.Rinse the samples with distilled water for 5 min.
• 71.Rinse the samples with PBS buffer for 5 min.
• 72.Wipe off excess water around the tissue sections with filter paper.
• 73.Add the goat serum working solution dropwise at a volume of 20μl per sample and incubate the samples at 23 ± 2°C for 1 hour.
• 74.Pour off the residual liquid, and proceed without washing.
• 75.Dilute the primary antibody to the appropriate concentration with PBS solution.
• 76.Add the diluted antibody dropwise to fully cover the sample surface.
• 77.Place the samples in a humidified chamber, protect them from light, and incubate them at 4°C in a refrigerator for 16–18 h.

Note: Determining the optimal primary antibody concentration for immunohistochemical assays requires consideration multiple factors (see troubleshooting, problem 5).

• 78.On the following day, retrieve the humidified chamber and rinse sample twice with PBS buffer, 5 min each time.
• 79.Wipe off excess water around the tissue sections with filter paper.
• 80.Add the biotin-labeled goat anti-rabbit/mouse IgG working solution dropwise and incubate at 23 ± 2°C for 30 min.
• 81.Rinse the samples twice with PBS buffer, 5 min each time.
• 82.Wipe off excess water around the tissue sections with filter paper.
• 83.Add the horseradish peroxidase-labeled streptavidin working solution dropwise, and incubate the samples at 23 ± 2°C for 30 min.
• 84.Rinse the samples twice with PBS buffer, 5 min each time.
• 85.Wipe off excess water around the samples with filter paper.
• 86.Add freshly prepared DAB working solution dropwise to cover the sample surfaces.
• 87.Monitor the color development under a microscope; once the desired staining intensity is achieved, transfer the samples to distilled water to terminate the chromogenic reaction.

Counterstain is finished on LEICA Autostainer XL. The procedure is as follows:

• 88.Soak the tissue sections in hematoxylin solution for 1.5 min.
• 89.Rinse the tissue sections thoroughly under running tap water for 1 min.
• 90.Soak the tissue sections in 1% hydrochloric acid-ethanol differentiation solution for 10 s.
• 91.Soak the tissue sections in saturated lithium carbonate for 30 s.
• 92.Soak the tissue sections in 95% ethanol for 2 min.
• 93.Repeat Step 92.
• 94.Soak the tissue sections in 100% ethanol for 2 min.
• 95.Repeat Step 94.
• 96.Soak the tissue sections in xylene for 3 min.
• 97.Repeat Step 96.
• 98.Mount the tissue sections with neutral balsam.
• 99.Air-dry the mounted sections in a fume hood for 24 h.
• 100.Take photos of the stained sections using a microscope and calculate the positive staining rate with Image-Pro Plus software (version 6.0).

Expected outcomes

The expected results of the 4NQO-induced esophageal tumorigenesis experiment in gene knockout mice depend on the specific gene targeted for knockout. This study anticipates the following outcomes: (1) Under 4NQO induction, control group mice exhibit significantly higher esophageal tumor number, volume, and weight than experimental group mice (tumor count: male, 2.6 ± 0.24 vs. 1.2 ± 0.29, female, 2.8 ± 0.33 vs. 1.6 ± 0.27; tumor volume: male, 3.9 ± 0.55 vs. 1.9 ± 0.53 mm³; female, 4.4 ± 0.73 vs. 2.4 ± 0.45 mm³). Notably, these differences are more pronounced in male mice than in female mice. (2) Control group mice show a higher proportion of high-grade intraepithelial neoplasia and invasive squamous cell carcinoma in esophageal lesions compared with experimental group mice. These pathological changes are characterized by increased cellular atypia and basement membrane destruction. (3) Control group mice display higher expression of proliferation markers such as Ki-67 in tumor tissues compared with experimental group mice.

Limitations

Although 4NQO-induced mice tumorigenesis recapitulates the multistage development mode of human tumors and effectively simulates the natural carcinogenic process-thus serving as an irreplaceable model for investigating the roles of specific genes in esophageal cancer initiation and progression-it has three major limitations: 1) Prolonged experimental timeline. The entire modeling process is time-consuming, typically exceeding 2 years. The duration required to establish a 4NQO-induced esophageal squamous cell carcinoma (ESCC) mouse model can be shortened via the following strategies: a. Co-administration of 4NQO with 10% ethanol to accelerate tumor progression; b. Selection of highly susceptible mouse strains and strict control of the mice’s initial age at the start of treatment; c. Optimization of 4NQO dosing concentrations and administration regimens. 2) Incomplete recapitulation of human disease etiology. 4NQO exerts its carcinogenic effects primarily via chemical DNA damage, which fails to fully mimic the multifactorial pathogenesis of human esophageal cancer (e.g., smoking, alcohol consumption, and HPV infection). 3) Potential functional compensation of target genes. Esophageal epithelial cells may compensate for the loss of target gene function through homologous genes or alternative bypass signaling pathways.

Troubleshooting

Problem 1

Common issues encountered in PCR include the absence of amplified bands, presence of non-specific bands, false positive, etc. The underlying causes of these problems are as follows: template-related issues, enzyme inactivation, primer issues, inappropriate cycling conditions, cross-contamination of template DNA and cross-contamination of amplification products.

Potential solution

• •Ensure the purity and quality of the template DNA.
• •Maintain the activity of Taq DNA polymerase: Store the enzyme at −20°C, transport it on ice during use, and return it to the refrigerator immediately after use.
• •Ensure the quality of primers.
• •Determine an appropriate annealing temperature, which is generally set 3 ∼5°C lower than the Tm value of the primers.

Problem 2

Determining the optimal timing for euthanizing mice is challenging, as it varies based on experimental purposes and the characteristics of the mouse strain.

Potential solution

At the initiation of the experiment, prepare adequate number of additional mice to both the experimental group and the control group for the 4NQO-induced esophageal tumorigenesis assay. Beginning at week 24 post-treatment, euthanize 2 mice from each group every two weeks to examine esophageal tumorigenesis, thereby identifying the optimal euthanasia time point. If mice exhibit a marked increase in esophageal tumor burden, we may terminate the experiment prematurely. Notably, male mice are more sensitive to 4NQO, with tumors tending to emerge earlier and progress more rapidly. Therefore, we initiate preliminary monitoring as early as week 22 (via euthanasia of 2 mice per group). Following euthanasia, we prepare pathological sections, collect fresh esophageal tissue samples, and store the samples at −80°C. These samples facilitate subsequent detection of tumor-related biomarkers (e.g., Ki-67 proliferation index, p53 mutation status), which helps validate the molecular underpinnings of the identified optimal euthanasia time point. Additionally, if mice present overt cachexia (e.g., >20% body weight loss), dysphagia, or distant tumor metastasis, we promptly euthanize the animals and terminate the experiment accordingly.

Problem 3

Esophageal tissue tends to curl when directly placed into 4% formaldehyde. This curling makes it difficult to maintain the tissue in a flat orientation during embedding.

Potential solution

Adhere the esophageal tissue flat onto a rectangular filter paper slightly larger than the tissue itself, then immerse the filter paper with the attached esophageal tissue in 4% formaldehyde solution.

Problem 4

Drying of the tissue sections is prone to lead to false-positive results.

Potential solution

When incubating reagents or primary antibodies, perform the procedure in a light-tight chamber, and add a small volume of water to the chamber to maintain a humidified environment.

Problem 5

In immunohistochemistry assays, excessive high primary antibody concentration increases the likelihood of non-specific binding to tissue epitopes, resulting in heightened background staining that interferes with the visualization and interpretation of target antigen-positive signals. Conversely, an insufficient primary antibody concentration compromises full binding to the target antigen, leading to attenuated signal intensity and potentially even complete signal loss, which culminates in false-negative results.

Potential solution

Antibody product manuals typically provide a recommended initial concentration range. For preliminary optimization assays, gradient dilution experiments are routinely performed, in which a series of primary antibody dilutions (e.g., 1:50, 1:100, 1:200, 1:400, 1:500, 1:1000) are prepared. Tissue sections are then processed under identical experimental conditions, followed by microscopic evaluation of the staining outcomes. The optimal working concentration is defined as the dilution yielding the strongest specific staining, minimal background interference, and clear target signals. In addition, published studies employing the same or homologous primary antibodies can be consulted to obtain the concentrations validated in analogous experimental settings, which serve as a valuable reference for optimizing one’s own assay conditions.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Zigang Dong (dongzg@zzu.edu.cn).

Technical contact

Requests for further information should be directed to and will be fulfilled by the lead contact and first author, Zigang Dong (dongzg@zzu.edu.cn) and Dandan Zhang (ddzhang@hci-cn.org).

Materials availability

This paper did not generate any new reagents. All materials used can be purchased from the manufacturers.

Data and code availability

This paper did not generate any new datasets or code.

Acknowledgments

This study was supported by the general grant from China-US (Henan) Hormel Cancer Institute, the National Natural Science Foundation of China (no. 82073075), the Science and Technology Project of Henan Province (no. 221100310100), and Project of Science and Technology of the Henan Province for Tackling Key Problems (no. 222102310158).

Author contributions

Z.D. and K.L. led the project. D.Z. and M.J. optimized the protocol and performed the experiments. D.Z. performed analysis used in the generation of figures. D.Z. wrote the manuscript. All authors are involved in the review of this manuscript.

Declaration of interests

The authors declare no competing interests.