Immunostimulant activity of Centella asiatica (ECa 233) on RAW 264.7 macrophages

Abstract

Background

The innate immune system serves as the body’s first line of defense, with macrophages playing a central role in pathogen recognition and elimination. Although Centella asiatica has long been used in traditional medicine, its immunostimulatory effects are not yet fully elucidated. This study investigated the immunostimulant activity of a standardized C. asiatica extract (ECa 233) on RAW 264.7 macrophages.

Methods

ECa 233 was first characterized using FT-IR and NMR spectroscopy. FT-IR identified key functional groups, while NMR provided detailed insights into molecular structure, together ensuring precise extract characterization for subsequent pharmacological evaluation. RAW 264.7 cells were treated with ECa 233 at concentrations of 1.5625–200 μg/mL. The production of nitric oxide (NO), hydrogen peroxide (H₂O₂), and reactive oxygen species (ROS) was assessed, along with macrophage functional activity using zymosan-NBT reduction and neutral red uptake assays. Inflammatory gene expression was analyzed via Reverse transcriptase polymerase chain reaction (RT-PCR).

Results

ECa 233 significantly increased NO, H₂O₂, and ROS production without compromising cell viability and enhanced macrophage functional activity. RT-PCR results revealed upregulation of pro-inflammatory cytokines (TNF-α, IL-1β, IL-6), regulatory cytokines (TGF-β, IL-10, IL-12), surface markers (CXCR-1, CXCR-2), and inflammatory mediators (iNOS, COX-2).

Conclusion

These findings suggest that ECa 233 activates macrophages and promotes immune responses, supporting its potential as an immunostimulant. Further in vivo studies are warranted to confirm its efficacy and therapeutic relevance.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12906-026-05255-z.

Introduction

The immune system protects the body by eliminating foreign pathogens such as bacteria and viruses. Innate immunity serves as the first line of defense, while adaptive immunity employs highly specific mechanisms to recognize and eliminate foreign substances, including antigens. Both branches cooperate to stimulate the production and proliferation of immune cells, such as T and B lymphocytes [1, 2]. The component of the immune system that responds to early stimuli, such as infections and pathological conditions, is known as the innate immune system. Among its key cellular components are macrophages, which can recognize a wide range of invading microbes and foreign substances. As crucial effectors of the innate immune response, macrophages phagocytose these targets and degrade them using lysosomal enzymes such as hydrolases, as well as through the generation of reactive oxygen species (ROS) and nitrogen species, including nitric oxide (NO) produced via inducible nitric oxide synthase (iNOS) [3]. Additionally, macrophages function as antigen-presenting cells by expressing major histocompatibility complex (MHC) class II molecules, thereby activating CD4⁺ T cells and promoting their proliferation. Upon exposure to inflammatory stimuli, macrophages become activated and secrete various pro-inflammatory cytokines, including tumor necrosis factor-alpha (TNF-α), interleukins (IL-1, IL-6, IL-8, and IL-12) [4], along with leukotrienes, prostaglandins, and chemokines. These mediators enhance vascular permeability and recruit leukocytes to sites of inflammation. Systemically, they contribute to fever and stimulate the liver to produce acute-phase proteins [5].

Macrophages can be broadly classified into two subtypes: classically activated (M1) and alternatively activated (M2) [6]. The M1 phenotype is typically induced by stimulation with lipopolysaccharide (LPS) or cytokines such as interferon-gamma (IFN-γ) and TNF-α. M1 macrophages express surface markers such as TLR-2, TLR-4, CD80, CD86, iNOS, and MHC class II and are associated with strong antimicrobial and tumoricidal activity. They contribute to inflammation by producing pro-inflammatory cytokines, including TNF-α, IL-1, and IL-6, as well as reactive oxygen and nitrogen species [6, 7]. M1 macrophages also release IL-12, which promotes the activation of other immune cells. Conversely, the M2 phenotype arises in response to cytokines such as IL-4, IL-13, IL-10, IL-33, and transforming growth factor-beta (TGF-β), although only IL-4 and IL-13 can directly stimulate M2 macrophage polarization. M2 macrophages may also be influenced by IL-33 and IL-25 during differentiation and are characterized by the expression of markers such as the mannose receptor (CD206), CD163, CD209, FIZZ1, and Ym1/2 [8]. These cells are involved in the production of anti-inflammatory cytokines such as IL-10 and TGF-β, which suppress immune responses and inhibit T cell proliferation. Furthermore, M2 macrophages play key roles in tissue repair, resolution of inflammation, regulation of allergic responses, defense against parasites, tumor angiogenesis, and immunomodulation. They facilitate the clearance of apoptotic cells and help suppress excessive production of pro-inflammatory cytokines [9, 10].

Medicinal herbs are widely used to treat various health conditions, including immune deficiencies and cancer. C. asiatica, a commonly cultivated medicinal plant, has attracted considerable scientific interest. Previous studies have explored its pharmacological properties, such as promoting wound healing, enhancing memory and learning, and reducing anxiety-related gastric ulcers [11]. The standardized extract of C. asiatica, known as ECa 233, contains madecassoside and asiaticoside in a ratio of 1.5 ± 0.5:1 and exhibits several pharmacologically active components. Reported pharmacological activities of ECa 233 include anti-inflammatory [12–15], neuroprotective and memory-enhancing [16], antinociceptive [17], and anticancer effects [18]. A phase I clinical trial assessed the pharmacokinetics, safety, and tolerability of ECa 233 in both healthy human subjects and experimental animals [19, 20], supporting its potential as a therapeutic agent. Although multiple studies have demonstrated that ECa 233 can modulate immune responses through its anti-inflammatory activity [12–15], its direct immunostimulatory effects, particularly on macrophages, have not been fully characterized. While prior research has examined the immunomodulatory effects of ECa 233 on regulatory T cells [21], limited data are available regarding its influence on innate immune cells. Therefore, this study aimed to investigate the immunostimulatory effects of ECa 233 on RAW 264.7 macrophages. We hypothesized that ECa 233 enhances macrophage function by stimulating pro-inflammatory cytokine expression and increasing macrophage functional activity.

Materials and methods

Chemicals and equipments

The following reagents and equipments were used in this study: Dulbecco’s Modified Eagle’s Medium (DMEM) (Hyclone, USA), Heat-inactivated fetal bovine serum (FBS, Hyclone, USA), Penicillin–streptomycin (Hyclone, USA), 0.4% Trypan blue dye (Sigma, USA), Griess reagent (TFS Cell & Protein Cons, USA), Levamisole (MedChemExpress, USA), Resazurin sodium chloride (Sigma, USA), Neutral red (TFS Cell & Protein Cons, USA), DCFDA (Sigma, USA), Zymosan A from Saccharomyces cerevisiae (Sigma, USA), NBT (MedChemExpress, USA), GF-1 Total RNA Extraction Kit (Vivantis, Malaysia), Diethyl pyrocarbonate (DEPC, Molekula, UK), ImProm-II™ Reverse Transcription Kit (Promega, USA), Taq polymerase (Vivantis, Malaysia), ViSafe Green Gel Stain (Vivantis, Malaysia), Agarose (molecular biology grade) (Vivantis, Malaysia), 10 × Tris–Borate-EDTA buffer (Vivantis, Malaysia), 6 × loading dye with xylene cyanol (Vivantis, Malaysia), Hi-Gel Run 0608 (HiMedia, India), Electrophoresis power supply (HiMedia, India), and Hi-Gel Caster (HiMedia, India).

Test compound

The ECa 233 extract was obtained from C. asiatica grown in Ayutthaya Province, Thailand. The standardized ECa 233 extract was prepared using a patent-pending process as previously described by Saifah et al. (2009) [22], which produces a colorless mixture of madecassoside and asiaticoside from C. asiatica. The extract was quantified and standardized by high-performance liquid chromatography (HPLC) and liquid chromatography-tandem mass spectrometry (LC–MS/MS), confirming the content of 46.3% madecassoside and 41.6% asiaticoside, as certified by Siam Herbal Innovation Ltd., Thailand. The standardized extract of C. asiatica (ECa 233) used in this study was kindly provided by Associate Professor Dr. Mayuree Tantisira, Division of Pharmacology and Biopharmaceutical Sciences, Faculty of Pharmaceutical Sciences, Burapha University, Thailand. A freeze-dried powder of ECa 233 was dissolved in DMSO to prepare a stock solution at a concentration of 100 mg/mL. Working solutions in the range of 1.5625–200 µg/mL were subsequently prepared using incomplete DMEM immediately before use Fig. 1.

Fig. 1.

Schematic diagram of the experimental design used in this research

FT-IR

The ECa 233 extract was vacuum-dried to obtain a fine powder. The dried sample was mixed with potassium bromide (KBr) at a ratio of 1:100 and pressed into a thin pellet using a hydraulic press. The pellet was placed in a liquid cell with KBr windows for analysis. FT-IR spectra were recorded using a Fourier Transform Infrared Spectrometer (Nicolet 6700, Thermo Electron Corporation, Waltham, MA, USA). Spectral data were collected over the range of 4000–400 cm⁻¹ with a resolution of 4 cm⁻¹, and the final spectrum was obtained by averaging 32 scans.

NMR spectroscopy

For ¹H-NMR and ¹³C-NMR analysis, 10 mg of ECa 233 was dissolved in DMSO-d₆. NMR spectra were acquired using a 400 MHz NMR spectrometer (AVANCE III HD, Bruker, Rheinstetten, Germany). Key peaks were assigned to corresponding functional groups, and the spectral data were compared with previously reported values to confirm the structural integrity and composition of ECa 233.

Cell culture

RAW 264.7 macrophages were obtained from the American Type Culture Collection (ATCC® TIB-71™, Lot No. 70046149). Cells were cultured in T-75 flasks containing DMEM supplemented with 10% FBS and 1% penicillin–streptomycin. Cultures were maintained at 37 °C in a humidified incubator with 5% CO₂ and 95% humidity (Shel Lab, USA). Cells were subcultured every 3–4 days. Before each assay, cell viability was assessed using 0.4% trypan blue exclusion, with viability consistently in the range of 90%–95%.

NO quantification using Griess reagent

The immunostimulant activity of ECa 233 was assessed by quantifying nitrite levels in the culture supernatant of RAW 264.7 macrophages, as previously described [23]. In this assay, sulfanilamide reacts with nitrite ions in an acidic solution to form a diazonium salt, which subsequently couples with N-(1-naphthyl) ethylenediamine dihydrochloride to form a violet-red azo dye. The intensity of the color, measured at 540 nm, reflects nitrite concentration. RAW 264.7 macrophages were seeded into 96-well plates at a density of 6 × 10⁴ cells/well and incubated at 37 °C in a humidified atmosphere containing 5% CO₂ for 24 h. Cells were then treated with ECa 233 at concentrations of 1.5625, 3.125, 6.25, 12.5, 25, 50, 100, and 200 µg/mL. Untreated cells served as the negative control. After an additional 24-h incubation under the same conditions, 50 µL of the culture supernatant was mixed with 50 µL of Griess reagent in a fresh 96-well plate and incubated at room temperature for 10 min. Absorbance was measured at 540 nm using a microplate reader (FLUOstar Omega, BMG Labtech, Germany). Nitrite concentration was determined using a sodium nitrite standard curve ranging from 1.5625 to 200 µM. The NO concentration (µM) was calculated using the following formula:

Cell viability measurement via resazurin reduction assay

Cell viability was assessed using the resazurin reduction assay, which is based on the ability of metabolically active cells to reduce resazurin (a blue dye) to resorufin (a pink, fluorescent compound). This color change can be quantified by measuring absorbance in the 530–570 nm range. Following treatment, 50 µL of 50 µg/mL resazurin solution was added to each well and incubated at 37 °C in a humidified incubator with 5% CO₂ for 3 h. Absorbance was then measured at 570 nm using a microplate reader (FLUOstar Omega, BMG Labtech, Germany). The percentage of viable cells was calculated using the following formula:

Determination of ROS levels via fluorescence microscopy

ROS generation was assessed based on a previously described method [24]. RAW 264.7 macrophages were seeded into 6-well plates at a density of 5 × 10⁴ cells/well and incubated for 24 h. Cells were then treated with ECa 233 at concentrations of 12.5, 25, 50, 100, and 200 µg/mL for an additional 24 h. Following treatment, cells were stained with 25 µM DCFDA in phosphate-buffered saline (PBS) and incubated at 37 °C for 45 min. After staining, cells were washed twice with 1 × PBS to remove excess dye. Intracellular ROS levels were detected by measuring green fluorescence using a fluorescence microscope (ECLIPSE Ts2R, Nikon, Tokyo, Japan).

Analysis of ROS levels via DCFDA staining

The intracellular production of ROS was quantified using DCFDA, which fluoresces upon oxidation. The fluorescence intensity of the oxidized product (DCF) is proportional to ROS levels and can be measured at an excitation wavelength of 488 nm and an emission wavelength of 525 nm [25]. RAW 264.7 macrophages were seeded into 96-well plates at a density of 7.5 × 10⁴ cells/well and incubated for 24 h at 37 °C, 5% CO₂, and 95% humidity. The following day, cells were treated with ECa 233 at concentrations of 12.5, 25, 50, 100, and 200 µg/mL and incubated for 3 h under the same conditions. After treatment, the supernatant was removed, and 100 µL of 10 µM DCFDA was added to each well. Cells were incubated in the dark at 37 °C for 30 min. Following incubation, the DCFDA solution was discarded, and cells were washed three times with 1 × PBS. Fluorescence intensity was then measured at 488 nm excitation and 525 nm emission using a microplate reader (FLUOstar Omega, BMG Labtech, Germany). The relative of ROS generation was calculated using the following formula:

Measurement of H₂O₂

H₂O₂ production was measured as previously described [26]. This method is based on the horseradish peroxidase (HRP)-mediated oxidation of phenol red by H₂O₂, which generates a colored compound measurable at 610 nm. RAW 264.7 macrophages were seeded into 96-well plates at a density of 5 × 10⁴ cells/well and incubated at 37 °C in a humidified atmosphere (5% CO₂, 95% humidity) for 24 h. After incubation, cells were treated with ECa 233 at concentrations of 12.5, 25, 50, 100, and 200 µg/mL. Untreated cells served as the control. Following treatment, 100 µL of the culture supernatant was collected and mixed with freshly prepared phenol red solution (containing 5.5 mM dextrose, 0.056 g phenol red, and 8.5 U/mL type I HRP in Dulbecco’s PBS) in a new 96-well plate. The mixture was incubated at 37 °C, 5% CO₂, and 95% humidity for 3 h. The reaction was terminated by adding 10 µL of 1 N NaOH. The absorbance was then measured at 610 nm using a microplate reader (FLUOstar Omega, BMG Labtech, Germany). H₂O₂ concentrations were determined using a standard curve ranging from 0 to 50 µM. The H₂O₂ concentration (µM) was calculated using the following formula:

Phagocytic activity measured via a zymosan-NBT reduction assay

Phagocytosis in macrophages is accompanied by a respiratory burst, leading to increased metabolic activity and the generation of ROS such as H₂O₂ and superoxide (O₂⁻). These reducing agents convert yellow NBT dye into a blue insoluble formazan product, which can be quantified by measuring absorbance at 570 nm [27, 28]. RAW 264.7 macrophages were seeded in 96-well plates at a density of 1 × 10⁵ cells/well and incubated for 24 h at 37 °C with 5% CO₂ and 95% humidity. Cells were then treated with ECa 233 at concentrations of 12.5, 25, 50, 100, and 200 µg/mL. Untreated cells served as the control group. After 24 h of treatment, the supernatant was removed, and cells were washed with incomplete DMEM. Next, a mixture containing 800 µg/mL zymosan A from Saccharomyces cerevisiae and 600 µg/mL NBT was added to each well, and the cells were incubated for 60 min at 37 °C. Following incubation, cells were washed three times with methanol. Then, 120 µL of 2 M KOH and 140 µL of 100% DMSO were added to dissolve the formazan crystals. The absorbance was measured at 570 nm using a microplate reader (FLUOstar Omega, BMG Labtech, Germany). The phagocytic index (PI) was calculated using the following formula:

Macrophage phagocytic index assay

Phagocytic activity of macrophages can be quantified using the neutral red uptake assay, which measures the dye retained in phagolysosomes. The extent of dye uptake correlates with phagocytic activity and is measured by absorbance at 540 nm [29, 30]. RAW 264.7 macrophages were seeded into 96-well plates at a density of 1 × 10⁵ cells/well and incubated for 24 h at 37 °C with 5% CO₂ and 95% humidity. Cells were then treated with ECa 233 at concentrations of 12.5, 25, 50, 100, and 200 µg/mL. Untreated cells served as the control group. After 48 h of incubation under the same conditions, the culture supernatant was removed, and 100 µL of 0.075% neutral red solution was added to each well. Cells were incubated for an additional 1 h at 37 °C, 5% CO₂. Following incubation, cells were washed twice with 1 × PBS to remove excess dye. Then, 100 µL of cell lysis solution (commonly a mixture of 50% ethanol and 1% acetic acid or equivalent) was added to each well, and the plate was left at room temperature for 2 h to allow complete dye extraction. Absorbance was measured at 540 nm using a microplate reader (FLUOstar Omega, BMG Labtech, Germany). The phagocytic index (PI) was calculated using the following formula:

RT-PCR

RT-PCR was performed based on previously reported protocols with slight modifications [31]. RAW 264.7 macrophages were seeded into 24-well plates at a density of 5 × 10⁴ cells/well and incubated for 24 h at 37 °C with 5% CO₂ and 95% humidity. Cells were then treated with ECa 233 at concentrations of 50, 100, and 200 µg/mL. Untreated cells served as the negative control, whereas cells treated with levamisole at 10 and 100 µg/mL served as positive controls. After 24 h of treatment, total RNA was extracted using the GF-1 Total RNA Extraction Kit (Vivantis, Malaysia). RNA concentration and purity were assessed using a Nano-300 Micro-Spectrophotometer (Allsheng, China), and RNA samples were stored at − 80 °C until further use. Complementary DNA (cDNA) was synthesized from total RNA using the ImProm-II™ Reverse Transcription System Kit (Promega, USA). Subsequently, cDNA was amplified via PCR using Taq polymerase (Vivantis, Malaysia) in a thermal cycler (FlexCycler2, Analytik Jena, Life Science, Germany). The PCR protocol included an initial denaturation at 95 °C for 1 min, followed by 35 cycles of denaturation at 95 °C for 1 min, annealing at primer-specific temperatures for 45 s, and extension at 72 °C for 1 min. A final extension was performed at 72 °C for 10 min. PCR products were separated via electrophoresis on a 1.5% agarose gel for 20 min. Band intensities were analyzed using a gel documentation system (Alliance Q9 Advanced, UVITEC, Cambridge, UK), and relative gene expression levels were normalized to GAPDH expression.

The primer sequences used in this study were as follows:

Genes	Primer sequences	References
COX-2	Forward 5′-GGAGAGACTATCAAGATAGTGATC-3′	[32]
	Reverse 5′-ATGGTCAGTAGACTTTTACAGCTC-3′
IL-1β	Forward 5′-GAAGCTGTGGCAGCTACCTATGTCT-3′	[33]
	Reverse 5′-CTCTGCTTGTGAGGTGCTGATGTAC-3′
IL-6	Forward 5′- GAGGATACCACTCCCAACAG-3′	[33]
	Reverse 5′-TTCACAGAGGATACCACTCC-3′
TNF-α	Forward 5′- TACTGAACTTCGGGGTGATTGGTCC-3′	[33]
	Reverse 5′-CAGCCTTGTCCCTTGAAGAGAACC-3′
iNOS	Forward 5′-GTGCTGCCTCTGGTCTTGCAAGC-3′	[33]
	Reverse 5′-AGGGGCAGGCTGGGAATTCG-3′
IL-10	Forward 5′-ATGGAAGACGCCAAAAACATAAAG-3′	[34]
	Reverse 5′-ATAGCTTCTGCCAACCGAAC-3’
IL-12	Forward 5′ -TCAAGAGCAGTAGCAGTTCCCCTG-3′	[35]
	Reverse 5′ -GGTCCAGTGTGACCTTCTCTGCA-3′
TGF-β	Forward 5′ -GTGGCTGAACCAAGGAGACGG-3′	[35]
	Reverse 5′ -GGCTGATCCCGTTGATTTCCACG-3′
CXCR-1	Forward 5′-GGGTGAAGCCACAACAGATT-3’	[36]
	Reverse 5′-CGGTGTGTCAAAACCTCCTT-3′
CXCR-2	Forward 5’‐TGTCTGCTCCCTTCCATCTT‐3’	[37]
	Reverse 5’‐CCATTTCCTCTCCTCCAGCT‐3’
GAPDH	Forward 5′-CAGGAGCGAGACCCCACTAACAT-3′	[33]
	Reverse 5′-GTCAGATCCACGACGGACACATT-3′

Statistical analysis

Data were collected from three or more independent experiments and are presented as mean ± SEM. Graphs were generated using GraphPad Prism version 8.0 (San Diego, California, USA). Statistical analysis was performed using one-way ANOVA followed by Tukey’s Honestly Significant Difference post-hoc test. A p-value of < 0.05 was considered statistically significant.

Results

FT-IR spectrum analysis of ECa 233

FT-IR spectroscopy is a reliable and sensitive technique for detecting biomolecular components. In this study, FT-IR analysis was employed to identify the functional groups of the active constituents in the ECa 233 extract based on the infrared absorption peaks. As shown in Fig. 2, the FT-IR spectrum confirmed the presence of functional groups such as N–H, O–H, C = C, C–H, C–O, and CH₃. Specific peaks corresponding to the stretching vibrations of asiatic and madecassic acids were observed at 1069 cm⁻¹ (C–O), 1642 cm⁻¹ (C = O), 2919 cm⁻¹ (C–H), and 3233 cm⁻¹ (R–OH). Additional peaks were noted at 993 and 909 cm⁻¹ (CH₂), 1702 cm⁻¹ (C = O), and again at 2919 cm⁻¹ (R–OH). When compared with the FT-IR spectra of an asiaticoside standard reported previously [38], the spectral features of ECa 233 indicated the presence of asiaticoside (Fig. 3). These findings were further confirmed via NMR analysis.

Fig. 2.

FT-IR spectrum showing characteristic peak values of the ECa 233

Fig. 3.

Chemical structures of asiaticoside and madecassoside

NMR spectroscopy analysis

As demonstrated in Fig. 4a and b, the chemical composition of ECa 233 was analyzed using proton NMR (¹H-NMR) spectroscopy with a 400 MHz spectrometer in deuterated DMSO (DMSO-d₆). The spectrum exhibited several characteristic signals corresponding to the major triterpenoid constituents of C. asiatica. Chemical shifts at δ_H 3.58–3.65 were attributed to hydroxyl (–OH) protons, whereas signals in the range of δ_H 1.43–3.25 were associated with methine protons within the cyclohexane ring structure. Signals observed between δ_H 1.04 and 2.04 corresponded to methyl and methylene (CH₃ and CH₂) groups of aliphatic side chains. These chemical shift assignments are consistent with previously reported spectra of triterpenoid glycosides such as asiaticoside and madecassoside [39]. The ¹³C NMR showed signals at δ_c 175.52 and δ_c 175.46 indicating C-28 ester linkage of madecassoside and asiaticoside. The signals at δ_c 94.63, 103.21, and 100.89 indicating of anomeric carbons of 2 units of glucose and one rhamnose, respectively, which was confirmed intact of three sugar moieties. The structure of madecassoside and asiaticoside are similar except C-16 which the signal at δ_c 67.92 of C-6-OH madecassoside and δ_c 18.22 of C-6 asiaticoside were observed.

Fig. 4.

¹H-NMR spectrum (400 MHz, DMSO-d₆) (a) and ¹³C-NMR spectrum (100 MHz, DMSO-d₆) (b) of the ECa 233, where MA is madecassoside and AS is asiaticoside

NO production assay using Griess reagent

The levels of NO produced by RAW 264.7 macrophages after treatment with ECa 233 at concentrations of 1.5625, 3.125, 6.25, 12.5, 25, 50, 100, and 200 µg/mL for 24 h are shown in Fig. 5. The NO concentrations measured in the treated groups were 121.1 ± 19.93 µM (p < 0.01), 95.89 ± 10.99 µM (p < 0.05), 112.4 ± 7.89 µM (p < 0.05), 124.8 ± 15.69 µM (p < 0.01), 123.7 ± 31.23 µM (p < 0.01), 107.9 ± 24.02 µM (p < 0.05), 120.0 ± 16.40 µM (p < 0.01), and 135.8 ± 30.86 µM (p < 0.01), respectively, compared to the control group, which exhibited an NO level of 12.24 ± 3.59 µM. All tested concentrations of ECa 233 significantly increased NO production relative to the control. Given the established link between NO production and macrophage cytolytic activity against various pathogens, these findings indicate that the immunostimulatory effect of ECa 233 may be partially mediated through the activation of NO production.

Fig. 5.

NO production by RAW 264.7 macrophages. RAW 264.7 cells (6 × 10⁴ cells/well) were stimulated with various concentrations of ECa 233 for 24 h. The cell culture supernatant was collected, and nitrite levels were measured using the Griess reagent. Data are presented as mean ± SEM from three independent experiments. *p < 0.05, **p < 0.01 compared to the control group

Morphological analysis and cell viability assessment using the resazurin reduction assay

As shown in Fig. 6a, the morphology of RAW 264.7 macrophages was examined under an inverted microscope after treatment with different concentrations of ECa 233. The treated cells exhibited an elongated, horn-like shape, which may suggest morphological differentiation. Cell viability of RAW 264.7 macrophages was assessed after 24-h stimulation with ECa 233 at concentrations of 1.5625, 3.125, 6.25, 12.5, 25, 50, 100, and 200 µg/mL. As shown in Fig. 6b, ECa 233 treatment promoted macrophage proliferation. Compared with the control group, which showed 100% ± 0.00% viability, the treated groups exhibited viability percentages of 111.3% ± 6.00%, 121.6% ± 6.74%, 121.2% ± 10.66%, 126.0% ± 9.90%, 120.6% ± 12.51%, 116.0% ± 6.46%, 121.1% ± 13.11%, and 129.9% ± 7.65%, respectively. The highest dose (200 µg/mL) resulted in a viability increase to 129.9% ± 7.65%. Although a trend of increased cell viability was observed, the differences were not statistically significant compared with the control group.

Fig. 6.

Morphology of RAW 264.7 macrophages treated with ECa 233 (a). Cell viability of RAW 264.7 macrophages after 24 h of exposure to various concentrations of ECa 233, assessed using the resazurin reduction assay (b). Data are presented as mean ± SEM from three independent experiments

ROS production assay using 2′,7′-dichlorodihydrofluorescein diacetate (DCFDA) staining

As shown in Fig. 7a and b, the generation of ROS in RAW 264.7 macrophages was evaluated after 24-h treatment with ECa 233 at concentrations of 12.5, 25, 50, 100, and 200 µg/mL. Compared with the control group (1.000 ± 0.00), the relative ROS levels were 1.121 ± 0.053, 1.151 ± 0.086, 1.193 ± 0.041 (p < 0.05), 1.264 ± 0.031 (p < 0.05), and 1.369 ± 0.042 (p < 0.001), respectively. These results indicate that ECa 233 significantly enhances ROS production in a dose-dependent manner. The observed increase in ROS levels suggests a potential role of ECa 233 in activating oxidative responses in macrophages.

Fig. 7.

Concentration of free radicals in RAW 264.7 macrophages after 24-h treatment with ECa 233 (a). Relative ROS generation in RAW 264.7 macrophages treated with ECa 233 at various concentrations (b). Data are presented as mean ± SEM from three independent experiments. *p < 0.05, ***p < 0.001 compared to the control group

H₂O₂ production in macrophages

Figure 8 illustrates the levels of H₂O₂ released by RAW 264.7 macrophages following 24-h treatment with ECa 233 at concentrations of 12.5, 25, 50, 100, and 200 µg/mL. ECa 233 treatment led to a dose-dependent increase in H₂O₂ production. The measured H₂O₂ concentrations were 10.37 ± 1.70 µM, 10.92 ± 2.22 µM, 12.20 ± 0.52 µM (p < 0.05), 18.04 ± 1.43 µM (p < 0.001), and 22.31 ± 2.99 µM (p < 0.001), respectively, compared to 4.47 ± 0.33 µM in the control group. These findings indicate that ECa 233 stimulates H₂O₂ production in macrophages, suggesting a role in enhancing cytotoxic activity against pathogens.

Fig. 8.

H₂O₂ production by RAW 264.7 macrophages after 24-h treatment with ECa 233 at various concentrations. Data are presented as mean ± SEM from three independent experiments. *p < 0.05, ***p < 0.001 compared to the control group

Zymosan-nitroblue tetrazolium (NBT) reduction assay

The phagocytic activity of RAW 264.7 macrophages treated with ECa 233 at concentrations of 12.5, 25, 50, 100, and 200 µg/mL for 24 h is presented in Fig. 9. The relative phagocytic activity values were 1.426 ± 0.086 (p < 0.05), 1.393 ± 0.100 (p < 0.05), 1.318 ± 0.150, 1.377 ± 0.079 (p < 0.05), and 1.578 ± 0.089 (p < 0.01), respectively, compared to the control group, which was set at 1.000 ± 0.00. These results indicate that ECa 233 enhances macrophage functional activity in RAW 264.7 macrophages.

Fig. 9.

Phagocytic activity of RAW 264.7 macrophages after 24-h treatment with various concentrations of ECa 233, assessed using the zymosan-NBT reduction assay. Data are presented as mean ± SEM from three independent experiments. *p < 0.05, **p < 0.01 compared to the control group

Neutral red uptake assay for macrophage phagocytosis

Figure 10 shows the phagocytic activity of RAW 264.7 macrophages treated with ECa 233 at concentrations of 12.5, 25, 50, 100, and 200 µg/mL over a 48-h period. Compared with the control group (set at 1.000 ± 0.00), the relative phagocytosis values were 1.402 ± 0.116 (p < 0.01), 1.370 ± 0.044 (p < 0.01), 1.374 ± 0.094 (p < 0.01), 1.464 ± 0.114 (p < 0.01), and 1.570 ± 0.027 (p < 0.001), respectively. These results confirm that ECa 233 significantly enhances macrophage functional activity in RAW 264.7 macrophages. This suggests that phagocytosis is one of the mechanisms through which ECa 233 contributes to macrophage-mediated cytotoxicity.

Fig. 10.

Phagocytic activity of RAW 264.7 macrophages after 48-h treatment with various concentrations of ECa 233, assessed using the neutral red uptake assay. Data are presented as mean ± SEM from three independent experiments. **p < 0.01, ***p < 0.001 compared to the control group

ECa 233 treatment altered gene expression in macrophages

Figure 11 illustrates the expression levels of genes associated with macrophage activation, including pro-inflammatory cytokines (TNF-α, IL-1β, IL-6), regulatory cytokines (TGF-β, IL-10, IL-12), surface markers (CXCR-1, CXCR-2), and inflammatory mediators (iNOS, COX-2), following a 24-h treatment with ECa 233 at 50, 100, and 200 µg/mL. Gene expression was compared with both negative and positive controls (levamisole at 10 and 100 µg/mL). ECa 233 significantly upregulated the expression of key genes involved in macrophage activation. Notably, treatment with 200 µg/mL of ECa 233 significantly increased TNF-α expression (p < 0.05) compared with both control and levamisole-treated groups. Although a mild increase in IL-1β and IL-6 expression was observed at this dose, the effect was less pronounced. ECa 233 at 200 µg/mL also significantly enhanced TGF-β expression (p < 0.05), suggesting potential involvement in immune regulation and tissue repair. However, the expression of IL-10 and IL-12 was only marginally affected.

Fig. 11.

mRNA expression levels of pro-inflammatory cytokines (TNF-α, IL-1β, IL-6) (a), regulatory cytokines (TGF-β, IL-10, IL-12) (b), surface markers (CXCR-1, CXCR-2) (c), and NO and inflammatory markers (iNOS, COX-2) (d) in RAW 264.7 macrophages after treatment with levamisole (positive control) and ECa 233. Data are presented as mean ± SEM from three independent experiments. *p < 0.05, ***p < 0.001, ###p < 0.001 compared to the control group

Additionally, 24-h treatment with ECa 233 increased the expression of surface markers in RAW 264.7 macrophages. CXCR-1 expression showed a dose-dependent upward trend at 50, 100, and 200 µg/mL; however, the differences were not statistically significant. Conversely, CXCR-2 expression was significantly upregulated by ECa 233 at 200 µg/mL compared to both the control group (p < 0.001) and levamisole 100 µg/mL group (p < 0.001). The increase in gene expression was supported by the progressively intensified PCR band densities, indicating a correlation between ECa 233 dose and surface marker expression.

Finally, ECa 233 treatment at concentrations of 50, 100, and 200 µg/mL stimulated the expression of iNOS and COX-2 in RAW 264.7 macrophages, although the increases were not statistically significant. A schematic illustration summarizing the proposed mechanism by which ECa 233 activates RAW 264.7 macrophages is presented in Fig. 12.

Fig. 12.

Schematic illustration of the mechanism by which ECa 233 activates RAW 264.7 macrophage functions

Discussion

In this study, we found that ECa 233 exhibits immunostimulatory properties by enhancing the functions of RAW 264.7 macrophages through the induction of NO, H₂O₂, and ROS generation. In addition, the molecular mechanisms underlying its action were explored. ECa 233 stimulated the production of pro-inflammatory and regulatory cytokines, surface markers, and other inflammatory mediators. These findings suggest that ECa 233 can modulate innate immune responses and act as a natural immunostimulatory agent. The FT-IR, ¹H, and ¹³C NMR analyses of the ECa 233 extract derived from C. asiatica confirmed the presence of major triterpenoid compounds, such as asiaticoside and madecassoside, consistent with the findings of previous studies [38, 39]. The ¹³C NMR data confirmed the structural features of madecassoside and asiaticoside. The signals at δ_c 175.52 and 175.46 correspond to the ester carbonyl carbons at C-28, consistent with their triterpenoid glycoside nature. Anomeric carbon signals at δ_c 94.63, 103.21, and 100.89 indicated the presence of two glucose units and one rhamnose, confirming that all three sugar moieties remain intact. A key difference between the two compounds was observed at the C-6 position. Madecassoside exhibited a signal at δ_c 67.92, consistent with a hydroxylated methide carbon, while asiaticoside showed δ_c 18.22, characteristic of a methylene group. This structural variation may influence their physicochemical properties and potentially their biological activities.

NO is one of the principal effector molecules produced by activated macrophages and plays a critical role in immune defense due to its strong cytotoxic effects against pathogenic bacteria and tumor cells [3]. In addition to its antimicrobial properties, NO also functions as an intracellular messenger involved in regulating various physiological processes [40, 41]. In the present study, treatment of RAW 264.7 macrophages with ECa 233 at concentrations of 1.5625–200 µg/mL significantly stimulated NO production compared with the control group, which exhibited markedly lower NO levels. This observation aligns with earlier findings on other natural compounds. For example, water-soluble polysaccharides extracted from tiger lilies via ultrasonic-assisted extraction were reported to enhance macrophage phagocytosis and NO production in a dose-dependent manner [42]. Previous studies have demonstrated that the combination of asiatic acid and madecassoside enhances phagocytosis, NO production, and iNOS expression in macrophages, compared with untreated cells, suggesting that ECa 233 activates macrophage immune function, at least in part, by stimulating iNOS expression [43], Upon examining the morphology of RAW 264.7 macrophages treated with varying doses of ECa 233, we found that ECa 233 exhibited no cytotoxicity, as no cellular death was observed even at higher concentrations. The cells maintained typical structural characteristics, including intact cytoplasm and nuclei. Moreover, RAW 264.7 macrophages treated with ECa 233 underwent morphological changes from a round shape to an irregular and rough appearance, with rapid spreading and the formation of pseudopodia, suggesting cell differentiation and activation. Consistently, our resazurin reduction assay demonstrated that ECa 233 promoted the proliferation of RAW 264.7 macrophages across the same concentration range, indicating that ECa 233 is not cytotoxic and may enhance immune cell viability and function. However, the results were not normalized to cell number, which may affect the interpretation of macrophage proliferation. The resazurin assay measures metabolic activity and can be influenced by oxidative bursts, which were not directly assessed in this study. In this study, ECa 233 was shown to modulate reactive oxygen species in macrophages. Future studies should include normalization and direct measurements of oxidative bursts. Moreover, M1 macrophage proliferation is physiologically limited; thus, increased metabolic activity likely reflects activation rather than true proliferation. These findings are consistent with previous studies examining the immunomodulatory effects of Rhinacanthus nasutus and C. asiatica extracts on human peripheral blood mononuclear cells (PBMCs). Both R. nasutus (water and ethanol extracts) and C. asiatica (water extract) were shown to stimulate PBMC proliferation and promote the release of cytokines such as TNF-α and IL-2. Interestingly, although C. asiatica ethanol extract inhibited PBMC mitogenesis, it still enhanced TNF-α and IL-2 production. In vivo, BALB/c mice administered 100 mg/kg body weight of C. asiatica extract exhibited enhanced primary and secondary antibody responses against bovine serum albumin, whereas R. nasutus extract enhanced only secondary responses [44]. Moreover, previous studies have reported that ECa 233 can suppress the production of LPS-stimulated pro-inflammatory mediators in RAW 264.7 macrophages, including NO, ROS, prostaglandin E₂, and cytokines such as TNF-α and IL-1β [12]. Importantly, ECa 233 was shown to be safe for RAW 264.7 macrophages at concentrations ranging from 0.1 to 100 µg/mL, further supporting its potential as a non-toxic immunomodulatory agent. In this study, we observed that treatment with ECa 233 at concentrations of 12.5–200 µg/mL significantly increased free radical production in RAW 264.7 macrophages. ROS play essential roles beyond direct pathogen killing, including involvement in signal transduction, cellular differentiation, and gene expression [45]. Their significance in macrophage-mediated immunity is well established, encompassing direct antimicrobial effects against bacteria and parasites, redox-based modulation of immune signaling pathways, and inflammasome activation [46]. Interestingly, while NO and ROS levels were elevated in treated cells relative to control, the changes did not exhibit a dose-dependent trend, suggesting that maximal activation may be reached at lower concentrations. However, it remains to be determined whether a saturation point exists or if higher concentrations may exert cytotoxic effects. ECa 233 also elevated H₂O₂ levels in a dose-dependent manner after 24 h of treatment, further supporting its role in oxidative immune activation. Alongside ROS and NO production, ECa 233 significantly enhanced the phagocytic activity of RAW 264.7 macrophages, as assessed using the NBT assay and neutral red uptake assay. These findings indicate that ECa 233 promotes macrophage functional activation and enhances the first-line immune response. Although the NBT assay indicated an increase in phagocytic activity upon treatment, the response did not demonstrate a clear dose dependency. This may suggest a threshold effect or a plateau in activation at lower concentrations. In this study, the neutral red uptake assay was used to evaluate phagocytic activity in RAW 264.7 macrophages. Although neutral red is conventionally utilized to assess endocytic (pinocytic) activity rather than classical phagocytosis, it has been widely employed as an indicator of cellular uptake activity in macrophage functional studies [30]. Moreover, neutral red and NBT assays provide a useful approximation of cellular uptake and oxidative responses; future studies should adopt more specific methodologies, such as FITC-labelled zymosan particles or pH-sensitive fluorescent probes, to quantify and visualize phagocytosis with greater precision. Phagocytosis represents a key initial defense mechanism of macrophages against invading pathogens and is closely linked to the generation of ROS, including NO and H₂O₂ [3]. These molecules are effective cytotoxic agents that help eliminate microorganisms. Notably, NO also plays a broader role in physiological regulation, including vasodilation, vascular relaxation, immune modulation, and tumor cytotoxicity [47]. Collectively, the results of this study demonstrate the immunostimulatory potential of ECa 233 through multiple mechanisms, including enhanced ROS, NO, and H₂O₂ production as well as stimulation of macrophage phagocytic activity. These effects indicate that ECa 233 may activate the innate immune response by promoting M1 macrophage function and division. The experimental outcomes highlight the roles and functions of genes expressed in macrophage activation and immune system enhancement. Specifically, genes encoding pro-inflammatory cytokines (TNF-α, IL-1β, IL-6), cytokine markers (TGF-β, IL-10, IL-12), surface markers (CXCR-1, CXCR-2), and inflammatory mediators (iNOS, COX-2) were assessed. The data demonstrate that ECa 233 exerts an immune-stimulating effect by promoting M1 macrophage activation, as evidenced by gene expression profiles in comparison with both the untreated control group and the levamisole-treated positive control group (10 and 100 µg/mL). Treatment with ECa 233 at concentrations of 50–200 µg/mL significantly upregulated the expression of several pro-inflammatory and regulatory markers, including TNF-α, IL-1β, IL-6, IL-10, and IL-12 in RAW 264.7 macrophages. Notably, expression levels of TNF-α and TGF-β were significantly elevated (p < 0.05) at 200 µg/mL ECa 233, and CXCR-2 expression was significantly higher (p < 0.001) than in both the control and the 100 µg/mL levamisole-treated groups. This is consistent with a pro-inflammatory or early immune activation profile. The upregulation of TNF-α and TGF-β at higher concentrations suggests a dual action of the extract in both promoting pro-inflammatory responses and potentially modulating resolution or repair mechanisms. TNF-α is a central mediator in macrophage-driven inflammation and plays a crucial role in pathogen clearance, while TGF-β, though often associated with anti-inflammatory functions, is also involved in macrophage activation and tissue remodeling [6–8]. Interestingly, the modest or negligible effects on IL-10 and IL-12 expression suggest that ECa 233 does not broadly suppress immune responses but rather selectively modulates specific signaling pathways. The observed increase in CXCR-2 gene expression at 200 µg/mL, together with a dose-dependent trend in CXCR-1 expression, indicates that ECa 233 may influence macrophage chemotactic behavior. CXCR-1/2 receptors are critical for migration toward chemokines such as IL-8 (CXCL8), and their upregulation suggests enhanced readiness of macrophages to respond to inflammatory cues [48]. These findings align with previous studies investigating natural immunostimulants. For example, increasing concentrations of Adenocaulon himalaicum leaf extract were shown to stimulate phagocytosis in RAW 264.7 macrophages and enhance the production of immune-activating factors such as NO, iNOS, IL-1β, IL-6, and TNF-α, without inducing cytotoxicity [49]. Similarly, HCMP, a high-molecular-weight polysaccharide derived from Cordyceps militaris, was found to activate mouse RAW 264.7 macrophages by promoting NO production, phagocytosis, and changes in the expression of inflammatory markers while also activating mitogen-activated protein kinases (MAPKs) [50]. Other research on polysaccharides from C. militaris confirmed their immunostimulatory potential, with increased NO, ROS, TNF-α production, and phagocytic activity in both mouse peritoneal and RAW 264.7 macrophages. C. militaris appears to exert these effects through the NF-κB and MAPK signaling pathways, mediated via dectin-1 and TLR2 receptors [51]. Moreover, the polysaccharide from Dictyophora indusiata, a traditional Chinese medicinal mushroom, has also been shown to stimulate the production and mRNA expression of NO, IL-1β, IL-6, and TNF-α in macrophages [52]. Compared with such well-established herbal immunostimulants like C. militaris and D. indusiata, ECa 233 demonstrated comparable or even superior immune-activating effects at relatively lower concentrations, supporting its potential as a potent and safe immunomodulatory agent. To further validate the immunostimulatory effects of ECa 233, additional studies should quantify the secretion of pro-inflammatory cytokines and chemokines in the culture medium during RAW 264.7 macrophage activation. These secreted factors can be measured using enzyme-linked immunosorbent assays. Additionally, the expression of key inflammatory proteins should be assessed via western blot analyses to provide deeper insight into the molecular mechanisms underlying ECa 233’s immunomodulatory activity. ECa 233 contains both asiaticoside and madecassoside, which may exert a synergistic effect in stimulating the immune system. The observed upregulation of TNF-α, IL-6, and iNOS suggests the potential involvement of the MAPK and nuclear factor-kappa B signaling pathways. However, further investigation is necessary to determine whether the immunostimulatory effects of ECa 233 on RAW 264.7 macrophages are mediated through these or alternative molecular mechanisms. In addition to enhancing macrophage functional activity, ECa 233 may modulate the expression of surface receptors that play critical roles in phagocytosis. Macrophages recognize and internalize pathogens through pattern recognition receptors such as Toll-like receptors (TLRs), as well as Fc receptors (FcRs), mannose receptors, and complement receptors. The observed increase in macrophage activation markers following ECa 233 treatment suggests a potential upregulation of these receptors, which could facilitate more efficient recognition and binding of pathogens. This mechanism may contribute, at least in part, to the immunostimulatory effects of ECa 233 and warrants further investigation using specific receptor expression assays [53, 54]. Additionally, in vivo studies using models such as LPS-induced systemic inflammation or immunosuppression-induced murine models are needed to provide a more comprehensive understanding of the systemic immunomodulatory effects of ECa 233. Future research should focus on elucidating the underlying molecular pathways and evaluating the clinical efficacy of ECa 233. Given its strong immunostimulant profile and demonstrated in vitro safety, ECa 233 shows promise as a potential candidate for the development of oral immunoboosters or nutraceuticals for use in immunocompromised individuals.

Conclusions

In this study, we first characterized the chemical structure and functional groups of ECa 233. Stimulation of RAW 264.7 macrophages with ECa 233 led to increased production of NO, H₂O₂, and ROS. ECa 233 also promoted RAW 264.7 cell proliferation without inducing cytotoxicity. Additionally, it enhanced macrophage functional activity and up-regulated the expression of pro-inflammatory and regulatory cytokines, immune markers, and surface receptors. These in vitro findings indicate that ECa 233 may act as a potential immunostimulant. However, further in vivo studies are required to confirm its efficacy and explore its therapeutic applications in immune-related conditions.

Authors’ contributions

S.M. contributed to the conceptualization, methodology, investigation, data curation, formal analysis, validation, visualization, supervision, resources, writing—original draft, writing—review and editing, and funding acquisition. T.S. and T.C. contributed methodology, investigation, resources, writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the Research Grant from the Faculty of Pharmaceutical Sciences, Burapha University (grant no. 07/2566).

Data availability

Data supporting the findings of this study are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

No ethical approval was required for the use of commercially available cell lines.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.