Indole-3-carbinol alleviates cisplatin-induced ovarian damage by inhibiting ovarian fibrosis through the TGF-β1/Smad pathway

Abstract

Background

Ovarian injury caused by chemotherapy severely threatens female reproductive health. Indole-3-carbinol (I3C), a natural substance that is abundant in cruciferous vegetables, has been reported to attenuate tissue damage. This study aimed to investigate whether I3C treatment could prevent ovarian damage induced by chemotherapy.

Methods

A mouse ovarian injury model was established by the intraperitoneal injection of cisplatin into 8-week-old ICR mice (n = 18). The therapeutic effect of I3C was studied through ovarian index calculations, estrous cycle analysis and follicular reserve assessment. Additionally, we performed TUNEL (Terminal Deoxynucleotidyl Transferase-Mediated dUTP Nick End Labeling) and immunohistochemistry (IHC) staining to analyze the levels of apoptosis and fibrosis, respectively. A 3-week-old ICR mouse (n = 30) model was used for mechanistic exploration because the model can avoid the influence of the estrous cycle on gene expression and signaling pathways. Additionally, the human granulosa cell line KGN was treated with cisplatin and I3C in vitro to assess their effects on fibrotic markers and the transforming growth factor-beta (TGF-β)/Smad pathway. Western blotting (WB) and real-time quantitative polymerase chain reaction (RT-qPCR) were employed to assess the protein and mRNA levels, respectively. A tumor-bearing model established in 4-week-old female BALB/c nude mice (n = 24) was used to verify the anticancer activity of I3C in cervical cancer in vivo and that I3C protects against ovarian damage induced by chemotherapy.

Results

The administration of I3C restored the ovary index and decreased the incidence of estrous cycle disorders. The results of follicle counting revealed that I3C treatment inhibited primordial follicle overactivation caused by cisplatin treatment, and maintained the primordial follicle pool. We also found that I3C treatment decreased the level of apoptosis in ovaries. Additionally, I3C treatment reduced ovarian fibrosis and inhibited α-SMA and collagen I expression. Further research revealed that I3C treatment significantly downregulated the activity of the TGF-β1/Smad signaling pathway. In vitro experiments have shown that cisplatin induced fibrosis is regulated by the TGF-β1/Smad pathway. The results from a tumor-bearing model established in nude mice revealed that I3C exposure blocked cervical carcinoma growth, reduced ovarian fibrosis and maintained the primordial follicle reserve.

Conclusion

In summary, I3C treatment alleviates cisplatin-induced primordial follicular overactivation, granulosa cell apoptosis and ovarian fibrosis, and promotes antitumor activity in vivo. Our study provides an innovative therapeutic strategy for preventing chemotherapy-mediated decreases in ovarian function in female cancer patients.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13048-026-01994-2.

Introduction

As the incidence of tumors increases annually, so does the number of young oncology patients. Moreover, advances in cancer detection and treatment methods have improved cancer patient prognosis and increased overall and disease-free survival rates [1, 2]. However, growing evidence indicates that anticancer treatment is frequently the cause of ovarian insufficiency and infertility [1, 3, 4]. Reproductive potential after chemotherapy is of particular concern for young women who are diagnosed with cancer [1]. Improving the reproductive health of oncology patients and preserving their fertility have become difficult issues to address during the therapeutic process.

The length of a woman’s reproductive life is determined by the number of primordial follicles [5, 6]. In contrast, chemotherapy-induced impairment of ovarian function is primarily manifested by overactivation of primordial follicles and direct apoptosis of primordial follicles, which results in a decrease in the ovarian reserve [7, 8]. Studies have confirmed that cisplatin can cause DNA damage in ovarian tissue, thereby leading to apoptosis [9–11]. P53 is involved in the regulation of ovarian cell apoptosis, and cisplatin can activate P53 by activating ART [3]. In addition, cisplatin increases reactive oxygen species (ROS) levels in oocytes and granulosa cells [12, 13]. ROS can downregulate Silent information regulator 1 (Sirt1) expression while upregulating both the protein expression and posttranslational modification levels of P53, thereby promoting DNA damage and apoptosis [14]. An increase in ROS can also promote the occurrence of ferroptosis [15]. Cisplatin can induce ferroptosis by increasing the expression of acyl-CoA synthetase long chain family member 4 (ACSL4) or inhibiting glutathione peroxidase 4 (GPX4), and inhibiting ferroptosis can alleviate premature ovarian failure (POF) [13, 16, 17].

Multiple variables affect the ovaries simultaneously, reducing the primordial follicular reserve, and resulting in POF and fibrosis, which lead to inflammation and further damage [3, 18]. The histological studies of the human ovary by Meirow et al. revealed that localized ovarian cortical fibrosis and vascular injury may be additional significant mechanisms underlying chemotherapy-induced ovarian functional impairment [19], but this has not yet been widely discussed. Additionally, Cui et al. demonstrated that fibrosis of ovarian tissue is a fundamental pathological change in primary ovarian insufficiency [20]. This information might aid in the development of new strategies focused on preventing chemotherapy-related ovarian damage.

Previous research has demonstrated that the TGF-β1/Smad signaling pathway is crucial for the development of hepatic, renal, cardiac, and pulmonary fibrosis [21–24]. TGF-β1 is a profibrotic cytokine that promotes excessive extracellular matrix (ECM) synthesis and deposition, resulting in tissue fibrosis [25]. Smad2 and smad3 are two important downstream regulators of fibrosis, and they support TGF-β1-mediated tissue growth [26]. More importantly, studies have shown that fibrosis occurs in ovary-related diseases, such as POF [20], polycystic ovary syndrome (PCOS) [27] and ovarian dysfunction induced by environmental pollutants [28], and is regulated by the TGF-β1/Smad pathway. Inhibiting the TGF-β1/Smad pathway through different intervention methods can alleviate ovarian fibrosis, increase ovarian reserves and improve ovarian function [10, 20, 27]. We therefore verified this pathway to understand the mechanism underlying fibrosis due to chemotherapy-induced ovarian damage.

Indole-3-carbinol (I3C) is a monomer found in the leaves and stems of Brassica plants such as broccoli, cauliflower, Brussels sprouts, and cabbage [29, 30]. According to numerous studies, I3C has anti-inflammatory, antioxidant, antiviral, apoptosis-inhibiting, and antitumor properties [31–33]. Furthermore, I3C increases adenosine monophosphate-activated protein kinase (AMPK) activation in the heart while decreasing mammalian target of rapamycin (mTOR) and extracellular signal-regulated kinase 1/2 (ERK1/2) activation, which can effectively prevent and reverse pressure overload-induced myocardial hypertrophy, fibrosis, and dysfunction [34]. In addition, the mTOR pathway is among the key pathways regulating the follicular reserve, with its abnormal activation leading to follicular reserve depletion [35]. Inhibiting the mTOR pathway or its upstream or downstream signaling can suppress the activation of primordial follicles and maintain the follicular reserve [36, 37]. Our previous study revealed that I3C can mitigate the extent of fibrosis in naturally aging ovaries without inducing significant damage to the ovaries of young mice [38]. However, no studies have investigated whether I3C has a protective effect on chemotherapy-induced POF.

The mechanisms by which I3C may contribute to the ovarian damage caused by chemotherapy, however, remain unknown. In this study, we aimed to determine whether I3C is able to alleviate the ovarian injury caused by chemotherapy in a mouse model and whether it has antitumor properties. In this manuscript, we provide evidence that I3C can maintain the primordial follicle reserve and decrease the apoptosis of granulosa cells in vivo. Additionally, our data show that I3C treatment is capable of reducing ovarian fibrosis by regulating the activity of the TGF-β1/Smad pathway and that I3C inhibits tumor progression both in vitro and in vivo.

Materials and methods

Reagents

Cisplatin (HY-17394), indole-3-carbinol (HY-N0170) and 4-[4-(1,3-benzodioxol-5-yl)-5-(2-pyridinyl)-1 H-imidazol-2-yl]benzamide (SB-431542, HY-10431) were purchased from MCE (New Jersey, USA). A TUNEL ApoGreen Detection Kit (40307ES20), a 1st Strand cDNA Synthesis Kit (11141ES60), Hieff qPCR SYBR Green Master Mix (11201ES08) and recombinant human TGF-beta 1 protein (91701ES08) were purchased from YEASEN Biotechnology (Shanghai, China). All components listed above were stored at -20 °C prior to use. A Cell Counting Kit-8 (CT0001) was purchased from SparkJade (Shandong, China) and stored at 4 °C protected from light. H&E (C0105S) was purchased from Beyotime (Shanghai, China) and stored at room temperature.

Animals

This study was approved by the Experimental Animal Ethics Committee of Anhui Medical University (LLSC20232239). All the animal experiments were performed in accordance with the U.K. Animals (Scientific Procedures) Act, 1986 and associated guidelines. The reporting of the animal testing experiments complied with the ARRIVE guidelines. ICR female mice were purchased from the Experimental Animal Center of Anhui Medical University at 3 weeks (n = 30) [13, 39] and 8 weeks (n = 18) [13] of age. Four-week-old female BALB/c nude mice (n = 24) were purchased from GemPharmatech. All the animals were kept in specialized, pathogen-free environments with a constant temperature of 22 °C, a humidity range of 50% to 60%, and 12 h of light each day. Prior to the studies, the animals underwent a 3-day acclimatization period during which they had unrestricted access to food and water. Throughout the study, the animals were randomized to experimental groups, and outcome assessments were performed in a blinded manner wherever applicable.

Groups and treatment

Eight-week-old female ICR mice were randomly divided into control (Ctr), cisplatin (Cis), and cisplatin+I3C (Cis+I3C) groups (n = 6 biologically independent replicates). The mice in the control group received daily intraperitoneal injections of phosphate-buffered saline (PBS) for 7 days; those in the cisplatin group received daily intraperitoneal injections of cisplatin (2 mg/kg) for 7 days to establish an ovarian injury model [40]; and those in the cisplatin + I3C group received daily intraperitoneal injections of I3C (30 mg/kg) [41–45] at 3-hour intervals and intraperitoneal injections of cisplatin (2 mg/ kg) for 7 days. All the mice were sacrificed once the prescribed doses had been administered, and the ovaries were collected and weighed on an electronic balance. The mice were sacrificed during the diestrus stage, as determined by daily vaginal smear cytology (described in Sect. Estrous cycle examination), to minimize hormonal variability across individuals [46, 47].

The estrous cycle of mice can affect gene expression [46, 47], and follicles at different developmental stages already exist in the ovaries of 3-week-old mice without an estrous cycle. Therefore, 3-week-old mice are often used for ovarian research [13, 39]. In this study, ovaries removed from 3-week-old mice were used for qRT-PCR or Western blot analysis. The dose of the drug injected into 3-week-old mice was the same as that into 8-week-old mice, and the mice were sacrificed 24 h after drug treatment [48].

To investigate the protective effects of I3C in a chemotherapy-related context, a xenograft model was established. The human cervical cancer cell line HeLa was cultured in DMEM supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. The incubation conditions were 37 °C and 5% CO₂. HeLa cells (1 × 10⁶ cells / injection) were resuspended in 100 µL of PBS and subcutaneously injected into 4-week-old female BALB/c nude mice. The mice were intraperitoneally injected with 100 µL of vehicle (PBS) (n = 6), an equivalent volume of either cisplatin (2 mg/kg, n = 6) or I3C (30 mg/kg, n = 6), or a combination of I3C and cisplatin (n = 6) every two days. The tumor volume was measured every 3 days via the following standard formula: volume = 0.5 × width² × length [49]. After 2 weeks, the mice were sacrificed, and the xenograft tumors were excised, photographed, and fixed in formalin for histological analysis.

Ovarian hematoxylin eosin staining and follicle counting

Ovaries were fixed for 24 h in 4% paraformaldehyde, paraffin embedded, serially sectioned at a thickness of 5 μm, and then stained with hematoxylin and eosin (H&E). According to the accepted criteria set by Pedersen and Peters [50], the follicular phases are categorized. Primordial or primary follicles are defined as oocytes surrounded by a single layer of flat or cuboidal granulosa cells, respectively. Secondary follicles are defined as oocytes surrounded by more than one layer of cuboidal granulosa cells without a visible lumen. Antral follicles are defined as follicles with a clear luminal gap that contain follicular fluid. To determine the total number of follicles at each stage, follicle counts were performed on one ovary per mouse for 5 mice in each group, and only follicles with visible oocyte nuclei were counted every 5th slice.

IHC

Paraffin-embedded ovarian sections from different groups were attached to the same slide, after which the sections were dewaxed and rehydrated before being immersed in a sodium citrate solution (pH = 6.0) for 20 min for high-pressure antigen repair. Then, an endogenous peroxidase blocker was added dropwise and incubated for 10 min. The sections were blocked with a ready to use goat serum solution (EE0008, SparkJade) for 30 min at 37 °C. The tissue sections were then incubated with the indicated primary antibodies at 4 ℃ overnight, washed three times with PBS (pH 7.4, G4202, Servicebio), and incubated for 40 min with an HRP-conjugated goat anti-rabbit IgG secondary antibody. Finally, 3,3’-diaminobenzidine tetrahydrochloride (DAB, ZLI-9018, ZSGB-BIO) was added and incubated for 10 s, after which the sections were observed under a microscope. The coverslips were sealed and photographed under a microscope for observation, and ImageJ software was used for computational analysis. For each staining, ovarian sections from all the mice in a given experimental group (n = 3 biologically independent replicates) were processed and analyzed. Residual paraffin-embedded tissue blocks were stored at 4 °C for a long time.

Estrous cycle examination

Vaginal smear samples were collected every day at 8 a.m. for 10 days. In short, 20 µL of saline was used to clean the vagina, after which the collected vaginal secretions were placed on slides, dried, and stained with HE. Analysis under a light microscope, was performed to identify the estrous cycle stage on the basis of the proportion of keratinized epithelial cells, nucleated epithelial cells, and polymorphonuclear leukocytes. These stages were proestrus (P), estrus (E), metestrus (M), and diestrus (D), which typically lasted for 4–5 days. Proestrus was characterized by low numbers of neutrophils or large and nucleated epithelial cells. Estrus was characterized mainly by nucleated keratinized epithelial cells, metestrus by a combination of anucleated keratinized epithelial cells and neutrophils and diestrus by a high number of neutrophils. This assessment was performed on all the mice in the relevant groups (n = 5 biologically independent replicates).

TUNEL staining

TUNEL staining was performed using the TUNEL ApoGreen Detection Kit (KTA2010, Abbkine). To allow permeabilization, the ovarian tissues were dewaxed and rehydrated before being incubated in DNAase-free proteinase K (20 µg/mL) solution at room temperature for 20 min. The sections were subsequently washed three times with PBS in a Rocker device for 5 min each. This was followed by a 60-min incubation period at 37 °C using a TDT buffered system while avoiding light, after which the samples were washed three times with PBS (pH 7.4). The nuclei were observed by restaining with Hochst 33,342 (1:500, SJ-MD0033, SparkJade). Slides were mounted with an anti-fade reagent (EE0014, SparkJade). Finally, the apoptotic signal was observed under a fluorescence microscope (Axio Scope.A1, ZEISS). The nuclei were blue and positive apoptotic cells were green. Sections from multiple biological replicates (n = 3) per group were stained and analyzed.

WB

For Western blotting analysis, radio-immunoprecipitation assay (RIPA, EA0002, SparkJade) buffer containing enzyme-inhibitor was used to lyse the ovarian tissues (30 µL/mg) or cell lines (200 µL for 10⁶ cells). Protein samples were separated on 10% SDS-PAGE gels, transferred to PVDF membranes, and blocked for 1 h at room temperature with 5% skim milk diluted in TBST (TBS-0.1% Tween-20). The PVDF membranes were subsequently incubated overnight at 4 °C with a variety of antibodies. The membranes were washed three times with TBST before being incubated for one hour with a secondary IgG antibody conjugated to horseradish peroxidase (HRP) and diluted in 5% skim milk. ECL Prime Western Blotting detection reagent was used to determine the expression of each protein. Using a CS analysis system (5200, Tanon, Shanghai, China), the luminous bands of the target proteins were identified. ImageJ software was used for computational analysis. The grayscale values of the target protein were normalized to those of the internal reference protein. The control group was set as 1, and the other groups were further normalized relative to the control. Each WB experiment was performed using protein lysates from at least three biologically independent samples (n ≥ 3) and repeated independently to ensure reproducibility. The samples and antibodies were routinely stored at -20 °C (Table 1).

Table 1.

The detail information of primary antibodies

Target	Host	Companies	Cat.NO.	Dilution and application	Corresponding Figure
AMH	Rabbit	ZenBio, Chengdu, China	620,222	1:1000 for WB (1 µg/ml)	Fig. 2c, d
Bax	Rabbit	ZenBio, Chengdu, China	380,709	1:1000 for WB (1 µg/ml)	Fig. 3a, b
				1:200 for IHC (5 µg/ml)	Fig. 3d, e
Bcl2	Rabbit	ZenBio, Chengdu, China	381,702	1:1000 for WB (1 µg/ml)	Fig. 3a, c
Collagen I	Rabbit	ZenBio, Chengdu, China	501,352	1:1000 for WB (1 µg/ml)	Figs. 4d and e, 6a-h and 7l and m
				1:200 for IHC (5 µg/ml)	Figs. 4a and c and 7k
α-SMA	Rabbit	ZenBio, Chengdu, China	380,653	1:4000 for WB	Figs. 4d and f, 6a-h and 7l and m
				1:200 for IHC (5 µg/ml)	Figs. 4a and b and 7k
Smad2	Mouse	ZenBio, Chengdu, China	200,790	1:1000 for WB (1 µg/ml)	Figs. 5e and g, 6a-h and 7l and m
p-Smad2 (Ser250)	Rabbit	ZenBio, Chengdu, China	R26361	1:1000 for WB (1 µg/ml)	Figs. 5e and f, 6a-h and 7l and m
				1:200 for IHC (5 µg/ml)	Figs. 5a and b and 7k
Smad3	Rabbit	ZenBio, Chengdu, China	R25743	1:1000 for WB (1 µg/ml)	Figs. 5e and i, 6a-h and 7l and m
p-Smad3 (Ser423/425)	Rabbit	ZenBio, Chengdu, China	380,775	1:1000 for WB (1 µg/ml)	Figs. 5e and h, 6a-h and 7l and m
				1:200 for IHC (5 µg/ml)	Figs. 5a and c and 7k
TGF-β	Rabbit	Affinity, Changzhou, China	AF1027	1:1000 for WB (1 µg/ml)	Figs. 5e and j, 6c, d, g and h and 7l and m
				1:200 for IHC (5 µg/ml)	Figs. 5a and d and 7k
β-Actin	Mouse	ZenBio, Chengdu, China	380,624	1:5000 for WB (0.2 µg/ml)	Figs. 2g and 5g
p-H2A.X (Ser139)	Rabbit	ZenBio, Chengdu, China	381,558	1:200 for IHC (5 µg/ml)	Fig. 3d, f
GAPDH	Mouse	ZenBio, Chengdu, China	380,626	1:3000 for WB (0.3 µg/ml)	Figs. 2c, 3a, 4d, 6a, c, e and g and 7l
PCNA	Rabbit	Bioss, Beijing, China	bs-2007R	1:200 for IHC (5 µg/ml)	Fig. 7d, e
FSHR	Rabbit	Affinity, Changzhou, China	AF5242	1:1000 for WB (1 µg/ml)	Fig. 2g, h
LHR	Rabbit	Affinity, Changzhou, China	AF9104	1:1000 for WB (1 µg/ml)	Fig. 2g, i

qRT-PCR

Total RNA was isolated from ovarian tissue using an RNA extraction kit (Yeasen, 19221ES50). A total of 2.5 µg of RNA was used as the template for the reverse transcription procedure. The primers used are listed in Table 2. First-strand cDNA was synthesized with 5× Hifair^® One-Step RT SuperMix and gDNA Remover Mix (11142ES60, Yeasean) and was used as a template for real-time PCR. After reverse transcription, real-time quantitative PCR was carried out using a SYBR Green I Master (11201ES08, Yeasean) and the LightCycler 480 (Roche, Switzerland, Germany). Real-time quantitative PCR was carried out in a 20 µL reaction volume per well. The cycling protocol consisted of initial denaturation at 95 °C for 5 min, followed by 40 cycles of amplification (95 °C for 10 s, 55 °C for 20 s, and 72 °C for 20 s per cycle). Product specificity was verified by melting-curve analysis. Finally, the 2^−ΔΔCt (ΔCt = Ct _target - Ct _reference, ΔΔCt = ΔCt _sample – ΔCt _control, RQ = 2^−ΔΔCt) technique was used to analyze relative gene expression. The data were normalized to the expression of the housekeeping gene β-Actin. For qRT-PCR analysis, the samples represented independent biological replicates (n = 6). All primers and cDNA were stored at -20 °C before use, and repeated freeze-thaw cycles were avoided.

Table 2.

List of qRT-PCR primers

Gene	Forward primer (5’-3’)	Reverse primer (5’-3’)	product size (bp)	Corresponding Figure
Fshr	CCTTGCTCCTGGTCTCCTTG	CTCGGTCACCTTGCTATCTTG	113	Fig. 2e
Lhr	CGCCCGACTATCTCTCACCTA	GACAGATTGAGGAGGTTGTCAAA	150	Fig. 2f
Col1a2	GTAACTTCGTGCCTAGCAACA	CCTTTGTCAGAATACTGAGCAGC	230	Fig. 4g
α-SMA	GTCCCAGACATCAGGGAGTAA	TCGGATACTTCAGCGTCAGGA	102	Fig. 4h
Tgf-β1	CTCCCGTGGCTTCTAGTGC	GCCTTAGTTTGGACAGGATCTG	133	Fig. 5m
Smad2	ATGTCGTCCATCTTGCCATTC	AACCGTCCTGTTTTCTTTAGCTT	173	Fig. 5k
Smad3	CACGCAGAACGTGAACACC	GGCAGTAGATAACGTGAGGGA	101	Fig. 5l
β-Actin	GGAGATTACTGCCCTGGCTCCTA	GACTCATCGTACTCCTGCTTGCTG	150	Figs. 2e and f, 4g and h and 5k, l and m

Cell culture

The KGN cell line, which retains many functional characteristics of granulosa cells, is widely used as an in vitro model for studying ovarian dysfunction and related signaling pathways [51–53]. KGN cells were cultured in DMEM/F-12 medium containing 10% fetal bovine serum and 1% penicillin/streptomycin. The cell culture medium was changed every 48 h and the cells were kept at 37 ℃ and 5% CO2 in a humid environment. Cisplatin, I3C and SB-431,542 were dissolved in DMSO and diluted in DMEM/F-12. KGN cells were cultured in DMEM/F-12 supplemented with 0.1% DMSO or cisplatin (200 ng/ml), I3C (20 µg/ml), SB-431,542 (10 µM) I3C+cisplatin, or SB-431,542 + cisplatin for 24 h. Each in vitro experiment was performed with a minimum of three biologically independent replicates (n ≥ 3), defined as cells cultured and treated in separate passages.

Statistical analysis

The experimental data were analyzed statistically with GraphPad Prism 9.0. The normality of the data distribution was assessed using the Shapiro-Wilk test. Data conforming to a normal distribution and with confirmed homogeneity of variance were included in the subsequent parametric analysis. For each experiment, a minimum of three biologically independent replicates were analyzed. Samples from two groups were compared via unpaired t-tests, whereas samples from more than two groups were compared via one-way ANOVA. Tukey’s post hoc test was used after ANOVA and the data are reported as the mean ± SEM. Statistical significance was defined as a P value less than 0.05.

Results

I3C treatment restored ovarian function in a mouse model of ovarian injury

To evaluate the effect of I3C treatment on a mouse model of cisplatin-induced ovarian injury, we first determined the body weight and ovarian weight of each group and calculated the ovarian index. Our results revealed that the body weight, ovarian weight and ovarian index (ovarian weight/body weight, mg/g) were considerably lower in the cisplatin-treated group than in the control group, whereas these indices were greater in the cisplatin- and I3C cotreated group (Fig. 1a and d). By analyzing the estrous cycle, we found that compared with the control group and the Cis+I3C group, the mice in the Cis group presented irregular estrous cycles with a shorter estrous phase and a longer diestrous phase (Fig. 1e-g). Follicle counting revealed that the number of primordial follicles was significantly lower in the mice treated with cisplatin than in the control group, whereas the number of primordial follicles was greater in the mice cotreated with I3C and cisplatin. As shown in Fig. 2a-b, the percentage of primary follicles in cisplatin group was significantly greater than that in the control group, indicating that cisplatin treatment promoted the transition from primordial follicles to primary follicles. However, I3C treatment can inhibit the overactivation of primordial follicles to maintain the primordial follicle reserve. Numerous studies have demonstrated that anti-Müllerian hormone (AMH) inhibits primordial follicle activation, and our results revealed that I3C reversed the cisplatin-induced decrease in AMH protein levels (Fig. 2c and d). We also found that cisplatin significantly increased the mRNA expression levels of Fshr and Lhr, but I3C treatment reversed these changes (Fig. 2e and f). The results were confirmed at the protein level by WB (Fig. 2g-i). In conclusion, these findings indicated that I3C administration restored ovarian function in chemotherapy-treated mice.

Fig. 1.

Assessment of ovarian index and analysis of vaginal smears. a Representative images of the general appearance of each group of ovaries. n = 6 biologically independent replicates. b-c Body weight (b), ovarian weight (c), and ovarian index (ovarian weight/ body weight) (d) of the three groups of mice. n = 6 biologically independent replicates. e Representative H&E staining images of mouse vaginal smear at different stages of the estrous cycle. n = 6 biologically independent replicates. Scale bars, 50 µm. f Relative proportion of each estrous cycle in the four groups of mice. P, proestrus; E, estrus; M, metestrus; D, diestrus. n = 6 biologically independent replicates. g Typical changes in estrous cycle in the three groups of mice. n = 6 biologically independent replicates. Ctr, control; Cis, cisplatin; Cis+I3C, cisplatin + I3C. The data are presented as the mean ± SEM, *P < 0.05, **P < 0.01, ***P < 0.001. ****P < 0.0001. Statistical significance was determined by one-way analysis of variance (ANOVA) followed by the Tukey post hoc test

Fig. 2.

Follicle counting and detection of biomarkers of follicular development. a Representative images of H&E-stained ovarian morphology. n = 5 biologically independent replicates. Scale bars, 100 μm. b The numbers of primordial follicles (PMFs), primary follicles (PFs), secondary follicles (SFs) and antral follicles (AFs) per ovary in each treatment group were shown in the columns. n = 5 biologically independent replicates. c Western blot for AMH expression in each group of ovarian tissue. Representative blots from one of four independent experiments are shown. n = 4 biologically independent replicates. GAPDH was used as a loading control. d Quantitative analysis of AMH protein expression using Image J software. n = 4 biologically independent replicates. e-f Relative levels of Fshr (e) and Lhr mRNA (f) in ovarian tissues of each group. n = 6 biologically independent replicates. g-i The WB results (g) and quantification of FSHR (h) and LHR (i). n = 3 biologically independent replicates. For the bar graphs in (b, d-f, h-i), the data are presented as the mean ± SEM. Ctr, control; Cis, cisplatin; Cis+I3C, cisplatin + I3C. *P < 0.05, **P < 0.01, ***P < 0.001. ****P < 0.0001. Statistical significance was determined by one-way analysis of variance (ANOVA) followed by the Tukey post hoc test

I3C suppressed cisplatin-induced apoptosis in ovarian tissue

The impact of I3C on cisplatin-induced apoptosis was subsequently examined in mouse ovarian tissues. The main function of Bcl-2 is to protect cells from apoptosis by inhibiting the activity of pro-apoptotic factors such as Bax [54]. The ratio of Bax/Bcl-2 is often used to determine whether the level of apoptosis increases or decreases [55]. Our results revealed that cisplatin treatment increased the expression level of Bax and decreased the Bax/Bcl2 ratio. In contrast, I3C therapy suppressed the increase in the Bax level and decrease in the Bax/Bcl2 ratio (Fig. 3a-c). The results of IHC staining also confirmed that Bax levels were significantly lower in the cisplatin+I3C group than in the cisplatin group, and that Bax-positivity was primarily concentrated in the granulosa cells of growing follicles (Fig. 3d-f). Compared with that in the cisplatin group, the expression level of γH2AX, another important regulator of the cellular response to DNA damage, was lower in the I3C-treated group (Fig. 3d-f). TUNEL assays revealed that the number of TUNEL-positive cells, particularly granulosa cells, was significantly greater in the cisplatin group than in the control group and was substantially decreased by I3C treatment (Fig. 3g and h). In conclusion, I3C treatment reduced cisplatin-induced apoptosis in mouse ovarian tissue, particularly in granulosa cells.

Fig. 3.

The apoptosis of granulosa cells caused by cisplatin was inhibited after I3C treatment. a Bax and Bcl-2 protein expression levels were measured by western blotting in the ovarian tissues of each group. n = 4 biologically independent replicates. GAPDH was used as a loading control. b-c Quantitative analysis of the expression levels of Bax (b) and Bax/Bcl2 (c). d Representative IHC results for Bax and γH2AX in the ovarian tissues of each group. n = 3 biologically independent replicates. Scale bar, 100 μm. e-f Quantification of the area positive for Bax (e) and γH2AX (f). n = 3 biologically independent replicates. g Apoptotic cells in ovarian tissue were detected using a TUNEL assay. Green represents apoptotic signals. The nuclei were stained with Hoechst and fluoresced blue. n = 3 biologically independent replicates. Scale bars, 200 μm. h Quantitative analysis of the fluorescence intensity of apoptotic cells. n = 3 biologically independent replicates. For the bar graphs in (b-c, e, f, h), the data are presented as the mean ± SEM. Ctr, control; Cis, cisplatin; Cis+I3C, cisplatin + I3C. *P < 0.05, **P < 0.01, ***P < 0.001. Statistical significance was determined by one-way analysis of variance (ANOVA) followed by the Tukey post hoc test

I3C treatment inhibited the deposition of α-SMA and collagen I in the ovaries of mice undergoing chemotherapy

To further investigate the protective effect of I3C on the ovaries of mice subjected to chemotherapy, we detected the fibrosis-related markers, α-SMA and collagen I via IHC staining, and the results revealed that cells expressing these proteins were located mainly in the ovarian mesenchyme. Cisplatin injection alone significantly increased the levels of α-SMA and collagen I, whereas the combined injection of cisplatin and I3C significantly decreased the levels of α-SMA and collagen I (Fig. 4a-c). Furthermore, the WB and qRT-PCR results confirmed these results (Fig. 4d-h). These findings suggest that I3C can reduce cisplatin-induced ovarian fibrosis.

Fig. 4.

Staining and detection of markers of fibrosis. a The immunohistochemistry results of α-SMA and collagen I from ovarian tissues in each group. n = 3 biologically independent replicates. Scale bars, 100 μm. b-c Quantification of areas positive for α-SMA (b) and collagen I (c). n = 3 biologically independent replicates. d Detection of collagen I and α-SMA by western blotting in each group of ovarian tissues. n = 4 biologically independent replicates. e-f Quantitative analysis of collagen I (e) and α-SMA (f) protein expression. n = 4 biologically independent replicates. g-h Relative levels of Col1a2 (g) and α-SMA mRNA (h) in ovarian tissues of each group. n = 6 biologically independent replicates. For bar graphs in (b-c, e-h) data are presented as mean ± SEM. Ctr, control; Cis, cisplatin; Cis+I3C, cisplatin + I3C. *P < 0.05, **P < 0.01, ***P < 0.001. ****P < 0.0001. Statistical significance was determined by one-way analysis of variance (ANOVA) followed by the Tukey post hoc test

I3C alleviates cisplatin-induced ovarian fibrosis through the TGF-β1/Smad signaling pathway

Compared with those in the control group, the expression of TGF-β1, p-Smad2, and p-Smad3 in the ovarian tissues in the cisplatin group was higher according to the IHC staining results, however, the expression levels in the cisplatin+I3C group were dramatically lower than those in the cisplatin alone group (Fig. 5a-d). Notably, granulosa cells were the primary cells expressing TGF-β1, p-Smad2 and p-Smad3 positive cells. The WB results revealed that the expression levels of Smad2 and Smad3, as well as their phosphorylated forms were lower in the cisplatin+I3C group than in the cisplatin alone group (Fig. 5e-j). We also confirmed the mRNA levels of TGF-β1, Smad2 and Smad3. The results revealed that the mRNA levels of these genes were significantly lower in the cisplatin+I3C group than in the cisplatin group (Fig. 5k-m). These results suggest that I3C can downregulate the activity of the TGF-β1/Smad pathway to attenuate cisplatin-induced ovarian fibrosis.

Fig. 5.

TGF-β/Smad pathway was downregulated by I3C. a The immunohistochemistry results of p-Smad2, p-Smad3 and TGF-β1 in ovarian tissues of each group. n = 3 biologically independent replicates. Scale bars, 100 μm. b-d Quantitative analysis of p-Smad2 (b), p-Smad3 (c) and TGF-β1 (d). e Protein level of p-Smad2, Smad2, p-Smad3, Smad3, and TGF-β1 in each group of ovarian tissues. n ≥ 3 biologically independent replicates. GAPDH was used as the loading control. f-j Quantitative analysis of p-Smad2, Smad2, p-Smad3, Smad3, and TGF-β1 protein expression levels. n ≥ 3 biologically independent replicates. k-m The RNA expression of TGF-β1, Smad2 and Smad3 in each group was determined by qRT‒PCR analysis. GAPDH was used as an internal control. n = 6 biologically independent replicates. For bar graphs in (b-d, f-m) data are presented as mean ± SEM. Ctr, control; Cis, cisplatin; Cis+I3C, cisplatin + I3C. *P < 0.05, **P < 0.01, ***P < 0.001. Statistical significance was determined by one-way analysis of variance (ANOVA) followed by the Tukey post hoc test

To further demonstrate that I3C inhibits fibrosis through the TGF-β/Smad pathway. We treated KGN cells with varying concentrations of TGF-β. The results revealed a significant increase in the phosphorylation of smad2 and smad3, implying that the TGFB/Smad pathway was activated (Fig. 6a and b). Moreover, α-SMA and collagen I expressions significantly increased in a dose-dependent manner (Fig. 6a and b). These results suggest that the TGF-β/Smad pathway is involved in the regulation of α-SMA and Collagen I expression. We also treated KGN cells with different concentrations of cisplatin and observed that Cis increased the levels of TGF-β, p-smad2 and p-smad3 and contents of α-SMA and collagen I (Fig. 6c and d). When the TGF-β receptor inhibitor SB-431,542 was used to block TGF-β/Smad pathway activity, Cis-mediated TGF-β activation, smad2 and smad3 phosphorylation, and α-SMA and collagen I elevation were blocked (Fig. 6e and f). These results indicate that Cis can induce fibrosis through the TGF-β/Smad pathway. Similar to SB-431,542, I3C also inhibited the activation of the TGF-β/Smad pathway and the expression of α-SMA and Collagen I (Fig. 6g and h). Taken together, our results suggest that I3C treatment alleviates CIS-induced fibrosis by inhibiting the activity of the TGF-β/Smad pathway.

Fig. 6.

I3C inhibited cisplatin-induced TGF-beta mediated fibrosis in KGN cells. After 24 h of TGF-β1 (0–3 ng/mL) treatment, the protein levels of α-SMA, collagen I, p-Smad2, Smad2, p-Smad3, and Smad3 were assessed by western blotting (a) and quantified (b). n ≥ 3 biologically independent replicates. GAPDH was used as the loading control. α-SMA, collagen I, p-Smad2, Smad2, p-Smad3, Smad3, and TGF-β1 protein expression levels in KGN cells exposed to cisplatin (0-200 ng/ml) for 24 h (c) and their quantitative analysis (d). n ≥ 3 biologically independent replicates. After KGN cells were cotreated with SB-431,542 (10 µM) and cisplatin (200 ng/ml) for 24 h, the protein expression levels of α-SMA, collagen I, p-Smad2, smad2, p-Smad3, and Smad3 (e) were determined, and their expression was quantified (f). n = 3 biologically independent replicates. The protein expression levels of α-SMA, collagen I, p-Smad2, smad2, p-Smad3, and Smad3 (g) and their quantitative analysis (h) were measured after KGN cells were cotreated with I3C (20 µg/ml) and cisplatin (200 ng/ml) for 24 h. n = 3 biologically independent replicates. For bar graphs in (b, d, f, h), the data are presented as the mean ± SEM. Ctr, control; Cis, cisplatin; Cis+I3C, cisplatin + I3C. *P < 0.05, **P < 0.01, ***P < 0.001. Statistical significance was determined by one-way analysis of variance (ANOVA) followed by the Tukey post hoc test

I3C treatment can suppress cervical carcinoma growth and protect ovaries from cisplatin-mediated damage in a tumor-bearing model

As shown above, I3C treatment can alleviate the ovarian damage induced by cisplatin. To verify whether our results are also applicable to tumor-bearing mice, we established a tumor-bearing model in nude mice. Our results showed that I3C treatment suppressed cervical tumor growth in vivo and enhanced the antitumor activity of cisplatin (Fig. 7a-e). We further analyzed the protective effect of I3C combined with cisplatin treatment on ovarian function. Consistent with previous findings, I3C treatment reversed the Cis-induced decrease in the ovarian index (Fig. 7f-h), maintained the stability of the primordial follicular pool (Fig. 7i), and inhibited the apoptosis of follicular granulosa cells (Fig. 7j). We also validated our findings concerning ovarian fibrosis and the TGF-β/Smad pathway in nude mouse ovarian tissue. Similar to the results in the ovarian injury model, I3C treatment inhibited Cis-induced α-SMA and collagen I overexpression, and TGF-β/Smad pathway activation, as shown by IHC staining (Fig. 7k). IHC staining results were confirmed by WB (Fig. 7l and m). These results indicate that I3C cotreatment can protect ovaries from damage caused by chemotherapy while simultaneously suppressing tumor growth.

Fig. 7.

I3C exhibits antitumor and ovarian protective capacity in tumor bearing mice. Tumor growth curves (a), tumor appearance (b) and tumor weight (c) of BALB/c nude mice subcutaneously injected with HeLa cells in the indicated groups. n = 6 biologically independent replicates. The IHC results of PCNA in various groups of tumor tissues (d) and quantitative analysis of PCNA expression (e). n = 3 biologically independent replicates. Scale bars, 100 μm. f Representative images of H&E-stained ovarian morphology. Scale bars, 200 μm. n = 3 biologically independent replicates. g Representative images of general appearance of the ovaries from each group. n = 6 biologically independent replicates. h Ovarian weight of each group. n = 5 biologically independent replicates. i Percentage of PMFs, PFs, SFs and AFs to total follicles in each treatment group. n = 4 biologically independent replicates. j Apoptotic cells in ovarian tissue were detected using a TUNEL assay. n = 3 biologically independent replicates. Scale bars, 200 μm. k The IHC staining of α-SMA, collagen I, p-Smad2, p-Smad3 and TGF-β1 in ovarian tissues of each group. n = 3 biologically independent replicates. Scale bars, 200 μm. l Protein levels of collagen I, α-SMA, p-Smad2, Smad2, p-Smad3, Smad3, and TGF-β1 in each group of ovarian tissues and (m) their quantitative analysis. n = 3 biologically independent replicates. For bar graphs in (a, c, e, h, i, m) data are presented as mean ± SEM. Ctr, control; Cis, cisplatin; Cis+I3C, cisplatin + I3C. *P < 0.05, **P < 0.01, ***P < 0.001. Statistical significance was determined by one-way analysis of variance (ANOVA) followed by the Tukey post hoc test

Discussion

Owing to the susceptibility of ovarian tissue to chemotherapy, it is necessary to consider how to effectively maintain and preserve fertility throughout a patient’s oncological treatment. The identification of substances that can protect ovarian tissues from chemotherapy-induced damage is therefore urgently needed. I3C has been demonstrated in numerous trials to reduce injury and prevent disease in a number of organs. I3C inhibits the proliferation and neointima formation of cultured vascular smooth muscle cells in a carotid artery injury model via the Akt/GSK3β pathway to prevent vascular value-added disease [56]. However, whether I3C can alleviate ovarian damage caused by chemotherapy and protect fertility has not been previously reported. In this study, we discovered that combining I3C with cisplatin could alleviate cisplatin-induced ovarian damage. We also investigated the mechanism by which this protection occurs.

The TGF-β1/Smad pathway is currently recognized as the primary pathway that induces fibrosis [25]. I3C can regulate the levels of TGF-β1, α-SMA and collagen I [57, 58]; therefore, we explored this pathway in ovarian tissues to determine whether I3C treatment reduces α-SMA or collagen I levels by blocking the TGF-beta/Smad signaling pathway in chemotherapy-treated mice. Excessive deposition of the extracellular matrix (ECM) is a hallmark of ovarian fibrosis, and granulosa cells play a critical role in ECM accumulation [51, 52, 59]. Elevated expression of α-SMA in granulosa cells contributes to collagen production and fibrotic progression, and its inhibition may alleviate ovarian fibrosis [52, 59]. Previous studies have demonstrated that fibrosis in PCOS is associated with activation of the TGF-β/Smad signaling pathway in granulosa cells [59]. Consistently, our findings revealed significant activation of the TGF-β/Smad pathway in the ovarian granulosa cells of mice with cisplatin-induced POF. Furthermore, treatment of both mouse ovaries and KGN cells with I3C effectively suppressed the expression of key components of this pathway, including TGF-β/Smad and downstream effectors such as α-SMA and collagen. These results indicate that I3C exerts antifibrotic effects in the ovary by modulating the TGF-β/Smad signaling cascade.

The commonly recognized safe oral dose for humans (200–400 mg/day) translates to an approximate mouse equivalent dose range of 35–70 mg/kg based on body surface area conversion [43, 45]. The 30 mg/kg dose used in our study is close to the lower end of this range. Numerous preclinical studies have demonstrated that I3C at doses ranging from 10 to 50 mg/kg clearly produces pharmacological effects in various mouse models [41, 43–45]. Pharmacokinetic data further confirm that intraperitoneal injection of 30 mg/kg I3C results in plasma concentrations of its active metabolite, DIM, that reach effective therapeutic levels [45]. Importantly, DIM is effectively cleared within 24 h, balancing efficacy with safety [42].

We established an ovarian injury model via the intraperitoneal injection of cisplatin. With this model, we observed that I3C treatment can restore the ovarian index and regulate the estrous cycle in mice (Fig. 1). The ovarian reserve is not restorative and that women develop primordial follicular reserves during fetal life [60]. To maintain the balance of their reproductive lifespan, females are physiologically conditioned to rationalize the use of the follicular reserve through the orderly regulation of primordial follicular activation [61]. Numerous investigations have demonstrated that cisplatin treatment causes the loss or overactivation of primordial follicles, which decreases the ovarian reserve [62–64]. Both the number of primordial follicles and the AMH level are indicators of ovarian reserve [48, 65]. Consistent with previous results, we found that cisplatin treatment reduced the ovarian reserve, manifested as a decreased percentage of primordial follicles and decreased AMH levels. In addition, the activation of primordial follicles increased after cisplatin treatment, manifested as an elevated percentage of primary follicles and increased levels of FSHR and LHR (Fig. 2). It has been reported that FSHR and LHR are involved in the regulation of follicular formation [66], and their expression levels in primary follicles are significantly higher than those in primordial follicles [67]. The treatment with I3C inhibited follicular activation and preserved follicular reserve (Fig. 2). This might be related to the fact that I3C can inhibit the PI3K-AKT pathway [38, 68], which is a key pathway for follicular activation [8, 62]. Inhibiting this pathway can preserve follicular reserves [8]. In addition, the occurrence of apoptosis is also one of the key mechanisms through which chemotherapy causes ovarian damage. The apoptosis of growing follicles accelerates the activation of primordial follicles [69]. I3C has been reported to inhibit apoptosis and alleviate tissue damage [70, 71] .

Although we have gained a better understanding of the mechanisms underlying chemotherapy-induced ovarian damage in women of childbearing age in recent years, we still do not know which mechanisms are the most important in this process. Notably, although the vast majority of protective agents currently in use focus solely on follicular effects, the stromal environment of the ovary also contributes to follicular health. Ovarian cortical fibrosis has been shown to be an important additional mechanism of chemotherapy-induced ovarian functional impairment [19]. The most common events in fibrotic disease are EMT and ECM synthesis, with type I collagen being the most abundant component of the ECM and widely expressed in the ovary [72, 73]. Our results indicated that I3C reversed the cisplatin-induced increase in Collagen I and the EMT marker, α-SMA (Fig. 4). In other words, I3C slowed the progression of cisplatin-induced ovarian fibrosis. The TGF-β1/Smad signaling pathway is important in ovarian fibrosis and has been extensively researched, particularly in polycystic ovary syndrome [53, 59, 74]. Interestingly, consistent with previous findings, we discovered that TGF-β1 and p-Smad2/3 were expressed in the granulosa cells of mouse ovaries. We established that the ability of I3C treatment to decrease ovarian fibrosis caused by cisplatin relies on the suppression of the TGF-β1/Smad signaling pathway. Notably, an I3C-only treatment group was not included in this study. Although our previous findings indicate that I3C does not cause overt ovarian toxicity in young mice [38], future studies incorporating an I3C-only group would help to further delineate its baseline effects on ovarian homeostasis.

Previous studies on protecting ovaries from chemotherapy damage have mainly established ovarian damage models in normal mice and have not evaluated the effects of protective agents on tumors or chemotherapy [8, 11–14]. In this study, we investigated the antitumor effect of I3C and its influence on the efficacy of chemotherapy using a tumor-bearing nude mouse model. These results indicated that I3C could inhibit tumor growth, and its combined use with Cis enhanced the antitumor effect of cisplatin. Several studies have confirmed the antitumor activity of I3C. For example, Lee et al. first reported that I3C treatment inhibited the reactivation of Pten by WWP1, leading to effective inhibition of tumorigenesis driven by the PI3K-AKT pathway [68]. In our previous studies, I3C was shown to suppress the AKT pathway in ovarian tissue [38]. By suppressing the EMT process, I3C also reduced the migration of breast cancer cells [75]. In this study, we showed that I3C treatment inhibited cervical tumor growth in vivo. These findings establish the groundwork for additional research into the use of I3C to protect ovarian function.

This study has several limitations. The lack of hormonal profiling and direct measurement of drug concentrations in ovarian tissue prevents a comprehensive evaluation of the impact of the treatment on endocrine function or direct confirmation of its pharmacokinetics at the target site. Additionally, the observation period was relatively short, which limits the assessment of long-term efficacy. Moreover, HeLa xenograft models are highly proliferative, genetically unstable, and distinct from primary tumors, thereby constraining the clinical relevance of the findings. Although the literature suggests that active metabolites of I3C can be distributed to peripheral organs following intraperitoneal injection and that the dose-dependent improvements observed at the physiological and molecular levels indirectly support drug activity in the ovaries, the specific bioavailability and tissue exposure levels of I3C remain unclear [42, 43]. Future studies should incorporate hormonal monitoring, extend the observation period, employ more clinically relevant models, and apply direct quantification techniques such as LC‑MS/MS to further validate and extend the findings of this research.

Conclusion

In summary, we provide convincing evidence that I3C inhibits the activity of the TGF-β1/Smad2/3 signaling pathway, reduces ovarian fibrosis, protects against cisplatin-induced ovarian damage, and blocks the growth of cervical tumors. Therefore, I3C could be a promising candidate drug for preserving fertility in female cancer patients.

Abbreviations

I3C

Indole-3-carbinol

POF

Premature ovarian failure

Ctr

Control

Cis

Cisplatin

ECM

Extracellular matrix

H&E

Hematoxylin and eosin

RIPA

Radio-immunoprecipitation assay

HRP

Horseradish peroxidase

AMH

Anti-mullerian hormone

PCNA

Proliferating cell nuclear antigen

IHC

Immunohistochemistry

IF

Immunofluorescence

WB

Western blot

qRT-PCR

Quantitative real-time PCR

PMF_S

Primordial follicles

PF_S

Primary follicles

SF_S

Secondary follicles

AF_S

Antral follicles

DMEM

Dulbecco’s modified eagle medium

DAB

3,3’-diaminobenzidine tetrahydrochloride

P

Proestrus

E

Estrus

M

Metestrus

D

Diestrus

PBS

Phosphate-buffered saline

Authors’ contributions

F.Y. Zhu: Conceptualization; Investigation; methodology; writing – review and editing. F.F. Li: Investigation; Data curation; methodology; funding acquisition; writing – original draft. R.X. Zhang: Investigation; formal analysis; methodology. Z.Y. He: Investigation; Resources. J.Y. Li: Investigation; software;. N. Zhang: Investigation. H.X. Chen: Investigation. J.Q. Chen: Investigation. L.H. Cheng: Conceptualization; supervision; writing – review and editing. F. Zhong: Conceptualization; funding acquisition; supervision.

Funding

This work is financially supported by Natural Science Research Project of Anhui Educational Committee (2023AH050675); Research Fund of Anhui Institute of Translational Medicine (2023zhyx-C98); Scientific Research Project of Fuyang City Health Commission (FYZC2024-061).

Data availability

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Declarations

Competing interests

The authors declare no competing interests.