Foot-and-mouth disease virus VP4 interferes with host interferon response by targeting the nuclear translocation of interferon regulatory factor 3 (IRF3)

Abstract

Upon RNA virus infection, nuclear translocation of activated transcriptional factors via the RNA-sensing signal pathway is a key event in the interferon (IFN)-mediated antiviral response, and a specific target of viral immune evasion. Foot-and-mouth disease virus (FMDV) causes an acute vesicular disease in cloven-hoofed animals and poses a serious economic risk to the dairy industry. FMDV VP4, one of the structural proteins, is an internal protein of the viral capsid and is known to play an important role in cell entry. Here, we demonstrate a novel molecular mechanism by which VP4 inhibits karyopherin (KPNA)-mediated antiviral immune responses. VP4 and IRF3 specifically interacted with the nuclear localization signal (NLS) binding site on the KPNA4 molecule, and VP4 inhibited the interaction between KPNA4 and IRF3 via competitive binding with higher affinity. Thus, VP4 inhibited nuclear translocation of IRF3 without affecting dimerization and phosphorylation of IRF3. Consequently, VP4 significantly enhanced the replication of RNA and DNA viruses by suppressing IFN production through inhibition of the IRF3-mediated type I IFN signaling pathway. Taken together, these results suggest that VP4 negatively regulates host type I IFN signaling by inhibiting the nuclear translocation of IRF3 and provide a critical implication for better understanding the pathogenesis of FMDV.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13567-026-01712-2.

Introduction

The innate immune system of the host is the first line of defense against viral infections. Interferons (IFNs) are a major component of innate immunity and the earliest mediators of the innate immune response against viral infection [1]. Upon infection, viral RNA is recognized by cellular cytosolic pattern recognition receptors (PRRs) such as retinoic acid-inducible gene I (RIG-I) and melanoma differentiation-associated gene 5 (MDA5) [2, 3]. TRIM38 was identified to act as a SUMO E3 ligase for stabilizing RIG-I and MDA5 [4]. Activated RIG-I, or viral RNA-bound MDA5, interacts with the downstream mitochondrial antiviral signaling protein (MAVS) [5]. Ultimately, this facilitates activation of IFN-regulatory factor 3 (IRF3) through C-terminal phosphorylation and dimerization, allowing translocation from the cytoplasm to the nucleus [6]. In this context, DYRK4 acts as a scaffold protein that recruits TRIM71 and LUBAC to IRF3, thereby increasing its linear ubiquitination and ensuring IRF3 stability and sustained activation during viral infection [7]. Protein translocation between the nuclear and cytoplasmic compartments relies on recognition by soluble receptors that regulate movement through the nuclear pore complex. Shuttling receptors identify specific amino acid sequences known as nuclear localization signals (NLS) in proteins that are targeted for nuclear translocation [8, 9]. Accordingly, activated IRF3 is recruited by a shuttling receptor, karyopherin (KPNA), and translocates to the nuclear compartment [10–14]. Since the type I IFN response is a powerful and immediate host antiviral response [15], many viruses have developed mechanisms to respond to this response [16–19]; interfering with or inhibiting the secretion of IFN, disrupting IFN-mediated signaling pathways, and impeding the activity of IFN-stimulated genes (ISGs).

Foot-and-mouth disease (FMD), which affects both domestic and wild ungulates, is one of the most ruinous diseases affecting the global dairy industry, and has a huge economic impact [20–24]. Foot-and-mouth disease virus (FMDV) is widespread across extensive regions of Africa and Asia, exacerbating poverty and malnutrition in agrestic communities and restricting trade opportunities [25–27].

FMDV is the etiological agent responsible for FMD. FMDV belongs to the genus Aphthovirus within the family Picornaviridae [28]. FMDV is a single-stranded, positive-sense RNA virus with a genome of 8.5 kb that encodes a single polyprotein within an icosahedral capsid. The polyprotein comprises four structural proteins (VP1 to VP4; VP4 comprises the terminal 85 amino acid residues of VP0) and ten nonstructural proteins (L protein, 2A, 2B, 2C, 3A, 3B1–3, 3C, and 3D). Assembly of the viral capsid involves progressive formation of the four structural proteins. Initially, proteins VP0, VP3, and VP1 are folded to form a protomer comprising one copy of each protein. This protomer is then repeated five times to form a pentamer. The final viral capsid is an oligomeric protein shell composed of 12 pentamers, resulting in an icosahedral capsid structure comprising 60 copies of each structural protein [29]. During FMDV replication, VP0 is cleaved to generate two viral capsid proteins: VP2 and VP4 [30]. A genetically engineered FMDV, which cannot undergo the maturation cleavage of VP0 to yield VP2 and VP4, is noninfectious and acid-sensitive [31]. VP1, VP2, and VP3 are surface-exposed and form the outer layer of the viral capsid [32]. By contrast, VP4 is an internal protein [30]. However, because VP4 is small and hydrophobic, it is temporarily exposed on the capsid surface in a process known as “capsid breathing.” This process plays an important role in cell entry [33–37]. VP4 has a myristic acid moiety at its N-terminus, a standard feature of all VP4 proteins in the Picornaviridae family [33]. The length of the VP4 protein varies among members of the Picornaviridae family, but FMDV has the longest VP4 protein at 85 residues. To date, the known antiviral function of VP4 is that it induces lysosomal-mediated degradation of nucleoside diphosphate kinase 1 (NME1), thereby impairing the expression of p53-regulated IFN-inducible antiviral genes [38].

In this study, we identify a previously uncharacterized role of VP4 in modulating the type I IFN signaling pathway. Our findings suggest that VP4 competitively interacts with KPNA molecules and is, hence, associated with cytoplasmic retention of IRF3, which may contribute to attenuation of the type I IFN response during viral infection.

Materials and methods

Cell lines and antibodies

HEK293T (ATCC^® CRL1126™), PK15 (ATCC^® CCL-3™), HeLa (ATCC^® CCL-2™), LFBK (RRID: CVCL_RX26), and Vero (ATCC^® CCL-81) cells were cultured using Dulbecco’s Modified Eagle’s Medium (DMEM; Hyclone) supplemented with 10% fetal bovine serum (FBS; Gibco) and 1% antibiotic/antimycotic solution (AA) (Gibco). 3D4/21 (ATCC^® CRL2843™) cells were cultured using Roswell Park Memorial Institute (RPMI-1640; Hyclone) medium supplemented with 10% FBS and 1% AA. Subsequently, cells were incubated in a humidified 5% CO₂ incubator at 37 °C. The antibodies utilized in the study were as follows: Flag (M2) (8146) was purchased from Sigma. Strep (34850) was purchased from Qiagen. The antibodies GST (sc-138), KPNA2 (sc-55538), KPNA4 (sc-390535), β-actin (sc-47778), and α-tubulin (sc-8035) were purchased from Santa Cruz Biotechnology. In addition, the following antibodies were purchased from Cell Signaling: IRF3 (4302S), phospho-IRF3 (4947), TBK1(3504S), phospho-TBK1 (5483S), STAT1 (9175), phospho-STAT1 (9167), p65 (4764S), phospho-p65 (3031S), IκBα (9242S), phospho-IκBα (2859S), and lamin B1 (12586). V5 (A190-220A) was purchased from Thermo Fisher Scientific. For the confocal microscopy, Cy3-conjugated donkey-mouse IgG (715-165-150) was purchased from The Jackson Laboratory, Bar Harbor, ME, USA, and Alexa 488 goat-rabbit IgG (A11034) was purchased from Invivogen.

Plasmids, plasmid transfection, and chemicals

To construct the FMDV VP4 of the O1/Manisa/Turkey/69 strain, gene-specific PCR primers were used. The PCR product was cloned into Flag-pIRES, Strep-pEXPR, and GST-pEBG vectors. Similarly, IRF3 was amplified from template DNA using gene-specific PCR primers and cloned into Flag-pIRES, Strep-pEXPR, or GST-pEBG vectors. IRF3 domains were subcloned into the GST-pEBG vector. The mutation cloning kit (Thermo Fisher, 00940669) generated the IRF3 point-mutated sequences. KPNA1-4 and KPNA6 templates were purchased from the Korean Human Gene Bank (KPNA1-hMU00566, KPNA2-hMU00978, KPNA3-hMU003242, KPNA4-hMU002270, and KPNA6-hMU001700), and the KPNA5 template was purchased from Addgene (26681). Gene-specific PCR primers were used to amplify the template, which was then cloned into the Flag-pIRES vector. KPNA4 and its truncated forms were amplified and ligated into the GST-pEBG vector. As described in [39], interferon-β (IFN-β) promoter plasmids and luciferase reporter plasmids were constructed. RIG-I, RIG-I (2CARD), MAVS, TRIF, TBK1, IKKƐ, and IRF3 were cloned into the Flag-pIRES vector by amplifying template DNA with gene-specific PCR primers. A range of commercially available reagents and supplies were obtained to support our experimental procedures, including trypsin–EDTA (Gibco-25300-054), Normocin-Antimicrobial Reagent (InvivoGen-NOL-45–03), puromycin (InvivoGen-A11138-03), Protein A/G PLUS-agarose (Santa Cruz Biotechnology; sc-2003), Sepharose 6B (GE Healthcare; 17011001), Glutathione-conjugated Sepharose 4B beads (Cytiva), and Strep-Tactin Sepharose resin (IBA Lifesciences; 2-1201-002). Polyinosinic:polycytidylic acid (poly I:C) (Sigma-Aldrich, St. Louis, MO, USA) was utilized for transfection at 10 μg/mL, employing Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Furthermore, plasmids were transfected into 3D4/21, PK15, and LFBK cells using Lipofectamine 2000 (Invitrogen), whereas HEK293T cells were transfected with polyethyleneimine (PEI; Polysciences Inc., 23966).

Stable cell line preparation

For the preparation of a VP4 stably expressing cell line, the Flag-VP4 plasmid was transfected with Lipofectamine 2000 into 3D4/21 cells, followed by overnight incubation (reaching 60% cell confluency). Then, 2.0 μg/mL of puromycin (InvivoGen, A11138-03) was used to select the positive colonies. Flag-VP4 expression was verified by immunoblotting.

Virus infection and titration

GFP-expressing recombinant H1N1 influenza A virus (A/PR8/8/34; PR8-GFP), vesicular stomatitis virus (VSV), and herpes simplex virus (HSV), along with non-GFP-expressing sendai virus (Cantell strain; SeV), were used for the experiments. PR8-GFP and non-GFP-expressing SeV were replicated using specific pathogen-free (SPF) embryonated chicken eggs, and GFP-expressing VSV and HSV were replicated in Vero cells. For viral infection, DMEM or RPMI-1640 medium enriched with (1%) FBS was used at the indicated multiplicity of infection (MOI). After 2 h of infection, the culture medium was replenished with DMEM or RPMI-1640 enriched with 10% FBS. At the indicated time-course sampling points, cells and supernatant were separately collected via centrifugation at 2340 × g (5000 rpm) for 3 min. The supernatant was used for enzyme-linked immunosorbent assays (ELISAs), and the cell pellet was reconstituted in phosphate-buffered saline (PBS) to assess the fluorescence level using a fluorometer (GloMax multi-detection system, Promega). A plaque-forming assay was conducted to calculate the virus titers. Overnight-incubated Vero cells seeded to a 12-well cell culture plate were exposed to serially diluted reconstituted cell pellet in a medium containing 1% FBS for 2 h. Infected medium was replaced with (0.1%) agarose (Sigma-Aldrich) containing DMEM, and incubation was continued for 36 h. The plaques were observed under a microscope at 200× magnification. Dilution factor and plaque-forming units (PFU) were taken into consideration in calculating the virus titer.

ELISA

Secreted proinflammatory cytokines and IFNs were quantified using commercialized ELISA kits as per the manufacturer’s guidelines. Human IFN-β (CUSABIO, CSB-E09889h), human interleukin 6 (IL-6) (BD Biosciences, 555220), porcine IFN-β (CUSABIO, CSB-E09890p), and porcine IL-6 (R&D Systems, P6000B) were used in the study.

Quantitative real-time PCR (qRT-PCR)

Control vector or Flag-VP4 transfected HEK293T or PK15 cells and stably expressing 3D4/21 cells were seeded in 12-well plates, followed by stimulation with virus infection. Samples were collected at the defined time points. Cellular RNA isolation was done using RNeasy Mini Kit (Qiagen). Following isolation, complementary DNA (cDNA) was generated via a reverse transcriptase kit (Toyobo). The resulting cDNA was quantified through qRT-PCR employing a SYBR^® green qPCR master mix (Toyobo), as per manufacturer’s guidelines. The qRT-PCR was carried out on a Rotor-Gene Q instrument (Qiagen). Analysis of quantitative mRNA expression was performed via the 2^−∆∆Ct method, with β-actin or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serving as an internal control. The oligonucleotide sequences utilized in the study are provided in Table 1.

Table 1.

PCR primers used in the real-time PCR (Bioneer, Daejeon, Republic of Korea)

Target gene	Forward primer	Reverse primer
pIFN-β	AAATCGCTCTCTGATGTGT	TGCTCCTTTGTTGGTATCG
pIFN-γ	CCATTCAAAGGAGCATGGAT	ATCCATGCTCCTTTGAATGG
pIL-6	CACCGGTCTTGTGGAGTTTC	GTGGTGGCTTTGTCTGGATT
pIL-1β	GGGACTTGAAGAGAGAAGTGG	CTTTCCCTTGATCCCTAAGGT
pTNF-α	TCACAGGGCAATGATCCC	GGGATCATTGCCCTGTGA
pMCP1	CAGAAGAGTCACCAGCAGCA	TCCAGGTGGCTTATGGAGTC
pMX1	TAGGCAATCAGCCATACG	GTTGATGGTCTCCTGCTTAC
pISG-15	AAATCGCTCTCCTGATGTGT	TGCTCCTTTGTTGGTATCG
pIFN-α	GCCTCCTGCACCAGTTCTACA	TGCATGACACAGGCTTCCA
pGBP1	GAAGGGTGACAACCAGAACGAC	AGGTTCCGACTTTGCCCTGATT
pIFIT1	CTGACTCACAGCAACCATG	CTTTCAGGTGTTTCACATAGG
pOASL	TCCCTGGGAAGAATGTGCAG	CCCTGGCAAGAGCATAGTGT
hIFN-β	CATCAACTATAAGCAGCTCCA	TTCAAGTGGAGAGCAGTTGAG
hIL-6	CCACACAGACAGCCACTCACC	CTACATTTGCCGAAGAGCCCTC
hTNF-α	ATGAGCACTGAAAGCAT	TCGACGGGGAGTCGAACT
hMX1	ATTTCGGATGCTTCAGAGGTAGA	CCCGGCGATGGCATT
hISG-15	TCCTGGTGAGGAATAACAAGGG	GTCAGCCAGAACAGGTCGTC
hGBP1	CCAGTTGCTGAAAGAGCAAGAGA	TCCCTCTTTTAGTAGTTGCTCCTGTT
VP4	CAATCAGGCAACACTGGGAGCATCATC	GGTGGGGGTTGTGTCCGTGGACCC

Luciferase assays

HEK293T cells were cultured in a 12-well cell culture plate and stored at 37 °C for incubation. After 12 h incubation, cells were transfected concurrently with thymidine kinase (TK)-Renilla and IFN-β promoter luciferase reporter plasmids, along with Flag-VP4 plasmid, dose-dependently. To stimulate the IFN-β promoter, plasmids encoding IFN pathway molecules RIG-I, RIG-I (2CARD), MAVS, TRIF, TBK1, IKKƐ, IRF3, and constitutively active form of IRF3 (IRF3-5D) plasmids were transfected using PEI. After 24 h of transfection, samples were collected and lysed for 15 min in (1×) passive lysis buffer (Promega, E194A), and luciferase reporter activity was measured via the dual-luciferase reporter assay system (Promega, E1980). Results were quantified compared with Renilla luciferase expressed independently (internal control).

Immunoprecipitation

Transfected cells were collected at 36 h and lysed using protease and phosphatase (Sigma) inhibitor cocktails containing radio-immunoprecipitation assay (RIPA) lysis buffer (50 mM Tris–HCl, 1 mM NaF, 150 mM NaCl, 1% IGEPAL, and 0.5% sodium deoxycholate). For further lysis of the samples, sonication (30% amplitude, 10 s, three cycles) was performed on 500 μL of lysate using a sonicator (Sonics), followed by centrifugation at 12 000 rpm at 4 °C for 10 min. Subsequently, whole-cell lysates (WCL) were separated by centrifugation, mixed 1:1 with sample loading buffer (Sigma-Aldrich, S3401), and boiled for 10 min. The remaining lysates were subjected to pre-clearing using Sepharose 6B. Then, pre-cleared lysates were incubated under continuous agitation with the target antibody, Strep-Tactin Sepharose, or glutathione-conjugated Sepharose 4B beads overnight at 4 ℃. Antibody-incubated lysates were further treated with Protein A/G PLUS-Agarose beads for 4 h under agitation. Immunoprecipitated beads were subjected to washing using NP40 lysis buffer under varying experimental conditions and mixed with sample loading buffer (Sigma) and subjected to boiling for 10 min for sample preparation. Precipitated proteins were separated via sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE), followed by immunoblotting using the relevant antibody.

Immunoblot analysis

Proteins resolved by SDS–PAGE, with the acrylamide percentage adjusted according to the molecular weight of the target proteins (6, 8, 10, 12, and 15%), were subsequently transferred onto a polyvinylidene fluoride (PVDF) membrane (Bio-Rad) utilizing a Trans-Blot SD semi-dry transfer cell machine (Bio-Rad). Upon transfer, the membrane was blocked in (5%) bovine serum albumin (BSA) for 1 h, after which it was incubated overnight at 4 ℃ with relevant primary antibodies prepared in 5% BSA. The following day, PVDF membranes were washed with Tris-buffered saline (TBS) supplemented with (0.05%) Tween 20 (TBS-T) and were then incubated for 1 h with horseradish peroxidase (HRP)-conjugated secondary antibody prepared in TBS-T. The membrane-washing procedures were repeated as previously. The HRP signal was detected using the chemiluminescence detection reagent (ECL-GE Healthcare, UK), followed by visualization via an ImageQuant LAS 4000 instrument (ECL-GE Life Sciences, UK).

Mass spectrometry

HEK293T cells were transfected with Strep-VP4 or a control vector, and subsequently, the cells were collected and lysed at 36 h post-transfection. Lysates were pre-cleared with Sepharose 6B for 2 h, followed by overnight incubation with Strep-Tactin Sepharose beads. Bead-bound immunoprecipitants were washed initially with lysis buffer followed by PBS. The immunoprecipitants bound to the Strep beads were extracted with elution buffer composed of 1 mM EDTA, 2.5 mM desthiobiotin, 150 mM NaCl, and 100 mM Tris–HCl. An Amicon Ultra-0.5 (10 K cutoff) centrifugal filter (Merck Millipore; UFC501096) was used to concentrate the eluted proteins. For protein separation, NuPAGE gel with a gradient of 4–12% (Invitrogen, NP0323PK2) was implemented, followed by subsequent visualization via silver staining [40, 41]. The Distinct protein bands were then separated and subjected to mass spectrometric analysis.

Confocal imaging

PK15 or HeLa cells were grown in an 8-well chamber slide (ibidi, 80,826). Upon transfection or stimulation, fixation of cells was done with (4%) paraformaldehyde at room temperature (RT) for 20 min, and cells were rinsed with (1×) PBS. Then, 100% methanol was used to permeabilize the fixed cells at −20 ℃ for 20 min. Afterward, 2% BSA in (1×) PBS was used to block the cells for 1 h at RT, which were then treated with corresponding primary antibodies overnight at 4 °C. Upon completion of incubation, cells were rinsed in (1×) PBS-T followed by incubation with the corresponding secondary antibody for 1 h (RT). Subsequently, cells were rinsed in (1×) PBS-T and nuclei were counterstained for 10 min with DAPI (4′,6-diamidino-2-phenylindole). Finally, images were acquired by LEICA DMi8 confocal microscope, and images were assessed via Las-X software (v3.7.1.21655).

Fractionation assay

VP4 stably expressing cells or the control 3D4/21 cells were grown in 6-well plates prior to stimulation with SeV (MOI = 1) infection. Samples were harvested in a time-course-dependent manner. Following this, nuclear and cytoplasmic fractionation was conducted per the manufacturer’s guidelines (Invent Biotechnologies Inc., SM-005). Protein concentrations were determined through the Bradford assay (Bio-Rad, USA), ensuring that consistent protein input was loaded for each sample across time points. An immunoblot analysis was done employing specific antibodies targeting IRF3, pIRF3, KPNA2, KPNA4, and Strep. Nuclear proteins were standardized with lamin B1, while cytoplasmic proteins were standardized by tubulin.

Native PAGE assay

Cells were lysed using RIPA buffer, supplemented with a protease inhibitor cocktail and a phosphatase inhibitor cocktail. The lysates were then run on an 8% Tris–glycine gel (Invitrogen) in a Tris–glycine native running buffer (25 mM Tris, pH 8.3, 192 mM glycine). Monomeric and dimerized IRF3 proteins were subsequently detected through immunoblot analysis.

Statistical analysis

All graphical representations and statistical assessments were conducted employing GraphPad Prism (v6) for Windows. Results are expressed as the mean ± standard deviation (SD) derived from a minimum of two independent experiments. An unpaired Student’s t-test was employed to evaluate the statistical significance between the untreated and treatment groups at individual time points. p-Values of * < 0.05, ** < 0.01, *** < 0.001, or **** < 0.0001 were considered statistically significant.

Results

VP4 suppresses RIG-I-mediated IFN-β-promoter-driven transcription

Plasmid transfection efficiency and VP4 expression in 3D4/21, PK15, LFBK, and HEK293T cells were confirmed through immunoblot assays (Additional files 1A–D), with corresponding VP4 mRNA expression levels also verified (Additional files 1E–H).

Given that FMDV employs multiple strategies to interfere with the type I IFN pathway to enhance viral replication, we next investigated whether FMDV structural proteins modulate IFN signaling. Using a dual-luciferase reporter assay, we activated the type I IFN pathway by RIG-I transfection and evaluated the effects of FMDV structural proteins. These analyses identified VP4 as one of four FMDV structural proteins that attenuated RIG-I-mediated IFN-β luciferase activity (Additional file 2 A).

VP4 targets KPNA molecules

On the basis of our screening results, we selected the VP4 gene to investigate the precise molecular mechanisms underlying immune evasion. To assess the effect of VP4 on the RLR signaling pathway, a luciferase promoter assay was conducted in HEK293T cells. In this assay, VP4 was co-transfected with key adapter proteins involved in the RIG-I pathway. The results demonstrated that VP4 significantly suppressed IFN-β promoter activity mediated by RIG-I, RIG-I (2CARD), MAVS, TRIF, TBK1, IKKε, IRF3, and IRF3-5D in a dose-responsive manner (Figure 1A). These findings indicate that VP4 inhibits the RIG-I pathway downstream of IRF3-5D. Since importin α (KPNA1-6) and importin β (KPNB1) are responsible for IRF3 nuclear translocation, we hypothesize the possibility of VP4 involvement in this process [42, 43]. To further evaluate the specific molecular target of VP4 involved in immune modulation, we expressed VP4 in HEK293T cells, then performed a large-scale Strep pull-down (PD) assay. In the mass spectrometric analysis, KPNA2 (NCBI gene ID: 3838) and KPNA4 (NCBI gene ID: 3840) were identified as potential interacting partners of VP4 (Figure 1B). To corroborate these findings, we conducted an immunoprecipitation (IP) assay to examine the association of VP4 with KPNA1 through KPNA6 plasmids. Immunoblot analysis demonstrated a direct interaction of VP4 with both KPNA2 and KPNA4 (Figure 1C). In addition, the VP4–KPNA2 and KPNA4 interaction was further validated through an overexpression PD assay in HEK293T cells (Figures 1D, E). Reverse IP assays also reinforced these observations (Additional files 2B, C). Thereafter, we confirmed VP4 binding to endogenous KPNA2 and KPNA4 in HEK293T cells (Figures 1F, G). Finally, confocal microscopy assays provided evidence for both colocalization of exogenously expressed and endogenous KPNA2 and KPNA4 with VP4 in PK15 and HeLa cells, with the colocalized regions indicated by white squares (Figures 1H, I). Collectively, the above results suggest that VP4 initiates a novel regulatory mechanism that counteracts the type I IFN pathway by targeting KPNA2 and KPNA4.

Figure 1.

FMDV structural protein VP4 interacts with KPNA. A HEK293T cells underwent co-transfection with TK Renilla and IFN-β promoter luciferase reporter plasmids, increasing amounts of Flag-VP4 plasmid, and expressing plasmids of key modulatory proteins involved in the type I IFN cascade: RIG-I, RIG-I (2CARD), MAVS, TRIF, TBK1, IKKƐ, IRF3, and IRF3-5D. Then, 24 h after transfection, luciferase reporter activity was measured in the samples. Subsequently, results were quantified and normalized against Renilla luciferase expressed independently. B HEK293T cells underwent transfection with Strep-VP4 or control vector, followed by a large-scale Strep-PD assay and subsequent mass spectrometric analysis. C HEK293T cells underwent co-transfection with Flag-KPNA1 to KPNA6 along with Strep-VP4, subsequently subjected to Flag IP, followed by immunoblotting with pertinent antibodies. Next, HEK293T cells underwent transfection with Strep-VP4, and D Flag-KPNA2 or E Flag-KPNA4, and were subjected to Strep-PD. Thereafter, Strep-PD samples were analyzed by immunoblotting. HEK293T cells underwent transfection with Strep-VP4 or a control vector. Lysates were processed by Strep-PD and immunoblotted using F KPNA2 or G KPNA4. H Confocal microscopy was used to illustrate the colocalization of Strep-VP4 and Flag-KPNA2, or Flag-KPNA4, in PK15 cells. I HeLa cells underwent transfection with a control vector or Flag-VP4. Fixed plates were processed for confocal microscopy, using antibodies against Flag and either KPNA2 or KPNA4. Marked squares in the confocal images indicate regions of colocalization for more precise visualization. Luciferase data represent two independent experiments, and all values are expressed as the mean ± SD of two biological replicates. All the immunoblot data are representative of at least two independent experiments, each with similar findings.

KPNA targets IRF3

Nuclear translocation of activated IRF3 is mediated by KPNA 1–4 [10–14], which exhibits a common domain structure [44, 45]. In order to examine the influence of VP4 on IRF3 nuclear translocation, we conducted a detailed analysis of the interaction between KPNA4 and IRF3. Consistent with our expectations, immunoblot analysis demonstrated a co-association of IRF3 and KPNA4 in the HEK293T cells (Figure 2A). Subsequently, to assess the co-association of IRF3 and both KPNA2 and KPNA4 under physiological conditions, HEK293T cells were infected with PR8-GFP in a time-dependent manner. An endogenous IP assay revealed a progressive increase in the co-association of IRF3 and KPNA2 and KPNA4, peaking at 16 h post-infection (hpi) (Figures 2B, C). Successful viral infection was confirmed by detection of M2 protein expression on immunoblots. Furthermore, we generated expression plasmids that encoded the GST-tagged DNA binding domain (DBD, 1–140 aa), the IRF-association domain (IAD, 140–380 aa), and the autoinhibition element (AIE, 380–427 aa) [46] to recognize which of these associates with KPNA4 (Figure 2D). Our results revealed that KPNA4 is associated with the DBD of IRF3 (Figure 2E). Thereafter, we sought to identify which region of KPNA4 is crucial for binding with IRF3 and VP4. We generated four GST-tagged KPNA4 constructs (1–60 aa, 1–110 aa, 1–280 aa, and 1–450 aa) (Figure 2F) and performed GST-PD assays with IRF3 and VP4. Immunoblot analysis indicated that both IRF3 and VP4 associate with KPNA4 within the region spanning 110–280 aa, which harbors nuclear localization signals essential for cargo recognition (Figures 2G, H). Thus, we identified that both IRF3 and VP4 engage with the same region of KPNA4; hence, we propose that they may compete for binding to KPNA4.

Figure 2.

VP4 and IRF3 compete for the interaction with KPNA4. A HEK293T cells underwent co-transfection with Strep-IRF3 and Flag-KPNA4, followed by a Flag IP assay and immunoblot analysis with pertinent antibodies. HEK293T cells were inoculated with the PR8-GFP at designated time points. Subsequently, harvested lysates were immunoprecipitated with B KPNA2 and C KPNA4 antibodies. D Domain constructs of IRF3 (1–427 aa, 1–140 aa, 140–380 aa, and 380–427 aa). E HEK293T cells underwent co-transfection with GST-IRF3 (WT) and its domain constructs together with Flag-KPNA4 plasmid and were subjected to the GST-PD assay and immunoblotting with the corresponding antibodies. F Truncated constructs of KPNA4 (1–520 aa, 1–60 aa, 1–110 aa, 1–280 aa, and 1–450 aa). HEK293T cells were co-transfected with GST-KPNA4 (WT) and its truncated constructs, together with G Strep-IRF3 or H Strep-VP4, and subjected to the GST-PD assay, followed by immunoblot analysis with the indicated antibodies. All the immunoblot data are representative of at least two independent experiments, each with similar findings.

VP4 impairs IRF3 nuclear translocation by competitively interacting with KPNA

Subsequently, we performed in vitro competition assays to assess the association of IRF3, VP4, KPNA2, and KPNA4. To facilitate this, we performed a competition assay by transfecting with increasing amounts of VP4-expressing plasmid (0.5 μg, 1.0 μg, and 2.0 μg). As anticipated, we observed a decrease in IRF3 affinity for KPNA2 with increasing VP4 doses (Figure 3A). Furthermore, analogous results were obtained with KPNA4, as illustrated in Figure 3B. Subsequent IP of KPNA2 and KPNA4 under endogenous conditions following plasmid transfection with increasing VP4 amounts (0.5 μg, 1.0 μg, and 2.0 μg) demonstrated a dose-dependent enhancement of VP4 binding to both KPNA proteins. This interaction correspondingly inhibited the endogenous association between the IRF3 and KPNA proteins (Figures 3C, D). In addition, we included VP1 as an experimental control in Figures 3C and D to confirm the specificity of VP4 interactions with KPNA2 and KPNA4, thereby strengthening the validity of our conclusions. These findings provide compelling evidence that VP4 disrupts the co-association of IRF3 and both KPNA2 and KPNA4 in a dose-dependent manner.

Figure 3.

VP4 impairs the nuclear translocation of IRF3. A An in vitro Flag-KPNA2 B Flag-KPNA4 interaction competition assay with co-expressed GST-IRF3, with increasing doses of Strep-VP4. At 36 h, samples were collected, and lysates underwent an IP assay and immunoblotting. Increasing doses of Strep-VP4 and Strep-VP1 were expressed in HEK293T cells via transfection and subsequently stimulated with poly I:C. The resulting cell lysates underwent IP assays for C KPNA2 and D KPNA4, followed by immunoblotting analysis. E HEK293T cells underwent co-transfection with increasing amounts of Strep-VP4 and consistent doses of V5-TBK1 and Flag-IRF3. pIRF3 and other proteins were observed by immunoblotting. F 3D4/21 cells were transfected with increasing doses of Strep-VP4 and subsequently subjected to poly I:C stimulation. After 36 h post-transfection, cells were harvested and analyzed using native gel electrophoresis to detect the monomeric and dimeric forms of IRF3. Immunoblotting was then performed with an anti-IRF3 antibody, while β-actin was used as a loading control. G Flag-VP4 stably expressing 3D4/21 cells were stimulated with the SeV (MOI = 1) and harvested at predetermined time points. Nuclear and cytoplasmic fractions were segregated from cell lysates and immunoblotted with pertinent antibodies. The histogram shows the relative quantification of protein levels from the western blot. The intensity of nuclear localization for IRF3 is quantified by measuring the IRF3 band intensity in the nuclear fraction using ImageJ software, adjusted to the nuclear lamin B1 fraction. H PK15 cells underwent transfection with Strep-VP4 or a control vector and stimulated with SeV (MOI = 1), followed by confocal microscopy with the corresponding antibodies. Marked squares in the confocal images indicate the IRF3 cytoplasmic retention for more precise visualization. I Graphical summary of VP4 immune evasion: VP4 inhibits the interaction between IRF3, KPNA2 and KPNA4, and disrupts the nuclear translocation of IRF3. All immunoblot data and confocal data are representative of at least two independent experiments, each with similar results. Student’s t-test: *p < 0.05, **p < 0.01, ***p < 0.001.

Consequently, to assess how VP4 regulates IRF3 activation, we investigated the involvement of VP4 in IRF3 phosphorylation and dimerization [46]. Initially, phosphorylation of IRF3 induced by TBK1 overexpression was evaluated in the presence of increasing amounts of VP4 plasmid transfection. Figure 3E illustrates that increasing amounts of VP4 (0.5 μg, 1.0 μg, and 2.0 μg) did not influence the phosphorylation status of IRF3. An endogenous IRF3 dimerization assay under stimulated conditions showed that VP4 does not inhibit IRF3 dimerization, as demonstrated by native PAGE analysis (Figure 3F). Subsequently, to substantiate the inhibitory effect of VP4 on IRF3 nuclear translocation, we performed a SeV-induced fractionation assay of IRF3 in 3D4/21 cells stably expressing VP4 or a control plasmid. We extracted cytoplasmic and nuclear fractions from the lysates for further analysis. Immunoblotting was conducted to confirm the specific protein expression. In VP4-expressing 3D4/21 cells, IRF3 nuclear translocation was substantially reduced compared with the control (Figure 3G). A graph depicting nuclear intensity was generated, indicating that at 16 hpi, VP4 expression in 3D4/21 cells led to an approximate 75% reduction in IRF3 nuclear translocation compared with the control. To further evaluate the impact of VP4 on the nuclear translocation of IRF3, we conducted an immunofluorescence assay using PK15 cells that were either transfected with Strep-VP4 or with a control vector, followed by SeV infection at predetermined time points. Upon stimulation, nuclear-localized IRF3 levels in control increased progressively at 16 hpi. In contrast, the nuclear presence of IRF3 in cells expressing VP4 was significantly reduced (Figure 3H). Figure 3I shows mechanistic evidence that VP4 disrupts the interaction between IRF3 and the nuclear import receptors KPNA2 and KPNA4. This disruption is associated with reduced nuclear translocation of IRF3, suggesting a potential role for VP4 in modulating IRF3 nuclear localization.

VP4 inhibits type I IFN signaling and antiviral gene transcription

To further elucidate the regulatory effect of VP4 on virus-mediated activation of the type I IFN pathway, we evaluated RNA virus-triggered phosphorylation of TBK1, IRF3, STAT1, IκBα, and p65. These molecules are essential components of the type I IFN and nuclear factor kappa B (NF-κB) pathways. VP4-overexpressing PK15, 3D4/21, and the respective control vector-transfected cells were stimulated by PR8-GFP infection. Cells were sampled at 0, 4, 8, 12, and 16 hpi for subsequent immunoblotting. A significant reduction in phosphorylated TBK1, STAT1, IκBα, and p65 was observed in VP4-expressing cells compared with control cells. This reduction was consistently observed across 3D4/21 (Figure 4A), PK15 (Figure 4C), and HEK293T (Additional file 3 A) cell lines. Furthermore, we conducted a signaling assay using poly I:C stimulation, which consistently revealed the inhibitory role of VP4 solely in IFN signaling (Additional file 3B). Subsequently, we evaluated the transcriptional effect of VP4 on IFNs (IFN-α, IFN-β, and IFN-γ), proinflammatory cytokines [IL-6, IL-1β, and tumor necrosis factor-alpha (TNF-α)], and ISGs [monocyte chemoattractant protein1 (MCP1), MX dynamin-like GTPase1 (MX1), IFN-induced guanylate-binding protein-1(GBP1), and ISG-15] in VP4-expressing and control cells. VP4 or control vector-expressing samples were infected with PR8-GFP. Samples were then collected at the designated time points, followed by RNA isolation. A qRT-PCR was then conducted. Compared with the control cells, VP4-overexpressing 3D4/21 (Figure 4B), PK15 (Figure 4D), and HEK293T (Additional file 3 C) cells show lower expression of mRNA encoding IFN genes, proinflammatory cytokine genes, and other ISGs. The above results suggest that VP4 downregulates the host type I IFN pathway and suppresses antiviral gene transcription.

Figure 4.

VP4 inhibits type I IFN signaling and antiviral gene transcription. Control vector or Flag-VP4 stably expressed A 3D4/21 cells or transiently transfected C PK15 cells were stimulated by PR8-GFP (MOI = 1). Samples were collected at predefined time points. Intact and phosphorylated forms of IRF3, TBK1, STAT1, IκBα, and p65 were assessed through immunoblotting. β-actin served as an internal reference to ensure equal protein loading. VP4 stably expressing B 3D4/21 or transiently transfected D PK15 cells were inoculated with PR8-GFP (MOI = 1). Cells were sampled at specified time points. Subsequently, cellular RNA was isolated. qRT-PCR quantified antiviral gene transcription levels. All immunoblot data represent at least two independent experiments, each with similar results. All qRT-PCR data represent at least two independent experiments, each with similar results, and the values are expressed as the mean ± SD of two biological replicates. Student’s t-test: *p < 0.05, **p < 0.01, ***p < 0.001.

VP4 downregulates RNA virus-mediated antiviral immune responses

Following confirmation that VP4 significantly inhibits host type I IFN signaling, we examined its effect on viral replication. Accordingly, we infected 3D4/21 cells that stably overexpressed VP4 or a control vector with PR8-GFP to evaluate the impact of VP4 on surrogate virus replication. The results indicated that VP4-overexpressing 3D4/21 cells manifested with significantly elevated GFP expression levels and virus titers compared with control cells, indicating enhanced viral replication (Figure 5A). Subsequently, we conducted ELISAs to quantify the amounts of secretory IFN-β and IL-6 in the cell supernatants of virus-infected cells. As anticipated, the VP4-overexpressing 3D4/21 cells displayed reduced cytokine secretion levels than the control cells (Figure 5B). The virus replication experiments were repeated with VSV-GFP in PK15, LFBK, and HEK293T cells (Figures 5C, E, G). Viral replication was found to be significantly higher in the cell lines expressing VP4 compared with control cells. We also assessed the secretion of IFN-β and IL-6 in the supernatants collected from cells following virus infection using commercial ELISA kits. Consistent with our previous findings, the cells expressing VP4 secreted significantly reduced amounts of cytokines than controls (Figures 5D, F, H). These results further suggest that VP4 functions as a downregulator of type I IFN and pro-inflammatory cytokine production, thereby enhancing RNA virus replication in both epithelial cells and macrophages of porcine and human origin.

Figure 5.

VP4 negatively regulates RNA virus-stimulated innate immunity to enhance viral replication. The control vector and Flag-VP4 stably expressing A 3D4/21 cells were stimulated with PR8-GFP (MOI = 1), along with transiently transfected C PK15 cells, E LFBK cells, and G HEK293T cells that were inoculated with VSV-GFP (MOI = 1). The assessment of viral replication was conducted at 24 hpi via fluorescence microscopy and determined at 12 and 24 hpi by a fluorescence modulator. Then, virus titers of individual samples were determined through plaque assays. B, D, F, and H The secretions of IFN-β and IL-6 in the culture supernatants were quantified at 12 and 24 hpi using ELISA. The results represent a minimum of two independent experiments, each presenting similar findings, and the values are expressed as the mean ± SD of three biological replicates. Student’s t-test: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

VP4 downregulates DNA virus-mediated antiviral immune responses

IRF3 functions as a central signaling molecule in type I IFN pathways activated by both RNA and DNA viruses. Given that VP4 has been shown to enhance the replication efficiency of RNA viruses, the subsequent step was to investigate its impact on DNA virus replication and the resulting cytokine secretion. Therefore, VP4-stable 3D4/21 cells were inoculated with HSV-GFP at the indicated time points. As expected, the increased HSV-GFP replication in the VP4-expressing cell line was confirmed in a GFP fluorescence assay and a virus titration assay compared with that of a control cell line (Additional file 4 A). ELISA assays for IFN-β and IL-6 revealed a significant reduction in cytokine secretion in cells expressing VP4 compared with controls (Additional file 4B). Experiments in VP4-overexpressing PK15 and HEK293T cells yielded similar results regarding DNA virus replication (Additional files 4C, E) and subsequent cytokine secretion (Additional files 4D, F). These results suggest that the expression of VP4 facilitates replication of DNA viruses along with RNA viruses by inhibiting the nuclear translocation of IRF3.

Discussion

FMDV has developed various strategies to evade host type I IFN responses [47, 48]. First, FMDV L^pro promotes viral replication by evading the antiviral IFN response through counteracting the 2’,5’-oligoadenylate synthetase (OAS)/RNase L system [49]. In addition, L^pro was shown to cleave MAVS and TBK1 [50]. FMDV 3C^pro also contributes to immune evasion by inhibiting the nuclear translocation of STAT1 [51]. Furthermore, 3C^pro degrades cytosolic pathogen recognition receptors, including MDA5 [52], laboratory of genetics and physiology 2 (LGP2) [53], and protein kinase R (PKR) [54]. Collectively, these mechanisms mediated by 3C^pro result in the downregulation of type I IFNs. FMDV 2B interacts with RIG-I and LGP2 [53, 55] and degrades RIG-I and MDA5 [56], thereby interfering with antiviral signal transduction. FMDV 3A contributes to immune evasion by promoting upregulation of leucine-rich repeat-containing protein 25 (LRRC25)-mediated degradation of ras-GAP SH3-binding protein 1 (G3BP1), which inhibits expression of RIG-I and MDA5 [57], and by interacting with DEAD-Box helicase 56 (DDX56) to inhibit IRF3 phosphorylation [58]. Further,  3A also interacts with cellular vimentin [59] and annexin-A1 (ANXA1) [60] to enhance viral replication. As a structural protein, FMDV VP1 interacts with sorcin to inhibit the type I IFN cascade [61] and interacts with MAVS to inhibit the MAVS/TRAF3 interaction [62]. FMDV VP3 also inhibits MAVS aggregation and downregulates the type I IFN pathway [63]. To date, FMDV VP4 is known to affect the expression of p53-regulated interferon-inducible antiviral genes [38]. However, the exact mechanism by which VP4 inhibits the type I IFN signaling has not yet been identified.

In this study, we aimed to identify the novel molecular mechanism underlying the inhibition of type I IFN signaling by the VP4 structural protein. Initially, we screened and confirmed that VP4 significantly inhibited IFN-β luciferase activity, suggesting a potential role in interfering with IFN induction. Second, on the basis of the results of the IFN-β luciferase reporter assay, VP4 was shown to target a downstream molecule of IRF3-5D and interact with the KPNA proteins to inhibit IFN production, as confirmed by interaction assays. Third, VP4 and IRF3 interact with the same region of KPNA4; therefore, VP4 inhibits the interaction between KPNA4 and IRF3 through competitive binding with higher affinity. Thus, we demonstrated that VP4 inhibits the nuclear translocation of IRF3 without affecting the dimerization and phosphorylation of IRF3. Finally, overexpression of VP4 led to a marked downregulation of the phosphorylation and activation of type I IFN signaling pathway molecules, as well as a reduction in the expression of mRNA encoding IFN-related genes, proinflammatory cytokine genes, and ISGs. In addition, overexpression of VP4 in macrophages and epithelial cells increased the replication of RNA viruses, accompanied by a significant reduction in the secretion of virus-induced IFN-β and IL-6. Taken together, these findings suggest that FMDV VP4 negatively regulates host type I IFN signaling by inhibiting the nuclear translocation of IRF3.

According to our results, FMDV VP4 targets KPNA molecules to inhibit the nuclear translocation of IRF3. KPNAs are a group of proteins that facilitate nucleocytoplasmic trafficking of numerous proteins, including transcription factors involved in cellular proliferation, differentiation, and host immunity. In the classical nuclear import pathway, cytoplasmic cargoes bearing a classical NLS are first recognized by KPNA and then associate with KPNB. The ternary complex of KPNA/KPNB and cargo translocates via the nuclear pore complex (NPC) across the Ran–GTP gradient [64, 65]. There are seven KPNA isoforms (KPNA1–KPNA7) in humans [66, 67], and KPNA1–KPNA4 are known carriers of IRF3 for nuclear translocation [10–14].

Recent studies have highlighted the importance of the interactions between viral proteins and KPNA molecules as a strategy to evade host immune responses [14, 68–70]. Notably, the VP24 protein of the Ebola virus interacts with the NLS region of KPNA5 and inhibits the nuclear translocation of pSTAT1 [68, 69]. Enterovirus 71 inhibits the Janus kinase (JAK)/STAT signaling pathway by inducing the degradation of KPNA1 [70]. Similarly, the Japanese encephalitis virus NS5 protein interacts with KPNA2–KPNA4 to prevent their association with cargo molecules such as IRF3 and NF-κB, resulting in downregulation of the host immune response [14].

Similar to previous studies, mass spectrometry results from the VP4 Strep large-scale PD assay identified KPNA2 and KPNA4 as potential binding partners, and we confirmed specific interactions between VP4 and KPNA2/KPNA4. The domain structure of KPNA molecules comprises three primary domains: a flexible N-terminal KPNB binding domain, known as the importin β-binding domain; a C-terminal domain; and a central region containing ten relatively hydrophobic tandem armadillo (ARM) repeats [71–73]. Each ARM repeat is approximately 42–43 amino acids in length. There are two NLS binding sites within the ten ARM repeats: an N-terminal NLS spanning ARM repeats 2–4, and a C-terminal NLS spanning ARM repeats 7–9 [44]. Based on domain mapping using truncated forms of KPNA4 (1–60 aa, 1–110 aa, 1–280 aa, and 1–450 aa), both VP4 and IRF3 specifically interact with the 110–280 aa region of KPNA4, which contains the N-terminal NLS spanning ARM repeats 2–4. These results suggest that VP4 competitively interacts with the N-terminal NLS site of KPNA4, thereby preventing KPNA4 from interacting with IRF3 and consequently inhibiting IRF3 translocation to the nucleus.

Previous studies have demonstrated that both VP4 and its precursor VP0 can antagonize type I IFN. Similar to VP4, VP0 facilitates the degradation of NME1 [38] while also promoting the degradation of MAVS through its interaction with PCBP2 [74]. These findings suggest that the IFN-inhibitory properties attributed to VP4 may also extend to VP0. Given that VP0 is cleaved into VP2 and VP4 during viral maturation, this processing could impact their accessibility and regulatory functions. In our study, direct experimentation with wild-type FMDV was not feasible owing to biosafety and infrastructure constraints, which is a limitation of the study. Therefore, we utilized two RNA surrogate viruses (VSV-GFP and PR8-GFP) and one DNA surrogate virus (HSV-GFP) to explore the role of VP4 in viral replication. The results indicated that VP4 inhibits the IFN response, at least in part, by competitively disrupting the interaction between IRF3 and KPNA, a mechanism that appears crucial for effective viral replication. Future studies using authentic FMDV may further support these findings. Overall, these findings support the notion that the inhibitory functions of VP4, observed in surrogate virus systems, may also influence FMDV-infected cells, thereby enhancing the virus’ ability to suppress host innate immune responses and facilitate replication.

In summary, we report a novel characterization by which VP4 structural protein acts as a negative regulator of type I IFNs and pro-inflammatory responses by inhibiting the KPNA-mediated nuclear translocation of IRF3. These data expand our understanding of FMDV pathogenicity by demonstrating that VP4 counteracts the type I IFN response as an immune-evasion strategy and reinforces the idea that VP4 represents a critical target for FMDV attenuation.

Authors' contributions

AS performed most of the experiments. NN performed some of the phenotype experiments. AW, NG, and DH helped with the experiments and contributed to the discussions. J-SL designed and supervised the overall study. J-SL wrote the manuscript with the help of AS. All the authors helped with data analysis. All authors contributed to the article and approved the submitted version.

Funding

This work was supported by the National Research Foundation (grant no. RS-2021-NR060136) and Chungnam National University, Republic of Korea.

Data availability

The data that support the findings of this study are available within the main body of the manuscript and additional files. Further inquiries can be directed to the corresponding author.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.