Skip to main content
Frontiers in Endocrinology logoLink to Frontiers in Endocrinology
. 2026 Feb 19;17:1754106. doi: 10.3389/fendo.2026.1754106

Novel loss-of-function SPAG17 homozygous variant segregated in a family with severe asthenozoospermia: upgrading gene-disease validity to strong

Li Wang 1,†, Jinli Li 2,†, Ling Huang 1, Jialing Wang 1, Li Zhou 1, Li Ding 1, Jia Li 1, Qinghua Zhang 3,4,*, Junyu Zhang 2,*, Guangmei Xie 1,*
PMCID: PMC12960102  PMID: 41798191

Abstract

Background

Severe asthenozoospermia is a significant cause of male infertility, commonly associated with genetic defects affecting sperm motility. However, the specific genetic contributors remain underexplored.

Objective

This study aimed to identify a genetic variant responsible for severe asthenozoospermia in two siblings and to evaluate the clinical validity of the gene-disease relationship between SPAG17 and this condition.

Methods

Whole exome sequencing (WES) was performed on two siblings diagnosed with severe asthenozoospermia. Sperm motility and morphology were assessed through standard semen analysis and transmission electron microscopy (TEM). The gene-disease validity was evaluated using the ClinGen Gene–Disease Validity SOP, incorporating both genetic and experimental evidence.

Results

A novel homozygous nonsense variant in SPAG17 (NM_206996.4: c.2188C>T; p.Q730*) was identified in both affected siblings. Semen analysis revealed significantly reduced sperm motility and abnormal sperm morphology, including malformed flagella. TEM showed severe axonemal defects, such as absent central-pair microtubules and disorganized axonemal structures. The gene-disease validity between SPAG17 and severe asthenozoospermia was upgraded to “Strong”, with a cumulative score of 13.4 points based on genetic (9.4 points) and experimental (4 points) evidence.

Conclusion

We identified a novel homozygous nonsense variant in SPAG17 in two siblings with severe asthenozoospermia, emphasizing its critical role in sperm motility and male fertility. The upgraded “Strong” gene-disease validity strengthens SPAG17’s clinical utility for genetic diagnostics and counseling.

Keywords: gene-disease validity, male infertility, severe asthenozoospermia, SPAG17, sperm ultrastructural abnormalities

1. Introduction

Sperm motility is a crucial determinant of fertility, which represents a fundamental feature of flagellate spermatozoa and playing a vital role in the fertilization process (1). Asthenozoospermia is a major cause of male infertility, affecting approximately 19% of infertile patients. It is defined by a progressive motility (PR) rate of spermatozoa below 32% (2). Asthenozoospermia has been attributed to various factors, including genetic causes, lifestyle, environmental pollutants, prolonged sexual abstinence, partial blockage of the seminal tract, varicocele, and infections (3–6). Although genetic deficiencies are significant causal factors (7), the specific genetic contributors to this condition remain largely unexplored.

SPAG17 encodes a protein located in the axoneme central pair complex of motile cilia and flagella (8). Previous studies in chlamydomonas have demonstrated that PF6, the ortholog of the mammalian SPAG17 protein, is critical for flagellar motility (9). Spag17 knockout mice exhibit infertility due to a severe defect in spermatogenesis. Histological analysis of testis sections from mutant mice revealed seminiferous tubules with spermatogenesis arrested at the spermatid stage. The few sperm retrieved from the cauda epididymis were immotile and exhibited abnormalities morphology (8). According to reports, several male cases with infertility carry homozygous variants in the SPAG17 gene (10–12). These findings collectively underscore the critical role of SPAG17 in sperm development, motility, and male fertility.

Despite this accumulating evidence, a formal evaluation of the clinical validity of the gene-disease association between SPAG17 and severe asthenozoospermia has not been thoroughly performed. Evaluating the clinical validity of the gene-disease relationship is essential for variant classification and clinical interpretation (13). The Clinical Genome Resource (ClinGen) has developed a semiquantitative points-based framework to assign clinical validity classifications to gene–disease relationships (14, 15). Clinical validity is categorized as definitive (12–18 points, replicated over time), strong (12–18 points), moderate (7–11 points), limited (0.1–6 points), no known disease relationship (0 points), disputed (contradictory evidence), or refuted (contradictory evidence outweighs supportive evidence). The ACMG recommends that variants in moderate genes should generally not be classified higher than Likely Pathogenic, and variants in genes with poorly understood disease-gene relationships (Limited, Disputed, Refuted) should not be classified higher than variants of uncertain significance (16).

In this study, we identified a novel homozygous nonsense variant in SPAG17 in two siblings with severe asthenozoospermia significantly contributes to understanding the genetic basis of this condition. The detailed semen analysis and ultrastructural studies revealed profound abnormalities in sperm morphology and flagellar structure, further supporting the involvement of SPAG17 in male infertility. This study, in conjunction with previous reports and emerging reports, substantially enhances the evidence for the gene-disease relationship between SPAG17 and severe asthenozoospermia, elevating the association to a strong strength according to the ClinGen Gene–Disease Validity SOP. These findings underscore the importance of SPAG17 in spermatogenesis and male fertility, providing valuable insights into potential diagnostic and therapeutic approaches for affected individuals.

2. Methods

2.1. Patients and ethics statement

This study received ethical approval from the Gansu Provincial Maternal and Child Health Hospital (Gansu Provincial Central Hospital), and informed consent was obtained from each participant. The brothers with primary infertility and their mother were recruited from the Gansu Provincial Maternal and Child Health Hospital (Gansu Provincial Central Hospital).

2.2. Whole exome sequencing, variant calling, and sequence variant validation

Genomic DNA was isolated from peripheral blood lymphocytes of participants using QIAamp DNA Blood Kits (Qiagen, Hilden, Germany). Library preparation and exome enrichment were conducted using SureSelect Human All Exon V6 (Agilent Technologies, Santa Clara, CA, USA). The prepared libraries were sequenced using the Illumina NovaSeq® 6000 system (Illumina, San Diego, CA, USA). The variants were filtered and prioritized using TGex (https://fa.shanyint.com/, accessed 4 January 2025) (17). The gene variants detected by WES were validated by Sanger sequencing, using the following primers for amplification and sequencing: SPAG17-c2188-F=CCGAGAACCTTCAGATCCTAGTC and SPAG17-c2188-R=AGGGTTGAAATAAAGAGAACTTATGG.

2.3. Literature review and gene–disease clinical validity curation

A comprehensive literature search was conducted using PubMed and Google Scholar to identify publications on the relationship between SPAG17 and male infertility in humans and animal models. Only English-language manuscripts and abstracts were considered. Cases reporting deleterious SPAG17 variants associated with male infertility due to asthenozoospermia were reviewed. The strength of the gene–disease association between SPAG17 and autosomal recessive severe asthenozoospermia was curated following the ClinGen Gene–Disease Validity SOP, version 11 (18).

2.4. Semen parameters and sperm morphology analysis

Semen samples were collected by masturbation and incubated at 37 °C for 30 minutes to achieve liquefaction. Routine semen analysis (volume, sperm concentration, and motility) was performed using the Sperm Class Analyzer CASA System (SCA, Spain) following World Health Organization guidelines (5th Edition) (19). Semen samples from subjects were washed with PBS, fixed in 4% paraformaldehyde (PFA), and stained with Mayer’s hematoxylin and a 1% eosin Y solution (FUJIFILM WakoPure Chemical). Sperm morphology was assessed by examining at least 130 sperm from each sample.

2.5. Transmission electron microscopy

Spermatozoa were immersed in a 2.5% glutaraldehyde solution, washed three times with 0.1 mol/L phosphate buffer (PB, pH 7.2), and postfixed with 1% osmium tetroxide in 0.1 mol/L PB for 1–1.5 hours at 4 °C. Dehydration was performed sequentially using ethanol solutions at concentrations of 50%, 70%, 80%, 95%, and 100%, followed by 100% acetone. Infiltration was then carried out by immersing the samples overnight at 37 °C in a 1:1 mixture of acetone and SPI-Chem resin (containing dodecenyl succinic anhydride, N-methylacetamide, SPI-Pon 812, and DMP-30). After infiltration and embedding in Epon 812 resin, ultrathin sections were stained with uranyl acetate and lead citrate. These sections were then examined and photographed using a TEM (TECNAI-10, Philips) operating at an accelerating voltage of 80 kV.

2.6. Normal controls

For comparative analyses in semen morphology and ultrastructural studies, normal control samples were obtained from three healthy fertile volunteers with normal semen parameters (progressive motility > 40%, normal morphology > 4%) and no history of reproductive disorders. Control samples were processed identically and simultaneously with patient samples under the same laboratory conditions, including fixation, staining, and TEM preparation, to minimize batch effects and pre-analytical variability.

3. Result

3.1. Severe asthenozoospermia and ultrastructural abnormalities in infertile two siblings

The patient and his sibling, with primary infertility durations of 10 and 3 years, respectively, both exhibit severe asthenozoospermia. Sperm motility and progressive motility of them were both significantly below the normal reference values (Table 1). Hematoxylin and eosin (H&E) staining was utilized to evaluate sperm morphology. The sperm from the two patients both exhibited a reduced proportion of morphologically normal sperm and an increased prevalence of abnormalities in flagella, including absent, short, curly, angular, and irregularly calibrated flagella (Figure 1, Table 1). Additionally, transmission electron microscopy (TEM) was used to analyze the ultrastructure of spermatozoa from the two siblings. Strikingly, compared to the regular “9 + 2” axonemal arrangement observed in sperm flagella from normal controls, the spermatozoa from the two patients exhibited absent or disorganized central-pair microtubules (CPs) and irregular or absent outer dense fibers (ODFs) and microtubule doublets (MTDs) in the flagellar midpiece. Additionally, the principal piece showed a loss of most axonemal microtubules, which were irregularly arranged, and the peripheral MTDs or CPs were absent in the end piece.

Table 1.

Clinical assessment of patients carrying SPAG17 variants.

Information II:2 II:3 Reference values
Genotype MT/MT MT/MT
Age (years) 37 34
Years of marriage 10 3
BMI 23.67 19.59
Semen parameters
Semen volume (ml) 3.47±1.19 1.86±0.21 >1.5
Semen pH Alkaline Alkaline Alkaline
Sperm concentration (106/ml, Mean ± SD) 45.7±23.11 77.02±39.40 >15
Motile sperm (%, Mean ± SD) 3.33±1.15 3.20±1.79 >40
Progressively motile sperm (%, Mean ± SD) 2.33±0.58 0.8±0.45 >32
Sperm flagellar morphology
Absent flagella (%) 22.79 10.07 <5.0
Short flagella (%) 15.44 11.51 <1.0
Coiled flagella (%) 23.53 22.3 <17.0
Angulation (%) 16.91 20.14 <13.0
Irregular caliber (%) 13.23 27.34 <2.0
Normal flagella (%) 8.09 8.63 >23.0

Figure 1.

Panel A shows stained sperm from a normal control, individual II:2, and individual II:3 under light microscopy; the control displays more numerous and morphologically normal sperm compared to the two patients. Panel B compares normal and several abnormal sperm to highlight morphological differences. Panel C contains transmission electron micrographs of sperm flagella cross-sections from normal control, II:2, and II:3, illustrating structural defects in the midpiece, principal piece, and end piece, with labels for outer dense fibers (ODF), mitochondria (MTD), and central pair microtubules (CP).

Morphological and ultrastructural analysis of spermatozoa in normal controls and individuals with bi-allelic SPAG17 variants. (A) Morphology of the spermatozoa from normal control and men harboring bi-allelic SPAG17 variants (scale bars, 15 μm). (B) Papanicolaou staining revealed sperm with normal morphology and various abnormal morphologies (scale bars, 15 μm). (C) Representative TEM micrographs display cross-sections of the midpiece, principal piece, and end piece of sperm flagella from normal controls and individuals with bi-allelic SPAG17 variants. The axoneme structure, along with its accessory components illustrated in the diagram, includes peripheral microtubule doublets (DMT), central pairs (CP), and outer dense fibers (ODF) (scale bars, 150 nm).

Additionally, transmission electron microscopy (TEM) was used to analyze the ultrastructure of spermatozoa from the two siblings. A total of 60 cross-sectional flagellar images per individual were evaluated. Compared to the regular “9 + 2” axonemal arrangement observed in controls, patient spermatozoa exhibited absent central-pair microtubules in 82% of cross-sections, disorganized outer dense fibers in 75%, and irregular microtubule doublets in 68%. Representative images are shown in Figure 1C.

3.2. Identification of a homozygous loss-of-function variant in SPAG17 in two siblings affected by severe asthenozoospermia.

Prior to referral, both individuals had underwent unsuccessful intracytoplasmic sperm injection (ICSI) cycles at an external clinic. Subsequent diagnostic genetic testing identified an identical homozygous nonsense variant in SPAG17 (NM_206996.4: c.2188C>T; p.Q730*) in both siblings, resulting in a premature stop codon. Sanger sequencing confirmed homozygosity for the SPAG17 variant in both patients and revealed that their mother was heterozygous for the same variant (Figure 2), consistent with autosomal recessive inheritance. The father, now deceased, could not be tested due to the unavailability of DNA. Following another ICSI cycle combined with assisted oocyte activation (AOA), both individuals achieved live births: II:2 had a daughter, and II:3 had twin daughters.

Figure 2.

Pedigree diagram shows inheritance of a genetic variant across three generations, followed by chromatograms for individuals I:2, II:2, and II:3 depicting c.2188C>T sequence change. I:2 is heterozygous, II:2 and II:3 are homozygous.

Identification of a homozygous SPAG17 variant in two infertile siblings with severe asthenozoospermia. Top: Pedigree of a family with two infertile males (II:2 and II:3), highlighting the proband indicated by an arrow. Bottom: Sanger sequencing chromatograms are shown for the tested individuals. The affected males harbor a homozygous loss-of-function variant in SPAG17.

3.3. The addition of this case upgrades the gene–disease validity between SPAG17 and autosomal recessive severe asthenozoospermia from “Moderate” to “Strong”

The identification of a novel homozygous loss-of-function variant in SPAG17 associated with severe asthenozoospermia prompted a formal evaluation of the gene-disease validity between SPAG17 and severe asthenozoospermia. The curation considered both genetic and experimental evidence. The current cases contributed significant genetic evidence, with 3 points awarded based on the identification of a predicted null variant in an autosomal recessive condition. This was combined with evidence from 4 previous report male cases with infertility harboring two homozygous missense variants and two homozygous loss of function variants in SPAG17 (Table 2) (10–12). Collectively, the cumulative genetic evidence scored 9.4 out of a total of 12 points (Table 3) (15, 18).

Table 2.

Cases with homozygous variants in SPAG17 and severe asthenozoospermia.

Individual Age at diagnosis Variant in SPAG17 Exon Clinical diagnosis Inheritance Reference
II:5 29 NM_206996.4:c.4343G>A p.(Arg1448Gln) 30 Severe asthenozoospermia Homozygous (11)
II:7 29 NM_206996.4:c.4343G>A p.(Arg1448Gln) 30 Severe asthenozoospermia Homozygous (11)
(Patient 1)IV:1 30 NM_206996.2:c.829+1G>T p.(Asp212_Glu276del) 6 multiple morphological abnormalities of the flagella Homozygous (10)
(Patient 2)IV:3 25 NM_206996.2:c.829+1G>T p.(Asp212_Glu276del) 6 multiple morphological abnormalities of the flagella Homozygous (10)
(Patient 3)IV:1 42 NM_206996.4:c.2120del p.(Leu707Ter) 15 multiple morphological abnormalities of the flagella Homozygous (10)
(Patient 4)IV:4 33 NM_206996.4:c.2120del p.(Leu707Ter) 15 multiple morphological abnormalities of the flagella Homozygous (10)
Patient 1 35 NM_206996.4:c.4511A>G p.(Asn1504Ser) − oligoasthenoteratozoospermia Homozygous (12)
Patient 1 34 NM_206996.4:c.2188C>T p.(Gln730Ter) 15 Severe asthenozoospermia Homozygous This study
Patient 2 37 NM_206996.4:c.2188C>T p.(Gln730Ter) 15 Severe asthenozoospermia Homozygous This study

II:5 and II:7 are twins.

Patient 1 and patient 2 are brothers.

(Patient 1)IV:1 and (Patient 2)IV:3 are from one consanguineous Pakistani families.

(Patient 3)IV:1 and (Patient 4)IV:3 are from another consanguineous Pakistani families.

Table 3.

Genetic evidence summary matrix for evaluating the strength of the gene-disease validity between SPAG17 and autosomal recessive male infertility.

Genetic evidence: case-level data
Evidence type Case information Suggested upgrades Points given References/Notes
Functional data De Novo
Variant Evidence: Autosomal Dominant*2 Predicted or proven null variant (default 1.5 points, scoring range 0-3 points per variant) +0.5 points +0.5 points 9.0 points Two homozygous frameshift variants in SPAG17, resulting in premature termination codons, have been identified in infertile men (see Table 2 for a case of a pair of brothers from this study and a case of a pair of brothers from previous research (10)). These two variants are predicted to induce nonsense-mediated transcript decay, as the premature termination codons are located more than 50 bp upstream of the final exon-exon junction (12). A homozygous canonical splice site in SPAG17 has been identified in infertile men (see Table 2 for a case of a pair of brothers from previous research (10)), The variant led to significantly reduced SPAG17 mRNA levels and no detectable SPAG17 protein in the spermatozoa of patient. All variants were assigned the default of 1.5 points.
Other variant type with some evidence of gene impact (default 0.1 points, scoring range 0-1.5 points per variant) +0.4 points +0.4 points 0.4
points
Two homozygous missense variants in SPAG17, have been identified in infertile men (see Table 2 for a pair of twins case from previous research (11) and another case from previous research (12)). These variants are assigned a default score of 0.1 points.
Segregation Evidence Evidence of segregation in one or more families (scoring range 0-3 points) 0 No evidence available
Genetic Evidence: case-control data
Case-Control Study Type Case-Control Quality Criteria Suggested Points/Study Points Given References/Notes
Single Variant Analysis •Variant detection methodology
•Power
•bias and confounding factors
•Statistical significance
0-6 points 0 No evidence available
Aggregate Variant Analysis 0-6 points 0 No evidence available
Total genetic evidence points 9.4

Clinical validity of gene-disease validity was curated using the Clinical Genome Resource (ClinGen) framework, version 11 (18).

The correlation between SPAG17 and severe asthenozoospermia is also supported by experimental evidence (Table 4). SPAG17 is crucial for the structure and function of motile cilia (20) and facilitates the translocation of protamines from the cytoplasm to the nucleus, a key process in sperm production (21). SPAG17 is highly expressed in testicular tissue, where spermatogenesis occurs (22). In SPAG17 knockout mice, primary cilia in chondrocytes, osteoblasts, and embryonic fibroblasts (MEFs) were shorter, and fewer cells exhibited primary cilia compared to wild-type mice (23). Spag17 knockout mice are infertile due to a severe spermatogenesis defect, with spermatogenesis arrested at the spermatid stage. Sperm retrieved from the cauda epididymis were immotile and displayed abnormal tail and head morphology (8). These data underscore the critical role of SPAG17 in male reproductive biology, with a cumulative evidence score of 4 out of 6 allowable points according to the ClinGen Gene–Disease Validity SOP (Table 4) (13, 18).

Table 4.

Experimental evidence summary matrix for evaluating the strength of the gene-disease validity between SPAG17 and male infertility.

Experimental evidence
Evidence category Evidence type Suggested points Points given References/Notes
Default Range
Function Biochemical function 0.5 0-2 1.0 SPAG17 is essential for the structure and function of motile cilia (20). SPAG17 facilitates the translocation of protamines from the cytoplasm to the nucleus, a process essential for sperm production (21).
Protein interaction 0.5 0-2 0 No evidence available
Expression 0.5 0-2 0.5 SPAG17 is highly expressed in testis tissue, where spermatogenesis takes place (22).
Functional Alteration Patient cells 1 0-2 0 No evidence available
Non-patient cells 0.5 0-1 0.5 Primary cilia in chondrocytes, osteoblasts, and embryonic fibroblasts (MEFs) from knockout mice were shorter, and fewer cells had primary cilia compared to those from wild-type mice (23).
Models Non-human model organism 2 0-4 2 Spag17 knockout mice are infertile due to a severe defect in spermatogenesis, with spermatogenesis arrested at the spermatid stage. The few sperm retrieved from the cauda epididymis were immotile and exhibited abnormal tail and head morphology (8).
Cell culture model 1 0-2 0 No evidence available
Rescue Rescue in human 2 0-4 0 No evidence available
Rescue in non-human model organism 2 0-4 0 No evidence available
Rescue in cell culture model 1 0-2 0 No evidence available
Rescue in patient cells 1 0-2 0 No evidence available
Total experimental evidence points 4.0

Clinical validity of gene-disease validity was curated using the Clinical Genome Resource (ClinGen) framework, version 11 (18).

Combining the genetic (9.4 points) and experimental (4 points) evidence resulted in a total score of 13.4 points. According to the ClinGen Gene–Disease Validity SOP, the 3 points contributed by our cases upgraded the gene–disease validity between SPAG17 and autosomal recessive severe asthenozoospermia from “Moderate” (requiring 7–11 points) to “Strong” (requiring 12–18 points).

4. Discussion

The identification of a novel homozygous nonsense variant in SPAG17 (NM_206996.4:c.2188C>T; p.Q730*) in these two siblings with severe asthenozoospermia significantly strengthens the genetic evidence implicating SPAG17 in this specific form of male infertility. Our finding, along with the previously reported homozygous missense variant (p. R1448Q) in the SPAG17 gene in twins with severe asthenozoospermia (11), and the more recently identified homozygous variants (c.4511A>G, p.Asn1504Ser; c.829 + 1G>T, p.Asp212_Glu276del; c.2120del, p.Leu707*) associated with oligoasthenoteratozoospermia (OAT) and MMAF phenotypes (10, 12), provides genetic evidence of SPAG17’s crucial role in sperm motility and male infertility. The sperm motility, morphology, and ultrastructure observed in the patients analyzed in this study align closely with findings from prior animal model research on SPAG17. Sperm motility analysis revealed severely reduced progressive motility, consistent with the immotile sperm phenotype reported in Spag17 knockout mice (8). Morphological evaluation demonstrated abnormalities, such as absent, short, and irregularly shaped flagella, consistent with defective sperm tails in knockout mice (8). Additionally, ultrastructural examination demonstrated disruptions in the “9 + 2” axonemal arrangement, including disorganized or absent central-pair microtubules, outer dense fibers, and microtubule doublets, consistent with flagellar defects reported in Spag17 knockout animal models (8). In addition to animal knockout models, other experimental evidence further supports the link between SPAG17 and severe asthenozoospermia. SPAG17 is essential for the structure and function of motile cilia and for the translocation of protamines during sperm production (20, 21). It is highly expressed in testicular tissue, where spermatogenesis occurs (22). The consistent findings of significantly reduced sperm motility and the array of flagellar abnormalities, both at the microscopic and ultrastructural levels, directly mirror the phenotypes observed in Spag17 knockout animal models, further reinforcing the functional consequence of SPAG17 deficiency in humans.

The central significance of our study lies in its impact on the formal evaluation of the gene-disease validity between SPAG17 and severe asthenozoospermia. Prior to this study, while evidence from Spag17 knockout mouse models and human case report (8, 10–12) suggested a link, the overall gene-disease validity, as assessed by the rigorous ClinGen Gene-Disease Validity SOP, was classified as “Moderate”(10.4 points). Our identification of this novel, loss-of-function homozygous variant in two affected siblings provided the critical additional genetic evidence needed to strengthen the association. Our cases, contributing a significant 3 points to the genetic evidence score within the ClinGen framework, effectively upgraded the overall evidence beyond the threshold required for “Strong”(13.4 points).

This upgrade from “Moderate” to “Strong” has significant implications for the clinical management of male infertility. Firstly, it provides more substantial support for including SPAG17 in diagnostic gene panels for asthenozoospermia (16), enhancing the precision of genetic testing and improving the likelihood of identifying the underlying genetic cause in similar cases. Secondly, the “Strong” classification has a direct impact on SPAG17 variant in clinical settings. Variants in genes with “Moderate” validity could be classified as “Likely Pathogenic”, in contrast, for genes with a disease association categorized as definitive or strong, variants can be classified as high as pathogenic (16). This shift provides more actionable information for patient management and reproductive planning.

Notably, the clinical management of the affected siblings in our study provides further insight into the multifaceted role of SPAG17. Both individuals underwent ICSI combined with assisted oocyte activation (AOA), suggesting potential fertilization impairment beyond mere motility defects. SPAG17 is known to facilitate nuclear translocation of protamines during spermiogenesis, and its deficiency may lead to chromatin abnormalities and impaired sperm-derived oocyte activation capacity. This aligns with emerging evidence that flagellar structural proteins can also influence sperm nuclear integrity and centriolar function. Therefore, AOA may address not only the overt motility barrier but also underlying chromatin or activation deficiencies in SPAG17-deficient sperm.

In summary, we identified a novel homozygous loss-of-function variant in SPAG17 in two affected siblings. Semen analysis and ultrastructural studies have revealed a significant reduction in sperm motility and severe morphological abnormalities in affected patients. Combined with previous genetic and experimental evidence, these findings upgrade the gene-disease validity for SPAG17-related autosomal recessive severe asthenozoospermia to “Strong”. Our findings highlight the critical role of SPAG17 in male fertility and have significant clinical implications, supporting the inclusion of SPAG17 in male infertility screening gene panels, enabling more reliable variant classification, and ultimately enabling more precise genetic counseling and therapeutic strategies for affected individuals.

4.1. Study limitations and future perspectives

This study has certain limitations. Most notably, due to the scarcity and complete consumption of patient sperm samples for essential diagnostic and ultrastructural analyses (e.g., TEM), we were unable to perform direct protein-level validation, such as immunofluorescence or Western blotting, to confirm the absence of the SPAG17 protein. While the identification of a homozygous nonsense variant provides strong genetic evidence for a loss-of-function mechanism, future studies with access to relevant samples are encouraged to validate these findings at the protein level. Additionally, the functional link between SPAG17 deficiency and the observed need for assisted oocyte activation warrants further mechanistic investigation.

Funding Statement

The author(s) declared that financial support was not received for this work and/or its publication.

Footnotes

Edited by: Paweł Grzmil, Jagiellonian University, Poland

Reviewed by: Ao Ma, University of Science and Technology of China, China

Meng Zhixiang, Soochow University, China

Data availability statement

The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding authors.

Ethics statement

The studies involving humans were approved by Gansu Provincial Maternity and Child Care Hospital (Gansu Provincial Central Hospital) Ethics Committee. The studies were conducted in accordance with the local legislation and institutional requirements. The human samples used in this study were acquired from primarily isolated as part of your previous study for which ethical approval was obtained. Written informed consent for participation was not required from the participants or the participants’ legal guardians/next of kin in accordance with the national legislation and institutional requirements. Written informed consent was not obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article because Written informed consent was not obtained because the images and data presented in this manuscript are completely anonymized, and there is no possibility of identifying the individual(s).

Author contributions

LW: Writing – original draft, Formal analysis, Data curation. JnL: Writing – original draft, Data curation. LH: Writing – review & editing, Methodology. JW: Investigation, Writing – review & editing, Validation. LZ: Data curation, Writing – original draft. LD: Formal analysis, Writing – review & editing. JLa: Investigation, Writing – original draft. QZ: Writing – review & editing. JZ: Writing – review & editing. GX: Writing – review & editing.

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declared that generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

References

  • 1. Holt WV, Van Look KJW. Concepts in sperm heterogeneity, sperm selection and sperm competition as biological foundations for laboratory tests of semen quality. Reproduction. (2004) 127:527–35. doi:  10.1530/rep.1.00134, PMID: [DOI] [PubMed] [Google Scholar]
  • 2. Zheng J, Lu Y, Qu X, Wang P, Zhao L, Gao M, et al. Decreased sperm motility retarded ICSI fertilization rate in severe oligozoospermia but good-quality embryo transfer had achieved the prospective clinical outcomes. PLoS One. (2016) 11:e0163524. doi:  10.1371/journal.pone.0163524, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Salas-Huetos A, Bulló M, Salas-Salvadó J. Dietary patterns, foods and nutrients in male fertility parameters and fecundability: A systematic review of observational studies. Hum Reprod Update. (2017) 23:371–89. doi:  10.1093/humupd/dmx006, PMID: [DOI] [PubMed] [Google Scholar]
  • 4. Tournaye H, Krausz C, Oates RD. Novel concepts in the aetiology of male reproductive impairment. Lancet Diabetes Endocrinol. (2017) 5:544–53. doi:  10.1016/S2213-8587(16)30040-7, PMID: [DOI] [PubMed] [Google Scholar]
  • 5. Adams JA, Galloway TS, Mondal D, Esteves SC, Mathews F. Effect of mobile telephones on sperm quality: A systematic review and meta-analysis. Environ Int. (2014) 70:106–12. doi:  10.1016/j.envint.2014.04.015, PMID: [DOI] [PubMed] [Google Scholar]
  • 6. Ortega C, Verheyen G, Raick D, Camus M, Devroey P, Tournaye H. Absolute asthenozoospermia and ICSI: What are the options? Hum Reprod Update. (2011) 17:684–92. doi:  10.1093/humupd/dmr018, PMID: [DOI] [PubMed] [Google Scholar]
  • 7. Sudhakar DVS, Shah R, Gajbhiye RK. Genetics of male infertility - present and future: A narrative review. J Hum Reprod Sci. (2021) 14:217–27. doi:  10.4103/jhrs.jhrs_115_21, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Kazarian E, Son H, Sapao P, Li W, Zhang Z, Strauss JF, et al. SPAG17 is required for male germ cell differentiation and fertility. Int J Mol Sci. (2018) 19:1252. doi:  10.3390/ijms19041252, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Goduti DJ, Smith EF. Analyses of functional domains within the PF6 protein of the central apparatus reveal a role for PF6 sub-complex members in regulating flagellar beat frequency. Cytoskeleton (Hoboken). (2012) 69:179–94. doi:  10.1002/cm.21010, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Liu T, Rahim F, Yang M-L, Uddin M, Ye J-W, Ali I, et al. Novel homozygous SPAG17 variants cause human male infertility through multiple morphological abnormalities of spermatozoal flagella related to axonemal microtubule doublets. Asian J Androl. (2025) 27:245–53. doi:  10.4103/aja202496, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Xu X, Sha Y-W, Mei L-B, Ji Z-Y, Qiu P-p, Ji H, et al. A familial study of twins with severe asthenozoospermia identified a homozygous SPAG17 mutation by whole-exome sequencing. Clin Genet. (2018) 93:345–9. doi:  10.1111/cge.13059, PMID: [DOI] [PubMed] [Google Scholar]
  • 12. Sethi S, Andrabi W, Mitra K, Rajender S. Case Report: A homozygous mutation in the SPAG17 gene in a case with oligoasthenoteratozoospermic infertility. Front Reprod Health. (2025) 7:1554027. doi:  10.3389/frph.2025.1554027, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. McArthur DG, Manolio TA, Dimmock DP, Rehm HL, Shendure J, Abecasis GR, et al. Guidelines for investigating causality of sequence variants in human disease. Nature. (2014) 508:469–76. doi:  10.1038/nature13127, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Rehm HL, Berg JS, Brooks LD, Bustamante CD, Evans JP, Landrum MJ, et al. ClinGen--the clinical genome resource. N Engl J Med. (2015) 372:2235–42. doi:  10.1056/NEJMsr1406261, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Strande NT, Riggs ER, Buchanan AH, Ceyhan-Birsoy O, DiStefano M, Dwight SS, et al. Evaluating the clinical validity of gene-disease associations: an evidence-based framework developed by the clinical genome resource. Am J Hum Genet. (2017) 100:895–906. doi:  10.1016/j.ajhg.2017.04.015, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Thaxton C, Good ME, DiStefano MT, Luo X, Andersen EF, Thorland E, et al. Utilizing ClinGen gene-disease validity and dosage sensitivity curations to inform variant classification. Hum Mutation. (2022) 43:1031–40. doi:  10.1002/humu.24291, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Dahary D, Golan Y, Mazor Y, Zelig O, Barshir R, Twik M, et al. Genome analysis and knowledge-driven variant interpretation with TGex. BMC Med Genomics. (2019) 12:200. doi:  10.1186/s12920-019-0647-8, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Gene-disease validity standard operating procedures, version 11 - ClinGen | clinical genome resource. Available online at: https://clinicalgenome.org/docs/gene-disease-validity-standard-operating-procedures-version-11/ (Accessed January 26, 2026).
  • 19. Cooper TG, Noonan E, von Eckardstein S, Auger J, Baker HWG, Behre HM, et al. World health organization reference values for human semen characteristics. Hum Reprod Update. (2010) 16:231–45. doi:  10.1093/humupd/dmp048, PMID: [DOI] [PubMed] [Google Scholar]
  • 20. Teves ME, Zhang Z, Costanzo RM, Henderson SC, Corwin FD, Zweit J, et al. Sperm-associated antigen-17 gene is essential for motile cilia function and neonatal survival. Am J Respir Cell Mol Biol. (2013) 48:765–72. doi:  10.1165/rcmb.2012-0362OC, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Agudo-Rios C, Rogers A, King I, Bhagat V, Nguyen LMT, Córdova-Fletes C, et al. SPAG17 mediates nuclear translocation of protamines during spermiogenesis. Front Cell Dev Biol. (2023) 11:1125096. doi:  10.3389/fcell.2023.1125096, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Zhang Z, Jones BH, Tang W, Moss SB, Wei Z, Ho C, et al. Dissecting the axoneme interactome: The mammalian orthologue of chlamydomonas PF6 interacts with sperm-associated antigen 6, the mammalian orthologue of chlamydomonas PF16 *. Mol Cell Proteomics. (2005) 4:914–23. doi:  10.1074/mcp.M400177-MCP200, PMID: [DOI] [PubMed] [Google Scholar]
  • 23. Teves ME, Sundaresan G, Cohen DJ, Hyzy SL, Kajan I, Maczis M, et al. Spag17 deficiency results in skeletal malformations and bone abnormalities. PLoS One. (2015) 10:e0125936. doi:  10.1371/journal.pone.0125936, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding authors.


Articles from Frontiers in Endocrinology are provided here courtesy of Frontiers Media SA

RESOURCES