Abstract
Background
Atherosclerosis (AS) is a major cause of severe cardiovascular disease and stroke. Ginsenoside Re (Re) has been shown to significantly alleviate AS in mice. Our study demonstrates for the first time that Re can reduce endothelial cell (EC) glycolysis, although the specific mechanism remains unclear.
Methods
The effects of Re on lipid levels, aortic wall thickness, inflammation, and aortic fibrosis in AS mice were assessed by measuring serum lipids, carotid artery intima-media thickness, Hematoxylin-Eosin, Masson, and Oil Red O staining, and enzyme-linked immunosorbent assay. The effects of Re on EC proliferation and migration were examined using CCK-8 and wound healing assays in a human umbilical vein endothelial cell model stimulated with oxidized low-density lipoprotein. Furthermore, immunohistochemistry, Western blotting, and real-time quantitative polymerase chain reaction were used to investigate the PFKFB3-HIF-1α-VEGFA-VEGFR2 pathways in vivo and in vitro.
Results
Re demonstrated strong anti-AS activity, evidenced by improved blood lipid profiles, reduced inflammatory factors, and decreased levels of glycolysis-related products and enzymes. In vivo, Re protected against AS by inhibiting glycolysis. In vitro, Re suppressed EC migration through inhibition of the glycolysis-related PFKFB3-HIF-1α-VEGFA-VEGFR2 pathways.
Conclusion
Re may benefit AS mice by inhibiting EC glycolysis and migration through suppression of the PFKFB3-HIF-1α-VEGFA-VEGFR2 pathways. This work broadens the theoretical basis for the therapeutic use of Re in AS.
Keywords: Atherosclerosis; Endothelial cell migration; Fructose-2-phosphate kinase/fructose-2,6-bisphosphatase-3; Ginsenoside Re; Glycolysis
Graphical abstract
1. Introduction
Atherosclerosis (AS) is a chronic inflammatory disease of the arteries that can progress to peripheral arterial disease. Global data show that between 1990 and 2019, the incidence of AS displayed a general upward trend [1].
At present, clinical drugs for AS mainly act through antiplatelet aggregation (e.g., aspirin and clopidogrel), lipid-lowering effects (e.g., statins and fibrates), and vasodilation [2]. However, these drugs are often limited by poor bioavailability, nonspecific distribution, and high toxicity, which result in suboptimal clinical outcomes [3]. For example, probucol, an antioxidant approved by the U.S. Food and Drug Administration for AS management, not only exhibits low oral bioavailability but also has difficulty entering the systemic circulation, greatly restricting its clinical applicability [4,5]. In addition, long-term use of aspirin and statins, the most widely prescribed lipid-lowering anti-AS agents, may cause severe adverse effects such as myopathy and gastrointestinal bleeding. Furthermore, because AS involves multiple pathogenic factors and interconnected pathological pathways, conventional therapies that target a single signaling pathway may contribute to the limited efficacy of current treatments [6,7]. Therefore, exploring alternative therapeutic strategies and identifying drugs with improved efficacy, broader applicability, and fewer adverse effects are urgently needed.
The ECs in the innermost layer of blood vessels, together with their intercellular tight junction complexes, form a selective permeation barrier between blood and tissues, which regulates vascular tone, inflammation, and thrombosis [8]. Lipoprotein particles in the blood accumulate at sites of endothelial damage, where ECs secrete adhesion molecules and chemokines, recruit monocytes to adhere to the endothelial surface, and facilitate their entry into the intima. There, monocytes differentiate into macrophages and phagocytose lipoproteins to form foam cells [9]. Endothelial activation or injury is therefore the initiating factor of AS, and protecting EC function is of great significance for its prevention. Cells primarily metabolize glucose to produce energy through oxidative phosphorylation, and glycolysis is activated mainly under hypoxic conditions. Subsequent studies have confirmed the presence of both aerobic and anaerobic glycolysis in AS [10]. ECs obtain most of their energy through aerobic glycolysis. Although aerobic glycolysis of glucose yields less adenosine triphosphate (ATP) than oxidative phosphorylation [11], it proceeds at a faster rate [12]. Glycolysis alleviates endothelial dysfunction in AS, but excessive glycolysis additionally stimulates EC proliferation and migration, and promotes the formation of new blood vessels in AS plaques [10]. Under normal conditions, the main source of ATP in ECs is glycolysis [13]. Reduced glycolysis in ECs diminishes their proliferation, migration, and sprouting ability [13,14]. Vascular endothelial growth factor (VEGF) and fibroblast growth factor 2 (FGF2) induce EC proliferation and migration by enhancing glycolysis [13,15]. Thus, targeting endothelial homeostasis and EC glycolysis is a promising therapeutic strategy for AS.
6-phosphofructokinase-1 (PFK-1) catalyzes the conversion of fructose-6-phosphate to fructose-1,6-bisphosphate during glycolysis. The enzyme phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 (PFKFB3) regulates PFK-1 activity [13]. PFKFB3, the most abundant isoenzyme of PFKFB in ECs, is the primary subject of study [16]. Recent reports have shown that reducing glycolysis by inhibiting PFKFB3 can effectively decrease vascular sprouting [13,14,16,17]. Specifically, PFKFB3 is important for EC migration, proliferation, and angiogenesis [13,14,18]. Silencing PFKFB3 reduces EC migration and proliferation, through suppression of hypoxia-inducible factor 1α (HIF-1α) and vascular endothelial growth factor receptor 2 (VEGFR2) [19,20]. In ApoE−/− mice with endothelial-specific PFKFB3 knockouts, venous graft lesions were smaller, thicker, and less stenotic [21]. Thus, PFKFB3 is critical for EC glycolysis, migration, proliferation, and angiogenesis.
Ginsenoside Re (Re) is a triterpenoid saponin isolated from the roots and rhizomes of Panax ginseng Meyer. Re possesses anti-inflammatory and antioxidant properties [22] and can also regulate EC proliferation and migration [23,24]. Previous investigations have demonstrated that Re has a wide utility in the prevention and treatment of AS. Preliminary studies have shown that Re improves AS, but its relationship with EC glycolysis and its underlying mechanism remain unknown. The study aimed to determine whether Re affects EC migration in AS through the PFKFB3-HIF-1α- VEGFA-VEGFR2 pathways.
2. Materials and methods
2.1. Reagents and antibodies
Ginsenoside Re, (Cat. B21055, Shanghai Yuanye Biotechnology Co., Ltd, purity≥ 98 %); Simvastatin tablets (Cat. 20210925, Shandong Xinqi Pharmaceutical Co., Ltd); PFKFB3 antibody (Cat. D7H4Q, Cell Signaling Technology, Inc.); HIF-1α Rabbit pAb (Cat. A11945, ABclonal Biotechnology Co., Ltd); HK2 polyclonal antibody (Cat. 22029-1-AP, Wuhan Sanying Biotechnology Co., Ltd); vascular endothelial cadherin (VE-cadherin) antibody (Cat. 2158S, Cell Signaling Technology, Inc.); VEGFA Rabbit mAb (Cat. ab214424, abcam); VEGFR2 Rabbit mAb (Cat. 2479, Cell Signaling Technology, Inc.).
2.2. Animals and experimental design
Six-week-old male ApoE−/− mice and C57BL/6J mice (SPF grade, 20–22 g) were purchased from Charles River Laboratories. Animals were housed at the SPF-level Experimental Animal Center of the Institute of Medicinal Plants, Chinese Academy of Medical Sciences (ethical review number: SLXD-20220623020; license number: SYXK [Beijing] 2023–0008). The facilities maintained barrier environmental standards. Lighting conditions were 12 h light/12 h dark. Five animals were housed per cage, and the housing space met the requirements of the national standard GB14925-2010 of the People's Republic of China for the minimum space for experimental animals. Newly arrived animals underwent a quarantine period of 3–7 days. All procedures complied with animal welfare guidelines and were approved by the Laboratory Animal Ethics Committee of the Institute of Medicinal Plants, Chinese Academy of Medical Sciences. Ten C57BL/6 mice were randomly assigned to receive tap water and a normal diet as the blank control group. Normal saline was administered by intragastric gavage once daily for 14 weeks. Fifty ApoE−/− (background C57BL/6J) mice were fed ad libitum with tap water and a high-fat, high-cholesterol diet to induce atherosclerosis. These mice were randomly divided into five groups according to initial body weight (n = 10 per group): (1) AS group: high-fat diet + saline; (2) Re high-dose group: high-fat diet + 80 mg/kg Re; (3) Re medium-dose group: high-fat diet + 40 mg/kg Re; (4) Re low-dose group: high-fat diet + 20 mg/kg Re, and (5) Positive control group: high-fat diet + 3 mg/kg simvastatin. All treatments were administered by daily intragastric gavage for 14 weeks.
2.3. Biochemical analysis
Serum was obtained by centrifugation of blood samples. Lipid indicators, including triglycerides (TG), total cholesterol (TC), low-density lipoprotein (LDL), and high-density lipoprotein (HDL), were analyzed using commercial diagnostic kits (Zhongsheng Beijing Enterprises Biotechnology Co., Ltd.). Inflammatory indicators, including tumor necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β), and interferon-gamma (IFN-γ), were measured using commercial enzyme-linked immunosorbent assay (ELISA) kits (Jiangsu Enzyme Immunoassay Industrial Co., Ltd.) according to the manufacturer's instructions.
2.4. Echocardiographic measurements
Measurements were performed using a Vevo 1100 miniature ultrasound system (FUJIFILM VisualSonics) with a 400 MHz mechanical transducer. Experimental animals were anesthetized with isoflurane throughout the procedure, and heart rate was maintained at approximately 450–500 beats/minute. The probe was first positioned to obtain a long-axis view of the aortic arch, and then placed at the aortic root to collect images and measure intima-media thickness (IMT).
2.5. Histopathological staining
Mouse aorta was fixed with paraformaldehyde, dehydrated with sucrose, embedded in OCT (Cat. G6059 Wuhan Servicebio Technology Co., Ltd.), and prepared as frozen sections of the aortic root. Frozen sections were removed, equilibrated at room temperature for 15 min, and soaked in tissue fixative solution for 10 min. Staining was performed according to the manufacturer's instructions for the Hematoxylin-Eosin (H&E) staining kit (Cat. G1076, Wuhan Servicebio Technology Co., Ltd.), Masson staining kit (Cat. G1039, Wuhan Servicebio Technology Co., Ltd.), Oil Red O (ORO) staining kit (Cat. G1015, Wuhan Servicebio Biotechnology Co., Ltd.), and Histochemistry kit (Cat. G1212, Wuhan Servicebio Biotechnology Co., Ltd.). Stained sections were observed under a light microscope, and images were collected. For immunohistochemical (IHC) staining, the primary antibody used was PFKFB3 (Cat. D7H4Q, Cell Signaling Technology Co., Ltd.), and the secondary antibody was Goat Anti-Rabbit IgG(H + C), HRP (Cat. 80800619, Biotech Co., Ltd).
2.6. Real-time quantitative polymerase chain reaction (RT-qPCR)
cDNA synthesis and real-time amplification were performed using the Evo M-MLV Reverse Transcription Premix kit (Accurate Biology, AG11728, China) and the SYBR ® Green Pro Taq HS Premix qPCR kit III (Accurate Biology, AG11739, China) according to the manufacturer's instructions. The primer sequences used for RT-qPCR are shown in Table 1.
Table 1.
Primer sequences of RT-qPCR.
| Genes | Species | Primer Name | Primer Sequences (5′–3′) |
|---|---|---|---|
| PFKFB3 | Mice | F primer: | CCCAGAGCCGGGTACAGAA |
| R primer: | GGGGAGTTGGTCAGCTTCG | ||
| HIF-1α | Mice | F primer: | GATGACGGCGACATGGTTTAC |
| R primer: | CTCACTGGGCCATTTCTGTGT | ||
| HK2 | Mice | F primer: | GTGTGCTCCGAGTAAGGGTG |
| R primer: | CAGGCATTCGGCAATGTGG | ||
| Actin | Mice | F primer: | AAGAAGGTGGTGAAGCAGG |
| R primer: | GAAGGTGGAAGAGTGGGAGT | ||
| PFKFB3 | Human | F primer: | ATTGCGGTTTTCGATGCCAC |
| R primer: | GCCACAACTGTAGGGTCGT | ||
| HIF-1α | Human | F primer: | GAACGTCGAAAAGAAAAGTCTCG |
| R primer: | CCTTATCAAGATGCGAACTCACA | ||
| HK2 | Human | F primer: | TGCCACCAGACTAAACTAGACG |
| R primer: | CCCGTGCCCACAATGAGAC | ||
| Actin | Human | F primer: | CTGGGCTACACTGAGCACC |
| R primer: | AAGTGGTCGTTGAGGGCAATG |
2.7. Western Blot
Proteins were extracted from mouse aortic tissue, and concentrations were determined using the Bicinchoninic Acid assay. Equal amounts of protein were separated by Sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes. The membranes were blocked in 5 % skim milk for 2 h and then incubated overnight at 4 °C with primary antibodies, including HIF-1α Rabbit pAb (1:500), PFKFB3 antibody (1:1000), HK2 polyclonal antibody (1:1000), VEGFR2 Rabbit mAb (1:1000), VE-cadherin antibody (1:1000), and VEGFA Rabbit mAb (1:500). Membranes were incubated with secondary antibodies at room temperature for 2 h, after washing with TBST, followed by chemiluminescent detection.
2.8. Cell culture and treatment
Human umbilical vein endothelial cells (HUVECs) were cultured in specialized medium containing 2 % fetal bovine serum (FBS) at 37 °C with 5 % CO2. Cells were seeded into culture plates and divided into the following groups: blank group, Re group (12.5 μg/ml), ox-LDL group (20 μg/ml), and ox-LDL + Re group (20 μg/ml + 12.5 μg/ml). After reaching 70 % confluence, cells in the drug treatment groups were exposed to the corresponding drug for 24 h and subsequently treated with ox-LDL (20 μg/ml) for 24 h. HUVECs were obtained from Genmei Technology Co., Ltd., and cell passage numbers were <6. Ox-LDL (Cat. YB-002) was purchased from Guangzhou Yiyuan Biotechnology Co., Ltd.
2.9. Cell counting kit (CCK)-8 assay
Cell proliferation was measured using the CCK-8 assay (Cat. WJ30025) according to the manufacturer's instructions. HUVECs were seeded at a density of 1 × 104 cells/well. After incubation as described in Section 2.8, the culture medium was removed, and 100 μl of CCK-8 working solution was added per well. Plates were incubated, and the optical density value (450 nm) was measured by a microplate reader.
2.10. Glucose uptake and lactate measurements
Glucose and lactate levels were measured using commercial assay kits (Beijing Solaibao Company; Cat. 20210303 and Cat. BC2230, respectively) according to the manufacturer's instructions.
2.11. Wound healing assay
HUVECs were seeded into plates for wound healing assays. After 24 h of culture, Re (with or without treatment) was added to each well. Three parallel scratches were made in each well using 200 μL pipette tips. Cells were gently rinsed three times with fresh medium, followed by the addition of medium with or without oxidized low-density lipoprotein. Images were captured at 0 and 12 h at the same magnification (40X) to monitor cell migration.
2.12. Adenovirus transfection
HUVECs were seeded at a density of 3 × 105 cells/well and cultured in an incubator for 24 h. Under appropriate multiplicity of infection conditions, adPFKFB3 adenovirus (Heyuan Biotechnology [Shanghai] Co., Ltd.) was added to the culture system. After 2 h of transfection, FBS containing medium was added to terminate transfection. After 24 h, the medium was replaced with fresh medium. Transfection efficiency was assessed 48 h post-infection, and subsequent experiments were performed.
2.13. Statistical analysis
Data are presented as mean ± standard error of the mean (SEM) and were analyzed using GraphPad Prism 8.0. Data normality was assessed using the Shapiro–Wilk test. For normally distributed data, comparisons between two groups were performed with a two-tailed unpaired t-test. One-way or two-way ANOVA was applied for comparisons among three or more groups, followed by Tukey's multiple comparisons test. For non-normally distributed data, the Kruskal–Wallis test was used. A p-value <0.05 was considered statistically significant.
3. Results
3.1. Re ameliorates dyslipidemia and decreases carotid IMT in atherosclerotic mice
This study evaluated the effect of Re on AS and explored its underlying anti-AS mechanism. Weekly body weight measurements showed that body weight increased from 0 to 3 months in all groups, with the AS group showing the fastest increase. Mice in the low-dose and control groups lost weight at three months, whereas the other groups continued to gain weight. Weight gain in the simvastatin, medium- and high-dose Re groups was slower than in the AS group, but the differences were not statistically significant (Fig. 1B). Because atherosclerotic mice exhibit abnormal lipid metabolism, serum levels of TC, TG, LDL-C, and HDL-C were assessed. AS mice had significantly higher TC, TG, and LDL-C levels and significantly lower HDL-C than the control group (p < 0.01). Both Re and simvastatin improved serum lipid profiles in AS mice, and the effects of Re were dose-dependent (Fig. 1C). Carotid IMT was measured by ultrasound (Fig. 1D–E). Both Re and simvastatin significantly reduced carotid IMT in AS mice but did not affect left ventricular systolic function. Together, these findings demonstrate that Re reduces IMT and improves lipid metabolism in atherosclerotic mice.
Fig. 1.
Re improves blood lipids and reduces IMT in atherosclerotic mice. (A) Flowchart of the study design. (B) Body weight data. (C) Serum levels of TC, TG, LDL-C, and HDL-C (n = 8). (D–E) Carotid IMT measured by ultrasound (n = 10). ###p < 0.001, ##p < 0.01, #p < 0.05 vs. control group, ∗∗∗p < 0.001, ∗∗p < 0.01, ∗p < 0.05, vs. AS group.
3.2. Re effectively ameliorates aortic pathophenotype and reduces inflammatory factor release in atherosclerotic mice
H&E staining, ORO staining, and Masson staining of the aorta of atherosclerotic mice are commonly used pathological methods to evaluate the characteristics and extent of AS. H&E staining revealed that the structural integrity of the aorta in the control group was intact, with uniform wall thickness and no visible damage. There were no morphological or structural abnormalities. In the AS group, significant atherosclerotic plaques were observed, containing cholesterol crystals and foam cells, and the intima attached to the plaques showed marked thickening and structural disarray accompanied by smooth muscle cell proliferation. Compared with the AS group, mice treated with different doses of Re or simvastatin showed lower smoothness of the inner vessel walls, smaller amounts of atherosclerotic plaque, varying degrees of reduction in foam cells and cholesterol crystals, and improved vessel wall thickness (Fig. 2A). Masson staining results showed that Re treatment effectively reduced collagen content in AS mice (p < 0.05) (Fig. 2B–D). ORO staining (Fig. 2C, E, and 2F) revealed that medium-dose Re substantially decreased plaque area and lipid accumulation in AS mice (p < 0.05). AS mice had significantly higher serum levels of TNF-α, IL-1β, and IFN-γ than the control group (p < 0.05). These cytokines were significantly reduced in the Re-treated groups compared with the AS group (p < 0.05) (Fig. 2G). This indicates that Re decreases inflammatory factor levels in AS mice and reduces the inflammatory response.
Fig. 2.
Re improves atherosclerosis. (A–C) Representative images of H&E staining, Masson staining, and ORO staining of the mouse aortic root, n = 3, bar = 100 μm. (D–F) Quantification of collagen content, plaque size, and lipid proportion in the mouse aortic root, n = 3. (G) Levels of TNF-α, IL-1β, IFN-γ, n = 6. ###p < 0.001, ##p < 0.01, #p < 0.05, vs. control group, ∗∗∗p < 0.001, ∗∗p < 0.01, ∗p < 0.05 vs. AS group.
3.3. Re significantly inhibits the mRNA and protein levels of PFKFB3, HIF-1α, and HK2 in atherosclerotic mice
EC glycolysis plays a crucial role in the onset and progression of AS. Inhibiting EC glycolysis is an effective strategy to improve AS. IHC was used to detect the expression of PFKFB3 in aortas. Fig. 3A shows that PFKFB3 expression in the AS group increased significantly (p < 0.01), while Re treatment reduced it (p < 0.05). The mRNA and protein levels of PFKFB3, HK2, and glycolysis-related regulatory factor HIF-1α were also evaluated in mouse aortas. Fig. 3B–C shows that the AS group had up-regulated HIF-1α, HK2, and PFKFB3 (p < 0.05). Re treatment significantly reduced this upregulation. The results indicate that glycolysis in the aorta of AS mice is abnormal and that Re can reverse these abnormalities.
Fig. 3.
Re inhibits glycolysis in mice. (A) Representative image of PFKFB3 expression in mouse aortic root detected by immunohistochemistry (IHC), n = 3, bar = 100 μm. (B) PFKFB3, HIF-1α, and HK2 mRNA levels in the aorta, n = 3. (C) Western blotting assay and quantitative data of HIF-1α, HK2, and PFKFB3 in aorta, n = 3. ###p < 0.001, ##p < 0.01, #p < 0.05, vs. control group, ∗∗∗p < 0.001, ∗∗p < 0.01, ∗p < 0.05 vs. AS group.
3.4. Re inhibits ox-LDL-induced proliferation and migration of HUVECs
Endothelial proliferation and migration are critical processes in the development of AS. Previous studies have demonstrated that knocking out or inhibiting PFKFB3 effectively suppresses EC proliferation and migration. Consistent with these findings, Fig. 4A and B shows that CCK-8 assays confirmed that Re significantly inhibited ox-LDL-induced EC proliferation (p < 0.05). The effect of Re on EC migration was further investigated using wound healing assays. As shown in Fig. 4C and D, ox-LDL increased directional migration of ECs, but this effect was reversed by Re (p < 0.05). VEGFA-VEGFR2 and VE-cadherin play important roles in EC migration. VEGFA-VEGFR2 is involved in angiogenesis by regulating mitogenic signaling and migratory activity [25]. VEGFAx induces a reduced maximal response compared with VEGF165a [26]. However, VEGFAx has also been shown to enhance vascular permeability and ex vivo migration of HUVECs [27]. The VEGFA ligand stimulates endothelial cell proliferation, survival, and migration by binding to VEGFR [28]. Endothelial cell-cell interactions are mediated by VE-cadherin-based adherens junctions (AJs), whose stability promotes the integrity of newly formed blood vessels. Consequently, normal sprouting, angiogenesis, and vascular barrier function require strict regulatory mechanisms that govern the formation and disassembly of endothelial cell-cell contacts[[29], [30], [31]]. EC migration is a critical step in angiogenesis. VE-cadherin is a marker of endothelial activation and a key protein in intercellular connections. Treatment with Re successfully restored the elevated expression of VE-cadherin and VEGFR2 caused by ox-LDL (Fig. 4E). In summary, Re inhibits ox-LDL-induced EC proliferation and migration.
Fig. 4.
Re suppresses ox-LDL-induced HUVEC proliferation and migration. (A, B) Results of the CCK-8 assay, n = 6. (C) Representative images of HUVECs at 0 h and 12 h after ox-LDL induction in wound healing experiments, bar = 50 μm. (D) Quantification of EC migration in the wound healing assay, n = 3. (E) Western blot assay and quantitative data of VE-cadherin and VEGFR2 in HUVECs, n = 3. ###p < 0.001, ##p < 0.01, #p < 0.05, vs. control group, ∗∗∗p < 0.001, ∗∗p < 0.01, ∗p < 0.05, vs. ox-LDL group.
3.5. Re inhibits glycolysis in human umbilical vein endothelial cells
Elevated lactate concentrations reflect metabolically adapted pathological angiogenesis and are clinically associated with several cancers. PFKFB3, HIF-1α, and HK2 are key enzymes regulating the glycolytic activity of ECs. To examine the effect of Re on glycolysis, we measured glucose uptake, lactate efflux, and mRNA levels of glycolysis-related enzymes after Re treatment. As shown in Fig. 5A–C, Re significantly reduced lactate production, glucose uptake, and expression of glycolysis-related enzymes (p < 0.05). Molecular docking analysis suggested potential binding interactions between Re and PFKFB3 (binding free energy = − 8.5 kcal/mol, Fig. 5E), HIF-1α (−7.2 kcal/mol, Fig. 5F), and HK2 (−8.3 kcal/mol, Fig. 5G). Taken together, these findings indicate that Re modulates EC glycolysis, particularly through its interaction with the key glycolytic enzyme PFKFB3.
Fig. 5.
Re inhibits ox-LDL-induced glycolysis of HUVECs. (A) Glucose uptake by HUVECs, n = 3. (B) Lactate efflux by HUVECs, n = 3. (C) mRNA expression of PFKFB3, HIF-1α, and HK2 in HUVECs, n = 3. (D) Structural formula of ginsenoside Re. (E–G) Predicted binding sites of Re to PFKFB3, HIF-1α, and HK2 by molecular docking. ###p < 0.001, ##p < 0.01, #p < 0.05, vs. control group; ∗∗∗p < 0.001, ∗∗p < 0.01, ∗p < 0.05, vs. ox-LDL group.
3.6. Re inhibits endothelial cell migration by suppressing the PFKFB3-HIF-1α/VEGFA-VEGFR2 signaling pathway
Glycolysis provides the energy required for EC proliferation and migration and is critical in the initiation and progression of AS. Our findings indicate that the glycolysis-related protein PFKFB3 is involved in Re's prevention of ox-LDL-induced EC migration. To investigate whether Re exerts its anti-atherosclerotic effects by regulating vascular EC migration through PFKFB3, we constructed an endothelial cell model overexpressing PFKFB3 in vitro (Fig. 6A–C). Wound healing experiments demonstrated that ECs overexpressing PFKFB3 exhibited enhanced directional migration after ox-LDL induction (p < 0.01). In this model, the inhibitory effect of Re on EC migration was attenuated (p > 0.05), suggesting that Re suppresses ox-LDL-induced migration by targeting PFKFB3 (Fig. 6D and E). To further explore the underlying mechanisms, prior studies have shown that PFKFB3 promotes cell migration and proliferation by modulating the VEGFA-VEGFR2 pathway [32]. Consistent with this, Western Blot analysis (Fig. 6F and G) demonstrated that PFKFB3 overexpression significantly increased ox-LDL-induced expression of HIF-1α, VE-cadherin, and VEGFA-VEGFR2 in ECs. In the PFKFB3 overexpression model, Re no longer exerted regulatory effects on these proteins. In summary, Re regulates EC migration and exerts anti-atherosclerotic activity by inhibiting PFKFB3-mediated glycolysis/HIF-1α/VEGFA-VEGFR2 signaling.
Fig. 6.
Re inhibits endothelial cell migration via the PFKFB3-HIF-1α/VEGFA-VEGFR2 signaling pathways. (A) Western blot assay and quantitative analysis of PFKFB3 in HUVECs, n = 3. (B) Cell viability of PFKFB3 overexpressing ECs measured by CCK-8 assay, n = 6. (C) Western blot assay and quantitative analysis of PFKFB3 in HUVECs, n = 3. (D–E) Representative images of HUVEC induced by ox-LDL for 0 h and 12 h in wound healing experiments (bar = 50 μm) and quantification of EC migration, n = 3. (F, G) Western blot assay and quantitative data of VE-cadherin, HIF-1α, VEGFA, and VEGFR2 in HUVECs, n = 3. ###p < 0.001, ##p < 0.01, #p < 0.05, vs. control group; ∗∗∗p < 0.001, ∗∗p < 0.01, ∗p < 0.05, vs. ox-LDL group.
4. Discussion
Atherosclerosis arises from complex interactions involving endothelial injury, lipid imbalance, inflammation, and oxidative stress. Although progress has been made in understanding its mechanisms, existing clinical therapies mainly focus on prevention and symptom relief [33]. Therefore, it is essential to identify more effective and broadly applicable treatment strategies for AS. An increasing body of evidence suggests that Chinese herbal medicine offers unique advantages in the management of AS. Among these, P. ginseng is widely used in both the prevention and treatment of AS. Clinical studies have shown that P. ginseng extract (GE) reduces lipid levels, inhibits inflammation, and suppresses glycolysis[[34], [35], [36], [37], [38]]. Re, one of the major active components of P. ginseng, has been reported to protect against AS by scavenging reactive oxygen species [39]. However, its specific mechanisms remain to be fully elucidated. In this study, we further explored the role of EC glycolysis, proliferation, and migration in AS. Our findings demonstrate that Re inhibits EC migration and attenuates AS by regulating the PFKFB3/HIF-1α and VEGFA-VEGFR2 signaling pathways.
AS is a pathological disease characterized by fibroproliferation, chronic inflammation, and lipid accumulation in the arterial wall. A normal artery wall consists of three layers: adventitia, media, and intima. The innermost layer is a monolayer of ECs [40]. AS is initiated by endothelial dysfunction, during which oxidized LDL accumulates at the site of injury. Damaged ECs secrete adhesion factors that recruit monocytes and promote their differentiation into macrophages. The macrophages subsequently transform into foam cells. The accumulation of foam cells leads to plaque formation [41], which thickens the arterial wall. Concurrently, smooth muscle cells from the media proliferate and migrate into the intima, covering the plaque with a fibrous cap. Rupture of the fibrous cap releases plaque contents into the bloodstream, resulting in thrombus formation [42]. The present study demonstrates that oral administration of Re improves dyslipidemia and reduces lipid deposition in atherosclerotic mice. Re also downregulates the serum inflammatory factors TNF-α and IL-1β, findings consistent with previous reports [39]. Prior studies have indicated that the aortic IMT of atherosclerotic mice increases, which may impair cardiac function[[43], [44], [45], [46]]. Using small animal ultrasonography, we observed that aortic IMT was significantly increased in AS mice, while Re treatment effectively inhibited this thickening. Aortic inflammatory infiltration and fibrosis are critical features of AS lesions in ApoE −/− mice [42]. Our results show that Re substantially reduced inflammation, lipid deposition, and collagen accumulation in the aorta of atherosclerotic mice.
Studies have found that glycolysis in aortic endothelial cells is greatly elevated in atherosclerosis models [47,48]. Glycolysis is a sequence of reactions that degrade glucose to pyruvate while generating ATP. ECs regulate vascular homeostasis, and their activation or dysfunction compromises barrier integrity, leading to vascular inflammation and atherosclerosis [49]. Mitochondria in ECs account for only 2–6 % of total cytoplasmic volume. Compared with mitochondria-mediated oxidative phosphorylation, glycolysis provides bioenergy more rapidly and is therefore the primary source of energy for endothelial activation or impaired function [50]. Therefore, EC metabolism must be considered in AS, and the effect of Re on glucose metabolism in ECs warrants investigation. During glycolysis, the enzymes hexokinase (HK), phosphofructokinase-1, and pyruvate kinase catalyze three irreversible reactions, making them critical regulatory nodes [51]. Deletion of HIF-1α in ECs ameliorates AS in mice [52]. Conversely, HIF-1α exacerbates AS by upregulating glycolysis, thereby promoting inflammation and inducing EC hyperproliferation [53]. Our results showed that Re significantly downregulated the mRNA and protein expression of PFKFB3, HK2, and HIF-1α. These findings support the hypothesis that Re may improve AS by inhibiting EC glycolysis.
Research has shown that enhanced glycolysis drives cell invasion and pannus formation. It also elevates lactate levels, which promote cell migration by creating an acidic microenvironment [54,55]. We assessed cell proliferation and migration using CCK-8 and wound healing assays. Re was found to inhibit ox-LDL-induced proliferation and migration of HUVECs. More critically, Re suppressed the ox-LDL-induced increases in glucose uptake and lactate production in ECs, as well as the elevated mRNA expression of glycolysis-related proteins PFKFB3, HIF-1α, and HK2. In addition, Re reversed ox-LDL-induced upregulation of EC proliferation- and migration-related proteins VE-cadherin and VEGFR2. These findings indicate that Re inhibits EC proliferation and migration by suppressing glycolysis.
PFKFB3 regulates multiple endothelial cell activities, including directed migration. Silencing PFKFB3 directly affects VEGFR2 activation and enhances endothelial adhesion [56]. Blocking PFKFB3 reduces VE-cadherin turnover and impairs endothelial barrier repair [57]. The mechanism by which PFKFB3 silencing decreases EC migration involves reduced local ATP production in lamellipodia, along with lower lactate levels, HIF-1α, and VEGFR2 expression [19,[58], [59], [60]]. Our results suggest that Re may interact with PFKFB3 through molecular docking. To further determine whether Re functions as a PFKFB3 inhibitor and thereby suppresses endothelial migration by regulating glycolysis, we established a PFKFB3 overexpression system. We found that ox-LDL-induced EC migration was further enhanced by PFKFB3 expression, while the inhibitory effect of Re on ox-LDL-induced EC migration was abolished. These results demonstrate that Re targets PFKFB3 and support its therapeutic application in the treatment of AS.
5. Conclusion
Our results demonstrate that Re is effective in treating atherosclerosis in mice. The underlying mechanism may involve inhibition of the PFKFB3/HIF-1α/VEGFA-VEGFR2 pathway, leading to reduced endothelial glycolysis and consequently impaired endothelial cell migration.
Authorship
Zhihui Wang: Writing - original draft, methodology, validation, investigation, formal analysis, data curation, and conceptualization. Junyu Mou: validation, investigation, formal analysis, and data curation. Wen Han: investigation, formal analysis, and data curation. Siyuan Liu: investigation and data curation. Min Wang: methodology and correction. Guibo Sun: supervision, project administration, funding acquisition, and conceptualization.
Funding
This study was supported by the CAMS Innovation Fund for Medical Sciences (CIFMS) (2021-I2M-1–031) and the National Key Research and Development Program of China (2023YFD2201802).
Declaration of competing interest
The authors declare no conflicts of interest.
Acknowledgements
The graphical summary was created using BioGDP.com and has been licensed for use and publication.
Footnotes
Supplementary data to this article can be found online at https://doi.org/10.1016/j.jgr.2025.11.012.
Contributor Information
Min Wang, Email: lily_12506053@163.com.
Guibo Sun, Email: sunguibo@126.com.
Appendix A. Supplementary data
The following is the Supplementary data to this article:
Data availability
Data are available from the authors on request.
References
- 1.Chen W., Li Z., Zhao Y., Chen Y., Huang R. Global and national burden of atherosclerosis from 1990 to 2019: trend analysis based on the global burden of disease study 2019. Chin Med J (Engl) 2023;136:2442–2450. doi: 10.1097/CM9.0000000000002839. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Developed with the special contribution of: European Association for Cardiovascular Prevention & Rehabilitation, Authors/Task Force Members. Reiner Z., Catapano A.L., De Backer G., Graham I. ESC/EAS guidelines for the management of dyslipidaemias: the task force for the management of dyslipidaemias of the european society of cardiology (ESC) and the european atherosclerosis society (EAS) Eur Heart J. 2011;32:1769–1818. doi: 10.1093/eurheartj/ehr158. et al. [DOI] [PubMed] [Google Scholar]
- 3.Nordestgaard B.G., Nicholls S.J., Langsted A., Ray K.K., Tybjærg-Hansen A. Advances in lipid-lowering therapy through gene-silencing technologies. Nat Rev Cardiol. 2018;15:261–272. doi: 10.1038/nrcardio.2018.3. [DOI] [PubMed] [Google Scholar]
- 4.Kita T., Nagano Y., Yokode M., Ishii K., Kume N., Ooshima A., et al. Probucol prevents the progression of atherosclerosis in watanabe heritable hyperlipidemic rabbit, an animal model for familial hypercholesterolemia. Proc Natl Acad Sci U S A. 1987;84:5928–5931. doi: 10.1073/pnas.84.16.5928. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Han L., Yang Q., Shen T., Qing J., Wang J. Lymphatic transport of orally administered probucol-loaded mPEG-DSPE micelles. Drug Deliv. 2015:1–7. doi: 10.3109/10717544.2015.1028600. [DOI] [PubMed] [Google Scholar]
- 6.Stroes E.S., Thompson P.D., Corsini A., Vladutiu G.D., Raal F.J., Ray K.K., et al. Statin-associated muscle symptoms: impact on statin therapy—European atherosclerosis society consensus panel statement on assessment, aetiology and management. Eur Heart J. 2015;36:1012–1022. doi: 10.1093/eurheartj/ehv043. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Mora S., Manson J.E. Aspirin for primary prevention of atherosclerotic cardiovascular disease: advances in diagnosis and treatment. JAMA Intern Med. 2016;176:1195. doi: 10.1001/jamainternmed.2016.2648. [DOI] [PubMed] [Google Scholar]
- 8.Gimbrone M.A. Vascular endothelium, hemodynamic forces, and atherogenesis. Am J Pathol. 1999;155:1–5. doi: 10.1016/S0002-9440(10)65090-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Lusis A.J. Atherosclerosis. Nature. 2000;407:233–241. doi: 10.1038/35025203. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Xu R., Yuan W., Wang Z. Advances in glycolysis metabolism of atherosclerosis. J Cardiovasc Transl Res. 2023;16:476–490. doi: 10.1007/s12265-022-10311-3. [DOI] [PubMed] [Google Scholar]
- 11.Vander Heiden M.G., Cantley L.C., Thompson C.B. Understanding the warburg effect: the metabolic requirements of cell proliferation. Science. 2009;324:1029–1033. doi: 10.1126/science.1160809. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Pfeiffer T., Schuster S., Bonhoeffer S. Cooperation and competition in the evolution of ATP-producing pathways. Science. 2001;292:504–507. doi: 10.1126/science.1058079. [DOI] [PubMed] [Google Scholar]
- 13.De Bock K., Georgiadou M., Schoors S., Kuchnio A., Wong B.W., Cantelmo A.R., et al. Role of PFKFB3-driven glycolysis in vessel sprouting. Cell. 2013;154:651–663. doi: 10.1016/j.cell.2013.06.037. [DOI] [PubMed] [Google Scholar]
- 14.Schoors S., De Bock K., Cantelmo A.R., Georgiadou M., Ghesquière B., Cauwenberghs S., et al. Partial and transient reduction of glycolysis by PFKFB3 blockade reduces pathological angiogenesis. Cell Metab. 2014;19:37–48. doi: 10.1016/j.cmet.2013.11.008. [DOI] [PubMed] [Google Scholar]
- 15.Yu P., Wilhelm K., Dubrac A., Tung J.K., Alves T.C., Fang J.S., et al. FGF-dependent metabolic control of vascular development. Nature. 2017;545:224–228. doi: 10.1038/nature22322. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Xu Y., An X., Guo X., Habtetsion T.G., Wang Y., Xu X., et al. Endothelial 6-phosphofructo-2-kinase (PFKFB3) plays a critical role in angiogenesis. Arterioscler Thromb Vasc Biol. 2014;34:1231–1239. doi: 10.1161/ATVBAHA.113.303041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Pisarsky L., Bill R., Fagiani E., Dimeloe S., Goosen R.W., Hagmann J., et al. Targeting metabolic symbiosis to overcome resistance to anti-angiogenic therapy. Cell Rep. 2016;15:1161–1174. doi: 10.1016/j.celrep.2016.04.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Zlacká J., Murár M., Addová G., Moravčík R., Boháč A., Zeman M. Synthesis of glycolysis inhibitor PFK15 and its synergistic action with an approved multikinase antiangiogenic drug on human endothelial cell migration and proliferation. Int J Mol Sci. 2022;23 doi: 10.3390/ijms232214295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Hunt T.K., Aslam R.S., Beckert S., Wagner S., Ghani Q.P., Hussain M.Z., et al. Aerobically-derived lactate stimulates revascularization and tissue repair via redox mechanisms. Antioxidants Redox Signal. 2007;9:1115–1124. doi: 10.1089/ars.2007.1674. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Vandekeere S., Dewerchin M., Carmeliet P. Angiogenesis revisited: an overlooked role of endothelial cell metabolism in vessel sprouting. Microcirc (n Y NY: 1994) 2015;22:509–517. doi: 10.1111/micc.12229. [DOI] [PubMed] [Google Scholar]
- 21.Perrotta P., de Vries M.R., Peeters B., Guns P.-J., De Meyer G.R.Y., Quax P.H.A., et al. PFKFB3 gene deletion in endothelial cells inhibits intraplaque angiogenesis and lesion formation in a murine model of venous bypass grafting. Angiogenesis. 2022;25:129–143. doi: 10.1007/s10456-021-09816-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Lim K.H., Lim D.-J., Kim J.-H. Ginsenoside-re ameliorates ischemia and reperfusion injury in the heart: a hemodynamics approach. J Ginseng Res. 2013;37:283–292. doi: 10.5142/jgr.2013.37.283. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Yu L.-C., Chen S.-C., Chang W.-C., Huang Y.-C., Lin K.M., Lai P.-H., et al. Stability of angiogenic agents, ginsenoside Rg1 and re, isolated from panax ginseng: in vitro and in vivo studies. Int J Pharm. 2007;328:168–176. doi: 10.1016/j.ijpharm.2006.08.009. [DOI] [PubMed] [Google Scholar]
- 24.Huang Y.-C., Chen C.-T., Chen S.-C., Lai P.-H., Liang H.-C., Chang Y., et al. A natural compound (ginsenoside re) isolated from panax ginseng as a novel angiogenic agent for tissue regeneration. Pharm Res. 2005;22:636–646. doi: 10.1007/s11095-005-2500-3. [DOI] [PubMed] [Google Scholar]
- 25.Abel T., Moodley J., Khaliq O.P., Naicker T. Vascular endothelial growth factor receptor 2: molecular mechanism and therapeutic potential in preeclampsia comorbidity with human immunodeficiency virus and severe acute respiratory syndrome coronavirus 2 infections. Int J Mol Sci. 2022;23 doi: 10.3390/ijms232213752. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Eswarappa S.M., Potdar A.A., Koch W.J., Fan Y., Vasu K., Lindner D., et al. Programmed translational readthrough generates anti-angiogenic VEGF-ax. Cell. 2014;157:1605–1618. doi: 10.1016/j.cell.2014.04.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Xin H., Zhong C., Nudleman E., Ferrara N. Evidence for pro-angiogenic functions of VEGF-ax. Cell. 2016;167:275–284.e6. doi: 10.1016/j.cell.2016.08.054. [DOI] [PubMed] [Google Scholar]
- 28.Peach C.J., Mignone V.W., Arruda M.A., Alcobia D.C., Hill S.J., Kilpatrick L.E., et al. Molecular pharmacology of VEGF-a isoforms: binding and signalling at VEGFR2. Int J Mol Sci. 2018;19:1264. doi: 10.3390/ijms19041264. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Vestweber D., Winderlich M., Cagna G., Nottebaum A.F. Cell adhesion dynamics at endothelial junctions: VE-cadherin as a major player. Trends Cell Biol. 2009;19:8–15. doi: 10.1016/j.tcb.2008.10.001. [DOI] [PubMed] [Google Scholar]
- 30.Dejana E., Orsenigo F., Lampugnani M.G. The role of adherens junctions and VE-cadherin in the control of vascular permeability. J Cell Sci. 2008;121:2115–2122. doi: 10.1242/jcs.017897. [DOI] [PubMed] [Google Scholar]
- 31.Dorland Y.L., Huveneers S. Cell–cell junctional mechanotransduction in endothelial remodeling. Cell Mol Life Sci: CMLS. 2016;74:279–292. doi: 10.1007/s00018-016-2325-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Abdali A., Baci D., Damiani I., Belloni F., De Dominicis C., Gelmi M.L., et al. In vitro angiogenesis inhibition with selective compounds targeting the key glycolytic enzyme PFKFB3. Pharmacol Res. 2021;168 doi: 10.1016/j.phrs.2021.105592. [DOI] [PubMed] [Google Scholar]
- 33.Liu Y., Lu K., Zhang R., Hu D., Yang Z., Zeng J., et al. Advancements in the treatment of atherosclerosis: from conventional therapies to cutting-edge innovations. ACS Pharmacol Transl Sci. 2024;7:3804–3826. doi: 10.1021/acsptsci.4c00574. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Li J.-N., Wang M.-Y., Tan Y.-R., Wang L.-L. Multidirectional intervention of Chinese herbal medicine in the prevention and treatment of atherosclerosis: from endothelial protection to immunomodulation. Am J Chin Med. 2024;52:925–947. doi: 10.1142/S0192415X24500381. [DOI] [PubMed] [Google Scholar]
- 35.Wei Q., Ren Y., Zheng X., Yang S., Lu T., Ji H., et al. Ginsenoside Rg3 and sorafenib combination therapy relieves the hepatocellular carcinomaprogression through regulating the HK2-mediated glycolysis and PI3K/akt signaling pathway. Bioengineered. 2022;13:13919–13928. doi: 10.1080/21655979.2022.2074616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Zhang S., Zhang M., Chen J., Zhao J., Su J., Zhang X. Ginsenoside compound K regulates HIF-1α-mediated glycolysis through Bclaf1 to inhibit the proliferation of human liver cancer cells. Front Pharmacol. 2020;11 doi: 10.3389/fphar.2020.583334. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Sun X., Zhao P., Li H., Liu Y., Wang T., Cheng Y. Ginsenoside RH2 inhibits glycolysis through the STAT3/c-MYC axis in non-small-cell lung cancer. J Oncol. 2021;2021 doi: 10.1155/2021/9715154. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Liu X., Li J., Huang Q., Jin M., Huang G. Ginsenoside RH2 shifts tumor metabolism from aerobic glycolysis to oxidative phosphorylation through regulating the HIF1-α/PDK4 axis in non-small cell lung cancer. Mol Med. 2024;30:56. doi: 10.1186/s10020-024-00813-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Shen J.-W., Li C., Yang M.-Y., Lin J.-F., Yin M.-D., Zou J.-J., et al. Biomimetic nanoparticles: U937 cell membranes based core–shell nanosystems for targeted atherosclerosis therapy. Int J Pharm. 2022;611 doi: 10.1016/j.ijpharm.2021.121297. [DOI] [PubMed] [Google Scholar]
- 40.Libby P. The changing landscape of atherosclerosis. Nature. 2021;592:524–533. doi: 10.1038/s41586-021-03392-8. [DOI] [PubMed] [Google Scholar]
- 41.Chistiakov D.A., Melnichenko A.A., Myasoedova V.A., Grechko A.V., Orekhov A.N. Mechanisms of foam cell formation in atherosclerosis. J Mol Med. 2017;95:1153–1165. doi: 10.1007/s00109-017-1575-8. [DOI] [PubMed] [Google Scholar]
- 42.Libby P., Buring J.E., Badimon L., Hansson G.K., Deanfield J., Bittencourt M.S., et al. Atherosclerosis. Nat Rev Dis Primers. 2019;5:56. doi: 10.1038/s41572-019-0106-z. [DOI] [PubMed] [Google Scholar]
- 43.Picano E., Pierard L., Peteiro J., Djordjevic-Dikic A., Sade L.E., Cortigiani L., et al. The clinical use of stress echocardiography in chronic coronary syndromes and beyond coronary artery disease: a clinical consensus statement from the european association of cardiovascular imaging of the ESC. Eur Heart J Cardiovasc Imaging. 2024;25:e65–e90. doi: 10.1093/ehjci/jead250. [DOI] [PubMed] [Google Scholar]
- 44.Fernández-Alvarez V., Linares Sánchez M., López Alvarez F., Suárez Nieto C., Mäkitie A.A., Olsen K.D., et al. Evaluation of intima-media thickness and arterial stiffness as early ultrasound biomarkers of carotid artery atherosclerosis. Cardiol Ther. 2022;11:231–247. doi: 10.1007/s40119-022-00261-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Khosravi M., Sheikhnia F., Pashaei M.R., Karimi-Dehkordi M., Alizadeh-Fanalou S. Association between small dense low-density lipoprotein and carotid intima-media thickness. J Cardiovasc Thorac Res. 2024;16:202–210. doi: 10.34172/jcvtr.33145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Zhang X., Ha S., Wei W., Duan S., Shi Y., Yang Y. Noninvasive imaging of aortic atherosclerosis by ultrasound biomicroscopy in a mouse model. J Ultrasound Med. 2015;34:111–116. doi: 10.7863/ultra.34.1.111. [DOI] [PubMed] [Google Scholar]
- 47.Sarrazy V., Viaud M., Westerterp M., Ivanov S., Giorgetti-Peraldi S., Guinamard R., et al. Disruption of Glut1 in hematopoietic stem cells prevents myelopoiesis and enhanced glucose flux in atheromatous plaques of ApoE−/− mice. Circ Res. 2016;118:1062–1077. doi: 10.1161/CIRCRESAHA.115.307599. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Yamashita A., Zhao Y., Matsuura Y., Yamasaki K., Moriguchi-Goto S., Sugita C., et al. Increased metabolite levels of glycolysis and pentose phosphate pathway in rabbit atherosclerotic arteries and hypoxic macrophage. PLoS One. 2014;9 doi: 10.1371/journal.pone.0086426. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Gimbrone M.A., García-Cardeña G. Endothelial cell dysfunction and the pathobiology of atherosclerosis. Circ Res. 2016;118:620–636. doi: 10.1161/CIRCRESAHA.115.306301. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Ali L., Schnitzler J.G., Kroon J. Metabolism: the road to inflammation and atherosclerosis. Curr Opin Lipidol. 2018;29:474–480. doi: 10.1097/MOL.0000000000000550. [DOI] [PubMed] [Google Scholar]
- 51.Soto‐Heredero G., Gómez de las Heras M.M., Gabandé‐Rodríguez E., Oller J., Mittelbrunn M. Glycolysis – a key player in the inflammatory response. FEBS J. 2020;287:3350–3369. doi: 10.1111/febs.15327. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Akhtar S., Hartmann P., Karshovska E., Rinderknecht F.-A., Subramanian P., Gremse F., et al. Endothelial hypoxia-inducible factor-1α promotes atherosclerosis and monocyte recruitment by upregulating MicroRNA-19a. Hypertension. 2015;66:1220–1226. doi: 10.1161/HYPERTENSIONAHA.115.05886. [DOI] [PubMed] [Google Scholar]
- 53.Feng S., Bowden N., Fragiadaki M., Souilhol C., Hsiao S., Mahmoud M., et al. Mechanical activation of hypoxia-inducible factor 1α drives endothelial dysfunction at atheroprone sites. Arterioscler Thromb Vasc Biol. 2017;37:2087–2101. doi: 10.1161/ATVBAHA.117.309249. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Fearon U., Hanlon M.M., Floudas A., Veale D.J. Cellular metabolic adaptations in rheumatoid arthritis and their therapeutic implications. Nat Rev Rheumatol. 2022;18:398–414. doi: 10.1038/s41584-022-00771-x. [DOI] [PubMed] [Google Scholar]
- 55.Buckley C.D., Ospelt C., Gay S., Midwood K.S. Location, location, location: how the tissue microenvironment affects inflammation in RA. Nat Rev Rheumatol. 2021;17:195–212. doi: 10.1038/s41584-020-00570-2. [DOI] [PubMed] [Google Scholar]
- 56.Cruys B., Wong B.W., Kuchnio A., Verdegem D., Cantelmo A.R., Conradi L.-C., et al. Glycolytic regulation of cell rearrangement in angiogenesis. Nat Commun. 2016;7 doi: 10.1038/ncomms12240. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Li L., Wang M., Ma Q., Ye J., Sun G. Role of glycolysis in the development of atherosclerosis. Am J Physiol Cell Physiol. 2022;323:C617–C629. doi: 10.1152/ajpcell.00218.2022. [DOI] [PubMed] [Google Scholar]
- 58.De Bock K., Georgiadou M., Schoors S., Kuchnio A., Wong B.W., Cantelmo A.R., et al. Role of PFKFB3-driven glycolysis in vessel sprouting. Cell. 2013;154:651–663. doi: 10.1016/j.cell.2013.06.037. [DOI] [PubMed] [Google Scholar]
- 59.Liu Z., Fan F., Wang A., Zheng S., Lu Y. Dll4-notch signaling in regulation of tumor angiogenesis. J Cancer Res Clin Oncol. 2014;140:525–536. doi: 10.1007/s00432-013-1534-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Vandekeere S., Dewerchin M., Carmeliet P. Angiogenesis revisited: an overlooked role of endothelial cell metabolism in vessel sprouting. Microcirc (n Y NY: 1994) 2015;22:509–517. doi: 10.1111/micc.12229. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data are available from the authors on request.







