Skip to main content
Journal of Pharmaceutical Analysis logoLink to Journal of Pharmaceutical Analysis
. 2025 Jul 24;16(2):101409. doi: 10.1016/j.jpha.2025.101409

Gliquidone alleviates DSS-induced ulcerative colitis in rats by targeting carnitine palmitoyltransferase 1A

Tian Tang a,b,1, Ying Zhang a,1, Xinrui Xing a, Ruiqi Sun a, Zhe Yu b, Yuan Tian a, Zunjian Zhang a, Pei Zhang a,, Fengguo Xu a,c,⁎⁎
PMCID: PMC12966598  PMID: 41798070

Abstract

Ulcerative colitis (UC) is an idiopathic, chronic inflammatory disorder with an increasing incidence worldwide. Due to the complex and unclear therapeutic targets, unmet UC therapeutic drugs still exist. Recently, acylcarnitine metabolism disorder has been linked to intestinal inflammation, but its role in UC remains elusive. According to our preliminary non-targeted metabolomics data, acylcarnitines (ACs) was screened as the disturbed metabolites in the different intestinal inflammation-related diseases. Here we quantified 26 ACs within liquid chromatography-tandem mass spectrometry (LC-MS/MS) in the dextran sulfate sodium (DSS)-induced UC rat model, and found that long-chain acylcarnitines (LCACs) were increased to varying degrees. As the key metabolites of fatty acid β-oxidation (FAO), the upstream metabolites long-chain fatty acids (LCFAs) and the related metabolic enzymes were further characterized, the results showed that the rate-limiting enzyme carnitine palmitoyltransferase 1A (CPT1A)-mediated LCFAs-LCACs metabolic axis was activated sharply. Next in vitro experiments exhibited that CPT1A was significantly upregulated in both inflammatory macrophages and colonic epithelial cells, and inhibition or knockdown of CPT1A could reduce the inflammation level remarkably. Thus, we screened the pharmacologic inhibitors of CPT1A from US Food and Drug Administration (FDA) approved drugs, within molecular docking, Western blot and cell membrane chromatography (CMC) technology, gliquidone was found to inhibit CPT1A in a dose-dependent manner and exert anti-inflammatory effects in vitro. Animal experiments also showed that gliquidone alleviated DSS-induced UC significantly. In summary, our study presents that within metabolomics analysis, inhibiting CPT1A is focused to be a potential therapeutic strategy against UC, and gliquidone represents an alternative treatment.

Keywords: UC, Acylcarnitine, Carnitine palmitoyltransferase 1A (CPT1A), Drug repurposing

Graphical abstract

Image 1

Highlights

  • CPT1A-mediated LCACs metabolism is accelerated in the DSS-induced colitis in rats.

  • Inhibiting CPT1A alleviates intestinal inflammation responses.

  • The inhibitory effect of gliquidone on CPT1A is verified for the first time.

  • Gliquidone is a promising intervention for ulcerative colitis by targeting CPT1A.

1. Introduction

Ulcerative colitis (UC) is an idiopathic, recurrent inflammatory disorder that occurs in the gastrointestinal tract, which has been listed as a modern refractory disease by the World Health Organization in recent years [1]. A report showed that the annual incidence of UC ranged 8.8–23.1/100,000 in North America, 0.6–24.3/100,000 in Europe, and 7.3–17.4/100,000 in Oceania [2,3]. Meanwhile, the incidence in developing countries is also increasing rapidly. A conservative estimate of the prevalence of UC in China was 11.6/100,000 [4,5]. Conventional therapies including chemical drugs and biological agents failed to offer satisfactory treatment. What’s worse, severe adverse reactions and low efficacy are often observed, with only about 40% of UC patients with short-term responses remaining in clinical remission at the end of a year [6,7]. Therefore, there is an urgent need for developing new UC therapies. However, the poorly understood pathogenesis of UC largely limits the research and development of effective drugs.

Recently, numerous studies have proven that metabolomics was a rapidly evolving tool in revealing disease mechanisms and providing a set of new targets for treatments. As reported, regulating short-chain fatty acid [8,9], bile acid [10], or tryptophan metabolism [11,12] have exhibited protective effects for alleviating inflammatory diseases. Acylcarnitines (ACs) was a group of endogenous metabolites with relatively low abundance and unanswered biological function. One of the Integrative Human Microbiome Project (HMP2) reports noted that ACs were significantly enriched in the intestine of UC patients, which was regarded as a predictive biomarker of UC progression and outcome [13]. Previously, our non-targeted metabolomics work demonstrated that ACs were dysregulated in the vincristine induced intestinal obstruction, irinotecan (CPT-11) induced gastrointestinal toxicity and dextran sulfate sodium (DSS)-induced colitis rat model, also indicating a pivotal role of ACs in the intestinal inflammation [[14], [15], [16]].

In general, long-chain ACs (LCACs, >12 carbon atoms) are considered to participate in the transporting of long-chain fatty acids (LCFAs) across the mitochondrial membrane for their β-oxidation. Recently new evidence has confirmed that LCAC metabolism was implicated in inflammation. For example, palmityl carnitine (C16) and stearoyl carnitine (C18) could activate downstream signaling and stimulate the release of proinflammatory cytokines and cyclooxygenase-2 (COX-2) in RAW 264.7 cells [17]. Myristoyl carnitine (C14) could stimulate the mRNA expression of pro-inflammatory cytokines and induce the phosphorylation of JUN N-terminal kinases (JNK) and extracellular-signal-kinases (ERK) in a dose-dependent manner [18]. In addition, carnitine palmitoyltransferase 1A (CPT1A), the rate-limiting enzyme of fatty acid β-oxidation (FAO), was highly involved in LCACs metabolism, and recent attention has also focused on the potential anti-inflammatory activity of CPT1A. Nicholas et al. [9] underscored blocking of CPT1A inhibited Th17-associated cytokine production by cells from people with type 2 diabetes (T2D). Calle et al. [19] and Qiao et al. [20] proposed that CPT1A regulated the macrophage inflammation via NOD-like receptor thermal protein domain associated protein 3 (NLRP3) inflammasome signaling pathway, and Wang et al. [21] remarked CPT1A modulated metabolic reprogramming and polarisation of macrophage under lipopolysaccharide (LPS) stimulation. Therefore, CPT1A-mediated LCACs metabolic axis might be involved in the pathogenesis of UC via intestinal immunity, but the precise role was unclear, and whether CPT1A could be a novel target to develop a new class of UC therapeutic agents needs to be investigated.

In this study, by integrating our non-target and target metabolomics data, we first depicted the metabolic profile of LCACs in the two intestinal inflammation rat models, based on which the role of CPT1A was further focused and explored. The results implied that inhibiting CPT1A could significantly reduce the inflammation level in the two cell models. Thus, we further conducted a virtual screening of approved drugs targeting CPT1A. As a result, gliquidone was shown to against intestinal inflammation potently both in vitro and in vivo. In conclusion, our data affirmed that targeting CPT1A is a promising strategy against intestinal inflammation, and gliquidone as a verified CPT1A inhibitor, is a promising alternative treatment for UC.

2. Materials and methods

2.1. Chemicals and reagents

Details of the chemicals and reagents are provided in the section on extended methods in the Supplementary data.

2.2. Animal experiments

Six to eight-week-old male specific pathogen-free (SPF) Sprague-Dawley (SD) rats were purchased from Vital River Laboratory Animal Technology (Beijing, China). All the rats were housed in a temperature-controlled SPF environment (24 °C ± 2 °C) and kept on a 12 h light/dark cycle. All the animal studies and procedures were approved by the Animal Ethics Committee of China Pharmaceutical University (License No.: SYXK 2018-0019). Animals were allowed to accommodate for 1 week before the experiment.

2.2.1. DSS-induced UC model construction

Rats were randomly divided into two groups: Control (n = 10) and DSS group (n = 10). The Control group was provided with normal drinking water and the DSS group was provided with drinking water containing 5% DSS (w/v) (Aladdin, Shanghai, China) for 7 consecutive days.

2.2.2. CPT-11-induced intestinal injury rat model construction

CPT-11 (Jari Pharmaceutical Co., Ltd., Lianyungang, Jiangsu, China) for injection was prepared as published [15,22]. Rats were randomly divided into two groups: Control (n = 10) and CPT-11 group (n = 10). CPT-11 group was administered with CPT-11 at 150 mg/kg intravenously for two consecutive days, and rats in control group were received a same dose of vehicle.

2.2.3. Drug efficacy verification experiment

Rats were randomly divided into three groups (n = 8): Control, DSS, and DSS + gliquidone (2.5 mg/kg) (MCE, Princeton, NJ, USA). Control and DSS groups were treated as mentioned above, and gliquidone was administered intragastrically every day for 7 days.

Body weight of the rats was recorded daily. The disease activity index (DAI) was calculated by combining the body weight loss, stool consistency and gross bleeding in the UC experiments, while the diarrhea score of each animal was evaluated every day in the CPT-11 experiment. On the sacrifice day, serum samples were collected from rats following a 12-h fasting period between 8:00 and 10:00 a.m., during which they had free access to water. The serum samples were obtained from the orbital venous plexus, the colon was collected and the length was measured. All blood samples were centrifuged at 8000 g (Centrifuge 5430 R, Eppendorf, Hamburg, Germany) for 10 min after coagulation for 1 h. For every colon sample, a portion was fixed in 10% formalin for histological examination and the rest were stored at −80 °C for metabolomics, Western blotting and biochemical indices analysis.

2.3. Targeted metabolomics study

A Shimadzu Nexera UPLC system interfaced with an 8060 triple quadruple mass spectrometer (Shimadzu, Kyoto, Japan) equipped with an electrospray ionization source was utilized for metabolomic analysis. Sample preparation, chemical derivatization, and instrument settings for the quantification of fatty acids (FAs) and ACs refer to our previous methods, and details are provided in the Supplementary data.

2.4. Detection of biochemical indices

Colons were homogenized as previously described, the supernatant was collected to determine the activity of superoxide dismutase (SOD; Jiancheng, Nanjing, China) and the content of malondialdehyde (MDA; Beyotime, Shanghai, China). Interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumour necrosis factor-alpha (TNF-α) enzyme-linked immunosorbent assay (ELISA) were performed according to the manufacturer’s instructions (4A Biotech Co., Ltd., Beijing, China).

In the drug efficacy verification experiment, serum was collected to determine the activity of alanine aminotransferase (ALT) and aspartate transaminase (AST) according to the manufacturer’s instructions (Jiancheng, Nanjing, China). Blood was collected from the tail vein and blood glucose was measured using Accu-Chek® Active (Roche Diagnostics GmbH, Mannheim, Germany) glucose meter following the manufacturer’s instructions.

2.5. Hematoxylin and eosin (HE) staining

Colon tissues were fixed in 4% paraformaldehyde and HE staining was performed by Wuhan Servicebio Technology Co., Ltd. (Wuhan, China).

2.6. Cell culture and treatment

THP-1 cell line was obtained from American Type Culture Collection (Manassas, VA, USA), and cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) and 1 × HEPES buffer (Boster, Wuhan, China). CCD 841 CoN cell line was obtained from American Type Culture Collection (Manassas, VA, USA), and cultured in minimum essential medium (MEM; Gibco, Grand Island, NY, USA) supplemented with 10% FBS, 1% non-essential amino acids (NEAA; Gibco, Grand Island, NY, USA) and 1% penicillin-streptomycin (Thermo Fisher Scientific, Waltham, MA, USA). All cells were maintained at 37 °C in a humidified atmosphere containing 5% CO2. The differentiation of THP-1 cells was induced by 100 ng/mL phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich, St. Louis, MO, USA) for 48 h and then treated with 1 μg/mL LPS (Sigma-Aldrich, St. Louis, MO, USA) in the absence or presence of gliquidone for 48 h. Simultaneously, the differentiation of CCD 841 CoN cells was induced by 100 ng/mL TNF-α (PeproTech, Wuhan, China), and also treated with gliquidone for 48 h.

2.7. Cell viability assay

Cells were seeded into 96-well plates with 5 × 103/well. After cell differentiation and drug treatment, 10 μL/well of Cell Counting Kit-8 (CCK-8; Beyotime, Shanghai, China) was added and incubated for 1–4 h at 37 °C. The absorbance was measured at 450 nm by a microplate reader (Tecan, Mannedorf, Switzerland).

2.8. Lentivirus infection

The human CPT1A gene silencing lentivirus was purchased from GenePharma Co., Ltd. (Shanghai, China; Order ID: LV2022-23034), and the oligonucleotide sequences are GCCATGAAGCTCTTAGACAAA (5′ to 3′). THP-1 cells (3 × 105 cells/mL) in 25 cm2 flask were transfected with lentivirus at a multiplicity of infection (MOI) of 100, and incubated with RPMI 1640 culture medium containing 10% FBS and 5 μg/mL polybrene (GenePharma, Shanghai, China). The next day after infection, medium was replaced with fresh culture medium. 2 μg/mL puromycin (GenePharma, Shanghai, China) was used to screen stably transfected cell lines, and the silencing extent of CPT1A was analyzed by Western blot.

2.9. Western blot analysis

Cells and tissues were lysed by radioimmunoprecipitation (RIPA) buffer (Beyotime, Shanghai, China) containing 1 mmol/L phenylmethylsulfonyl fluoride (PMSF, Beyotime, Shanghai, China) on ice for 10 min to acquire total protein. Protein concentrations were measured by BCA protein assay kit (Beyotime, Shanghai, China). Proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting was carried according to the standard procedures. The immunoreactive bands were visualized using an enhanced chemiluminescence (ECL) system (Millipore, Bedford, MA, USA) on a Tanon 5200 chemiluminescent imaging system (Tanon Science–&–Technology, Shanghai, China). Relative protein expression was calculated by densitometric analysis using ImageJ software.

2.10. Molecular docking and virtual screening

Homology modeling of protein CPT1A and virtual screening of potential inhibitors of CPT1A were performed by Beijing Wecomput Tech. Co., Ltd. (Beijing, China). In brief, SWISS-MODEL server was used for automated comparative modeling of protein structures. The Molecular Operating Environment (MOE) software v2015.1001 was used for structure-based virtual screening. The approved drug molecules in DrugBank were used as the screening library. All compounds were ranked by the flexible docking with the “induced fit” protocol. The top ranked 100 cluster centers were finally identified as potential hits by GBVI/WSA dG score and the best ranked pose.

2.11. CPT1A-overexpressed mitochondrial membrane chromatography (MMC)

The experiments were performed as described by Su et al. [23]. Briefly, HEK293 cells overexpressing CPT1A were cultured, and their mitochondrial membrane was further isolated and immobilized on aminopropyl SiO2 stationary phase cross-linked by glutaraldehyde (CPT1A/MMSP), establishing the MMC analysis model targeting CPT1A. Scanning electron microscope (SEM) analysis and immunofluorescence (IF) assay were employed to characterize the column. And then the samples were investigated by examining the retention behaviors on the CPT1A/MMC column.

2.12. Statistical analysis

Statistical analysis was performed with GraphPad Prism 8.0 Software. Two-tailed unpaired t-test for two groups and one-way analysis of variance (ANOVA) with Tukey test for three or more groups was applied to assess the significance. P < 0.05 was considered statistically significant.

3. Results

3.1. LCACs accumulated in DSS-induced UC rat model

As can be seen from Fig. 1A, the body weight of the rats in the model groups decreased significantly compared to the controls, and the disease activity scores of the UC rats were remarkably increased (Fig. 1B). Oxidative stress indices including SOD and MDA were measured [24]. The results suggest an upregulated oxidative status characterized by decreased SOD and increased MDA levels in the colon (Figs. 1C and D). Importantly, inflammatory factors including IL-1β and IL-8 in the colons were found significantly increased (Figs. 1E and F). As shown in HE staining of the colon, the DSS group showed obvious exfoliation of glandular epithelium cells and massive infiltration of inflammatory cells in the submucosa, suggesting a severe destruction of the colon (Fig. 1G). These results demonstrated that the UC rat model was successfully established. Meanwhile, the CPT-11-induced diarrhea rat model was also successfully constructed, which was also a classic intestinal disorder model manifested by inflammation, as shown by the body weight (Fig. S1A), diarrhea score (Fig. S1B), oxidative stress indices (Figs. S1C and D), inflammatory factors (Figs. S1E and F), as well as histopathological sections (Fig. S1G).

Fig. 1.

Fig. 1

Intestinal injury induced by dextran sulfate sodium (DSS) in rats. (A) Changes in body weight over the experimental period. (B) Disease activity index (DAI) score. (C, D) Superoxide dismutase (SOD) (C) and malondialdehyde (MDA) (D) levels measured in the colon. (E, F) Interleukin-1 beta (IL-1β) (E) and interleukin-8 (IL-8) (F) measured in the colon. (G) Mucosal histology examined by hematoxylin and eosin (HE) staining. (H) Changes of acylcarnitines (ACs) in model groups compared to corresponding controls. (I) Concentration of long-chain acylcarnitines (LCACs) (C14, C16, and C18) measured in colons. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001 vs. Control; ns: no significance. C0: carnitine; C2: acetyl carnitine; C3: propionyl carnitine; C4: butyryl carnitine; isoC4: isobutyryl-l-carnitine; C4–OH: 3-hydroxybutyryl-carnitine; 2-Me-C4: 2-methylbutyryl-l-carnitine; C5: valeryl-l-carnitine; isoC5: isovaleryl-l-carnitine; C5:1: tigloyl-l-carnitine; C6: hexanoyl-l-carnitine; C6–OH: 3-hydroxyhexanoyl-l-carnitine; C8: octanoyl-l-carnitine; C10: decanoyl-l-carnitine; C12: lauroyl-l-carnitine; C12–OH: 3-hydroxydodecanoyl-l-carnitine; C14: myristoyl-l-carnitine; C14:1: trans-2-tetradecenoyl-l-carnitine; C14:2: cis; cis-5; 8-tetradecandienoyl-L carnitine; C16: palmitoyl-l-carnitine; C16:1: trans-2-hexadecenoyl-l-carnitine; C18: stearoyl-l-carnitine; C18:1: oleoyl-l-carnitine; C18:2: cis; cis-9; 12-octadecadienoyl-l-carnitine; C18–OH: 3-hydroxyoctadecanoyl-l-carnitine; CPT-11: irinotecan.

To investigate the changes of ACs metabolism in the animal models, we quantified 26 ACs using our previously established method with liquid chromatography-tandem mass spectrometry (LC-MS/MS). The heatmaps showed that in both models ACs metabolism were significantly dysregulated (Fig. 1H). And notably, LCACs including C14, C16, and C18 were increased commonly in the two models (Fig. 1I), prompting LCACs were accumulated while intestinal inflammation.

3.2. Accelerated CPT1A-mediated LCACs metabolism was observed in UC

It is well established that LCACs are converted from the corresponding LCFAs while crossing the mitochondrial membrane in the β-oxidation, thus we focused on the corresponding LCFAs (F14, F16, and F18) in the colons. It is noteworthy that LCFAs including F16 and F18 were correspondingly decreased in both models (Figs. 2A and B), and the calculated ratios of LCFAs and LCACs including F14/C14, F16/C16, and F18/C18 were down-regulated (Fig. 2C), indicating the metabolism of LCFAs to LCACs was exacerbated in the injured intestine. To further reveal the mechanism of the changes, we investigated the expression of four enzymes involved in this pathway including organic cation/carnitine transporter 2 (OCTN2), CPT1A, carnitine acylcarnitine translocase (CACT), and carnitine palmitoyltransferase 2 (CPT2). As shown in Fig. 2D, CPT1A was inordinately up-regulated and CACT was down-regulated in the UC rats compared to the control, meanwhile in the CPT-11-induced diarrhea model, reductions of LCFAs/LCACs and significant upregulation of CPT1A were also observed (Figs. 2E and F). Taken together, the characterization of metabolites and metabolic enzyme collectively suggest CPT1A might play a key role in the intestinal inflammation (Fig. 2G).

Fig. 2.

Fig. 2

Evaluation of the metabolite ratios and enzymes involved in β-oxidation. (A) Changes of fatty acids (FAs) in model groups compared to corresponding controls. (B) Concentration of long-chain fatty acid (LCFAs) measured in colons. (C, D) Ratio of LCFAs and long-chain acylcarnitine (LCACs) (C) and the expression of key enzymes in the dextran sulfate sodium (DSS)-induced ulcerative colitis (UC) rats (D). (E, F) Ratio of LCFAs and LCACs (E) and the expression of key enzymes involved in the irinotecan (CPT-11) induced diarrhea rats (F). (G) The carnitine palmitoyltransferase 1A (CPT1A)-mediated LCACs metabolic pathway. ∗P<0.05, ∗∗P<0.01, ∗∗∗P<0.001, ∗∗∗∗P<0.0001 compared to the Control group, ns: no significance. CPT2: carnitine palmitoyltransferase 2; OCTN2: organic cation/carnitine transporter 2; CACT: carnitine acylcarnitine translocase; F2: acetic acid; F3: propionic acid; F4: butyric acid; F6: hexanoic acid; F7: heptanoic acid; F8: octanoic acid; F9: nonanoic acid; F10: decanoic acid; F12: dodecanoic acid; F13: tridecanoic acid; F14: myristic acid; F15: pentadecanoic acid; F16: palmitic acid; F17: heptadecanoic acid; F18: stearic acid; F18:1: oleic acid; F18:2: linoleic acid; F18:3: γ-linolenic acid; F19: nonadecanoic acid; F20:1: cis-11-eicosenoic acid; F20:4: arachidonic acid; F20:5: cis-5,8,11,14,17-eicosapentaenoic acid; F22: behenic acid; F22:1: erucic acid; F22:6: cis-4,7,10,13,16,19-docosahexaenoic acid; F24:1: nervonic acid; C14: myristoyl-L-carnitine; C16: palmitoyl-L-carnitine; C18: stearoyl-L-carnitine.

3.3. Inhibition of CPT1A reduced inflammatory response in vitro

LCACs have been shown to activate inflammatory signaling pathways, while the mechanism remains unclear. CPT1A, as the rate-limiting enzyme of LCACs metabolism, based on the findings in both two animal models, we speculated that regulation of CPT1A would alleviate intestinal inflammation. Thus, to validate the anti-inflammation effect of inhibiting CPT1A, two different cell models were utilized. In the first cell model, the THP-1 cells were primed with PMA and induced to the M1 polarisation subtype by adding LPS. We found the expression of CPT1A showed a significant upregulation in a time and concentration-dependent way (Fig. 3A and B). Then, the cells were administered with different concentrations of etomoxir (ETO), which was regarded as the specific inhibitor of CPT1A. Fig. 3C demonstrated that ETO could decrease the level of proinflammatory cytokines remarkably, including TNF-α, IL-6, and IL-1β, indicating that targeting CPT1A could reduce inflammation. Furthermore, it was demonstrated that the knockdown of CPT1A using shRNA decreased the expression of Il-1β, IL-6, and TNF-α (Fig. 3D), which confirmed the key role of CPT1A in the pro-inflammatory responses. In the second cell model, intestine epithelial cells CCD 841 CON were stimulated with TNF-α. Western blot analysis manifested an increased expression of both CPT1A and ICAM-1 (Fig. 3E). Importantly, a decreased expression of ICAM-1 was observed with ETO treatment (Fig. 3F). Taken together, our findings suggest that inhibiting CPT1A could alleviate intestinal inflammation in both human macrophages and intestine epithelial cells.

Fig. 3.

Fig. 3

Inhibition of carnitine palmitoyltransferase 1A (CPT1A) reduces inflammatory response in vitro. (A, B) CPT1A exhibits lipopolysaccharides (LPS) concentration-dependent (A) and time-dependent (B) upregulation in THP-1 cells. (C) Etomoxir (ETO) inhibited tumor necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β) and interleukin-6 (IL-6) expression in THP-1 cell. (D) CPT1A knockdown inhibited TNF-α, IL-1β and IL-6 expression in THP-1 cells. (E) CPT1A and intercellular adhesion molecule-1 (ICAM-1) increased in TNF-α treated CCD 841 CoN cell. (F) ETO inhibited ICAM-1 expression in CCD 841 CoN cell. A, B, E: ∗P<0.05, ∗∗P<0.01, ∗∗∗P<0.001, ∗∗∗∗P<0.0001 compared to the Control group; C, F: ∗P<0.05, ∗∗P<0.01, ∗∗∗P<0.001, ∗∗∗∗P<0.0001 compared to the Model group/TNF-α group, ####P<0.0001 compared to the Control group. PMA: phorbol-12-myristate-13-acetate.

3.4. Gliquidone suppressed intestinal inflammation in vitro

The above experiments exhibited that CPT1A is a potential therapeutic target for intestinal inflammation. On this basis, we screened CPT1A inhibitors from approved drugs and further tested whether any drugs could make pharmacologic inhibition against inflammation. To reveal this, we performed molecular docking by executing machine-learning approaches. First, a CPT1A protein homology modeling was constructed since there is a lack of the practicable protein crystal structure in RCSB Protein. The Ramachandran plot of CPT1A showed that 97% of residues were in allowed regions (Fig. 4A), indicating that the 3D structure of this model was reasonable. The sequences of CPT1A structure and template structure were compared, and the results showed that they had the same α-helix region and β-chain region, and the overall agreement is as high as 45.55% (Fig. 4B).

Fig. 4.

Fig. 4

Gliquidone (Glq) attenuate intestinal inflammation in vitro. (A, B) The Ramachandran plot of carnitine palmitoyltransferase 1A (CPT1A) (A) and the sequences of CPT1A structure (B). (C–E) Glq showed no cytotoxicity (C) and inhibited CPT1A expression at test concentrations in THP-1 cells (D) and CCD 841 CoN cells (E). (F) Retention behavior of Glq on CPT1A/mitochondrial membrane chromatography (MMC) columns. (G–J) Glq inhibited intercellular adhesion molecule-1 (ICAM-1) expression in CCD 841 CoN cells (G) and inhibited the release of interleukin-6 (IL-6) (H), interleukin-1 beta (IL-1β) (I), and tumor necrosis factor-alpha (TNF-α) (J) in THP-1 cells. (K) The expression of NOD-like receptor thermal protein domain associated protein 3 (NLRP3) and nuclear factor kappa-B (NF-κB p65) in THP-1 cells. D: ∗∗∗P<0.001, ∗∗∗∗P<0.0001 compared to the PAM+LPS group, ##P<0.01 compared to the PMA group; E, G: ∗∗P<0.01, ∗∗∗∗P<0.0001 compared to the TNF-α group, ##P<0.01, ####P<0.0001 compared to the Control group; H–K: ∗P<0.05, ∗∗P<0.01, ∗∗∗P<0.001, ∗∗∗∗P<0.0001 compared to the LPS group, #P<0.05, ####P<0.0001 compared to the Control group. ETO: etomoxir; PMA: phorbol-12-myristate-13-acetate; LPS: lipopolysaccharides.

In total, 2388 approved drugs were docking, and among them, 416 drugs had higher docking scores compared with ETO. Next, according to the clinical data, such as drug properties, half-life, and side effects, 24 drugs, as shown in Table S1, were finally selected as candidate drug for the further validation by Western blot analysis (Fig. S2). As a result, gliquidone, a second-generation hypoglycemic sulfonylurea agent, was found to reduce CPT1A expression in both THP-1 cells and CCD 841 CoN cells with the test concentrations (Figs. 4C–E), and decreased the level of LCACs to some extent (Fig. S3). Meanwhile, gliquidone displayed significant retention on the CPT1A/MMC column with a retention time of 29.75 min, which demonstrated the capability to interact with CPT1A directly (Fig. 4F). Besides, Western blot analysis proved that gliquidone could reduce the ICAM-1 expression in the TNF-α-stimulated CCD 841 CoN cells (Fig. 4G), and in vitro experiment indicated that gliquidone (10, 20, 40 μM) could reduce the level of IL-6, IL-1β, and TNF-α significantly (Figs 4H–J), and decrease the expression of NLRP3 and nuclear factor kappa-B (NF-κB) p65, which was comparable with ETO (Fig. 4K).

Specifically, we verified the bonding mode of gliquidone with CPT1A, as depicted in Fig. 5, and within the binding pocket, the residues S252, H473, Y589, and T602 formed four hydrogen bond interactions with gliquidone. Based on this, we concluded that gliquidone was a potential therapeutic agent targeting CPT1A for the treatment of intestinal inflammation.

Fig. 5.

Fig. 5

Analysis of bonding mode of gliquidone with carnitine palmitoyltransferase 1A (CPT1A).

3.5. Gliquidone attenuated intestinal injury in vivo by restoring LCACs metabolism

To further confirm the anti-inflammation effect of gliquidone in vivo, we treated UC rats with gliquidone at a dosage of 2.5 mg/kg. As shown in Fig. 6, first, gliquidone ameliorated DSS-induced body weight loss (Fig. 6A), and DAI score (Fig. 6B), and shortened colon length (Fig. 6C) compared with the DSS group. Second, gliquidone significantly reduced inflammatory factors including IL-1β, IL-6, and TNF-α in the colon (Figs. 6D–F). And finally, the increased ICAM-1 expression in the inflamed colon was also significantly reduced by gliquidone (Fig. 6G). In summary, this experiment revealed that gliquidone is effective against DSS-induced UC.

Fig. 6.

Fig. 6

Gliquidone (Glq) attenuates intestinal injury in vivo. (A) Changes in body weight over the experimental period. (B) Disease activity index (DAI) score. (C) Colon length. (D–F) Inflammatory factors including interleukin-1 beta (IL-1β) (D), interleukin-6 (IL-6) (E) and tumor necrosis factor-alpha (TNF-α) (F) measured in the colon. (G) Intercellular adhesion molecule-1 (ICAM-1) expression in the colon. (H, I) Concentration of long-chain acylcarnitine (LCACs) (H) and long-chain fatty acids (LCFAs) (I) measured in colons. (J, K) Carnitine palmitoyltransferase 1A (CPT1A) (J) and NOD-like receptor thermal protein domain associated protein 3 (NLRP3) (K) expression in colon. ∗P<0.05, ∗∗P<0.01, ∗∗∗P<0.001, ∗∗∗∗P<0.0001 compared to the DSS gruop; #P<0.05, ##P<0.01, ###P<0.001, ####P<0.0001 compared to the Control group. DSS: dextran sulfate sodium; C14: myristoyl carnitine; C16: palmityl carnitine; C18: stearoyl carnitine; F14: myristic acid; F16: palmitic acid; F18: stearic acid.

To investigate whether gliquidone exert their effectiveness by targeting CPT1A mediated LCACs metabolism, we primely detected the concentration of LCFAs and LCACs in the colon. The results showed that LCFAs were increased and LCACs were decreased with gliquidone treatment compared to the UC group (Figs. 6). And notably, the expression of CPT1A was down-regulated to some extent after drug treatment (Fig. 6J). Moreover, it was reported that up-regulating CPT1A could activate NLRP3 and promote the release of IL-1β. Therefore, we examined the expression of NLRP3 in different groups, and Fig. 6K indicated that gliquidone significantly reduced the expression of NLRP3 in the colon.

4. Discussion and conclusion

A growing number of studies showed that LCACs are involved in ion balance [25], insulin resistance [18,26], and cellular stress [27]. As reported, the sodium-potassium exchanger could be inhibited by LCACs [[28], [29], [30]], and C16 was found to induce mitochondrial damage, causing apoptosis via activation of the caspase pathway [31], and was able to impact cellular energy metabolism through dephosphorylation of the insulin receptor and protein kinase B (Akt) [32,33]. These findings suggest that LCACs may have additional biological functions other than participating in FAO.

In this study, we highlight the disturbed ACs metabolism especially the LCACs in both UC and CPT-11-induced diarrhea rats. It is well known that intracellular LCFAs cannot cross the mitochondrial membrane due to their low polarity and rely on the carnitine shuttle. CPT1A, responsible for the mitochondrial transport of LCFAs, is the rate-limiting enzyme of FAO [34]. It has been proven to regulate the development of various lipid metabolic diseases and cancers, such as non-alcoholic fatty liver [35,36] and hyperlipidemia [[37], [38], [39]], as well as malignant tumor diseases such as hepatocellular carcinoma [40,41] and breast cancer [42,43]. Several studies have demonstrated the potential value of ETO, a selective inhibitor of CPT1A, in the clinical treatment of heart failure and synergistic antitumor [44,45].

In recent years, researchers have started to focus on the modulation role of CPT1A in reprogramming and polarisation of macrophage while inflammation responses. However, contradictory results were observed in existing studies. On one hand, CPT1A was found to accelerate the generation of acetyls or ROS, which in turn accelerates the assembly of NLRP3, and promotes the expression of caspase-1 and IL-1β [20,46]. On the other hand, a study showed that in the CPT1A knocked down THP-1 cells, the endoplasmic reticulum stress and inflammatory responses were significantly increased [47]. In our work, we proved that CPT1A was significantly upregulated while intestinal inflammation, and inhibiting CPT1A resulted in an anti-inflammatory effect, suggesting that CPT1A is a potential druggable target for UC.

Until now, there are no approved drugs targeting CPT1A against UC. In this study, molecular docking-based virtual screening was conducted to screen CPT1A inhibitors from 2388 approved drugs. Gliquidone was found to inhibit CPT1A and exert anti-inflammatory effects in vitro. Gliquidone is a second-generation oral sulfonylurea hypoglycemic agent, which effectively improves β-cell dysfunction and insulin resistance, as well as enhances insulin sensitivity. It is widely used to treat of renal-impaired type 2 diabetes mellitus [48]. The most common adverse reaction to gliquidone is hypoglycemia, often caused by overdosing. Therefore, we monitored the blood glucose fluctuation in the experiment in vivo. The results showed that the blood glucose was within normal range at the given dose (Fig. S4). In our study, gliquidone is a potential novel drug for treating UC with few side effects.

Additionally, it has been reported that gliquidone could modulate LPS-induced microglial neuroinflammatory responses by inhibiting NLRP3 inflammasome [49], which drove us to consider whether the anti-UC effect of gliquidone is also related to NLRP3. As expected, the decreased expression of NLRP3 in vivo and in vitro were both observed after treatment, prompting that gliquidone may alleviate inflammation through the CPT1A/NLRP3 signaling pathway.

In conclusion, within metabolomics analysis, we discovered the LCACs metabolic disorder in UC rats and confirmed the potential of CPT1A as an anti-inflammatory target, and further we screened gliquidone as a potent agent for UC, providing a preclinical basis for repurposing gliquidone into clinical trials for UC management.

CRediT authorship contribution statement

Tian Tang: Writing – original draft, Methodology, Investigation, Formal analysis, Conceptualization. Ying Zhang: Writing – original draft, Validation, Formal analysis. Xinrui Xing: Investigation, Methodology. Ruiqi Sun: Data curation, Methodology. Zhe Yu: Data curation. Yuan Tian: Resources. Zunjian Zhang: Supervision, Funding acquisition, Conceptualization. Pei Zhang: Supervision, Writing – review & editing, Funding acquisition, Conceptualization. Fengguo Xu: Writing – review & editing, Supervision, Funding acquisition, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

This study was supported by the National Natural Science Foundation of China (Grant Nos.: 82273896, 82473883, and U24A20788), the Fundamental Research Funds for the Central Universities (Gramt No.: 2632024ZD02), a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions, Project Program of State Key Laboratory of Natural Medicines (China Pharmaceutical University, Program No.: SKLNMZZ2024JS21), the Natural Science Foundation of Shaanxi Province (Grant No.: 2024JC-YBQN-0941) and the Key Research and Development Projects of Shaanxi Province (Project No.: 2023-YBSF-504).

Footnotes

This article is part of a special issue entitled: Targeted drug screening published in Journal of Pharmaceutical Analysis.

Peer review under responsibility of Xi'an Jiaotong University.

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.jpha.2025.101409.

Contributor Information

Pei Zhang, Email: peizhang@cpu.edu.cn.

Fengguo Xu, Email: fengguoxu@cpu.edu.cn.

Appendix A. Supplementary data

The following is the Supplementary data to this article:

Multimedia component 1
mmc1.docx (1.6MB, docx)

References

  • 1.Cen L., Yi T., Hao Y., et al. Houttuynia cordata polysaccharides alleviate ulcerative colitis by restoring intestinal homeostasis. Chin. J. Nat. Med. 2022;20:914–924. doi: 10.1016/S1875-5364(22)60220-6. [DOI] [PubMed] [Google Scholar]
  • 2.Du L., Ha C. Epidemiology and pathogenesis of ulcerative colitis. Gastroenterol. Clin. N. Am. 2020;49:643–654. doi: 10.1016/j.gtc.2020.07.005. [DOI] [PubMed] [Google Scholar]
  • 3.Cohen R.D., Yu A.P., Wu E.Q., et al. Systematic review: the costs of ulcerative colitis in Western countries. Aliment. Pharmacol. Ther. 2010;31:693–707. doi: 10.1111/j.1365-2036.2010.04234.x. [DOI] [PubMed] [Google Scholar]
  • 4.Ng S.C., Shi H.Y., Hamidi N., et al. Worldwide incidence and prevalence of inflammatory bowel disease in the 21st century: a systematic review of population-based studies. Lancet. 2017;390:2769–2778. doi: 10.1016/S0140-6736(17)32448-0. [DOI] [PubMed] [Google Scholar]
  • 5.Kaplan G.G., Ng S.C. Globalisation of inflammatory bowel disease: perspectives from the evolution of inflammatory bowel disease in the UK and China. Lancet Gastroenterol. Hepatol. 2016;1:307–316. doi: 10.1016/S2468-1253(16)30077-2. [DOI] [PubMed] [Google Scholar]
  • 6.Peyrin-Biroulet L., Lémann M. Review article: remission rates achievable by current therapies for inflammatory bowel disease. Aliment. Pharmacol. Ther. 2011;33:870–879. doi: 10.1111/j.1365-2036.2011.04599.x. [DOI] [PubMed] [Google Scholar]
  • 7.Hirten R.P., Iacucci M., Shah S., et al. Combining biologics in inflammatory bowel disease and other immune mediated inflammatory disorders. Clin. Gastroenterol. Hepatol. 2018;16:1374–1384. doi: 10.1016/j.cgh.2018.02.024. [DOI] [PubMed] [Google Scholar]
  • 8.Luu M., Pautz S., Kohl V., et al. The short-chain fatty acid pentanoate suppresses autoimmunity by modulating the metabolic-epigenetic crosstalk in lymphocytes. Nat. Commun. 2019;10:760. doi: 10.1038/s41467-019-08711-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Nicholas D.A., Proctor E.A., Agrawal M., et al. Fatty acid metabolites combine with reduced β oxidation to activate Th17 inflammation in human type 2 diabetes. Cell Metab. 2019;30:447–461. doi: 10.1016/j.cmet.2019.07.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Hang S., Paik D., Yao L., et al. Bile acid metabolites control T(H)17 and T(reg) cell differentiation. Nature. 2019;576:143–148. doi: 10.1038/s41586-019-1785-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Nikolaus S., Schulte B., Al-Massad N., et al. Increased tryptophan metabolism is associated with activity of inflammatory bowel diseases. Gastroenterology. 2017;153:1504–1516. doi: 10.1053/j.gastro.2017.08.028. [DOI] [PubMed] [Google Scholar]
  • 12.Truyens M., Lobatón T., Ferrante M., et al. Effect of 5-hydroxytryptophan on fatigue in quiescent inflammatory bowel disease: a randomized controlled trial. Gastroenterology. 2022;163:1294–1305. doi: 10.1053/j.gastro.2022.07.052. [DOI] [PubMed] [Google Scholar]
  • 13.Lloyd-Price J., Arze C., Ananthakrishnan A.N., et al. Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases. Nature. 2019;569:655–662. doi: 10.1038/s41586-019-1237-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Guo H., Chen J., Huang Y., et al. A pseudo-kinetics approach for time-series metabolomics investigations: more reliable and sensitive biomarkers revealed in vincristine-induced paralytic ileus rats. RSC Adv. 2016;6:54471–54478. [Google Scholar]
  • 15.Gao Y., Li W., Chen J., et al. Pharmacometabolomic prediction of individual differences of gastrointestinal toxicity complicating myelosuppression in rats induced by irinotecan. Acta Pharm. Sin. B. 2019;9:157–166. doi: 10.1016/j.apsb.2018.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Xu D.D., Hou X.Y., Wang O., et al. A four-component combination derived from Huang-Qin Decoction significantly enhances anticancer activity of irinotecan. Chin. J. Nat. Med. 2021;19:364–375. doi: 10.1016/S1875-5364(21)60034-1. [DOI] [PubMed] [Google Scholar]
  • 17.Rutkowsky J.M., Knotts T.A., Ono-Moore K.D., et al. Acylcarnitines activate proinflammatory signaling pathways. Am. J. Physiol. Endocrinol. Metab. 2014;306:E1378–E1387. doi: 10.1152/ajpendo.00656.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Adams S.H., Hoppel C.L., Lok K.H., et al. Plasma acylcarnitine profiles suggest incomplete long-chain fatty acid beta-oxidation and altered tricarboxylic acid cycle activity in type 2 diabetic African-American women. J. Nutr. 2009;139:1073–1081. doi: 10.3945/jn.108.103754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Calle P., Torrico S., Munoz A., et al. CPT1a downregulation protects against cholesterol-induced fibrosis in tubular epithelial cells by downregulating TGFbeta-1 and inflammasome. Biochem. Biophys. Res. Commun. 2019;517:715–721. doi: 10.1016/j.bbrc.2019.07.121. [DOI] [PubMed] [Google Scholar]
  • 20.Qiao S., Lv C., Tao Y., et al. Arctigenin disrupts NLRP3 inflammasome assembly in colonic macrophages via downregulating fatty acid oxidation to prevent colitis-associated cancer. Cancer Lett. 2020;491:162–179. doi: 10.1016/j.canlet.2020.08.033. [DOI] [PubMed] [Google Scholar]
  • 21.Wang M., Wu D., Liao X., et al. CPT1A-IL-10-mediated macrophage metabolic and phenotypic alterations ameliorate acute lung injury. Clin. Transl. Med. 2024;14 doi: 10.1002/ctm2.1785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Wang D., Li D., Zhang Y., et al. Functional metabolomics reveal the role of AHR/GPR35 mediated kynurenic acid gradient sensing in chemotherapy-induced intestinal damage. Acta Pharm. Sin. B. 2021;11:763–780. doi: 10.1016/j.apsb.2020.07.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Su W., Xu F., Zhong J., et al. Screening of CPT1A-targeting lipid metabolism modulators using mitochondrial membrane chromatography. ACS Appl. Mater. Interfaces. 2024;16:13234–13246. doi: 10.1021/acsami.3c18102. [DOI] [PubMed] [Google Scholar]
  • 24.Liu Y., Dong Y., Shen W., et al. Platycodon grandiflorus polysaccharide regulates colonic immunity through mesenteric lymphatic circulation to attenuate ulcerative colitis. Chin. J. Nat. Med. 2023;21:263–278. doi: 10.1016/S1875-5364(23)60435-2. [DOI] [PubMed] [Google Scholar]
  • 25.Sato T., Kiyosue T., Arita M. Inhibitory effects of palmitoylcarnitine and lysophosphatidylcholine on the sodium current of cardiac ventricular cells. Pflügers Archiv. 1992;420:94–100. doi: 10.1007/BF00378647. [DOI] [PubMed] [Google Scholar]
  • 26.Mai M., Tönjes A., Kovacs P., et al. Serum levels of acylcarnitines are altered in prediabetic conditions. PLoS One. 2013;8 doi: 10.1371/journal.pone.0082459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.McCoin C.S., Knotts T.A., Ono-Moore K.D., et al. Long-chain acylcarnitines activate cell stress and myokine release in C2C12 myotubes: calcium-dependent and -independent effects. Am. J. Physiol. Endocrinol. Metab. 2015;308:E990–E1000. doi: 10.1152/ajpendo.00602.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ferro F., Ouillé A., Tran T.A., et al. Long-chain acylcarnitines regulate the hERG channel. PLoS One. 2012;7 doi: 10.1371/journal.pone.0041686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sato T., Arita M., Kiyosue T. Differential mechanism of block of palmitoyl lysophosphatidylcholine and of palmitoylcarnitine on inward rectifier K+ channels of Guinea-pig ventricular myocytes. Cardiovasc. Drugs Ther. 1993;7(Suppl 3):575–584. doi: 10.1007/BF00877623. [DOI] [PubMed] [Google Scholar]
  • 30.Liu Q.Y., Rosenberg R.L. Activation and inhibition of reconstituted cardiac L-type calcium channels by palmitoyl-L-carnitine. Biochem. Biophys. Res. Commun. 1996;228:252–258. doi: 10.1006/bbrc.1996.1649. [DOI] [PubMed] [Google Scholar]
  • 31.Olzmann J.A., Carvalho P. Dynamics and functions of lipid droplets. Nat. Rev. Mol. Cell Biol. 2019;20:137–155. doi: 10.1038/s41580-018-0085-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Koves T.R., Ussher J.R., Noland R.C., et al. Mitochondrial overload and incomplete fatty acid oxidation contribute to skeletal muscle insulin resistance. Cell Metab. 2008;7:45–56. doi: 10.1016/j.cmet.2007.10.013. [DOI] [PubMed] [Google Scholar]
  • 33.Aguer C., McCoin C.S., Knotts T.A., et al. Acylcarnitines: potential implications for skeletal muscle insulin resistance. FASEB J. 2015;29:336–345. doi: 10.1096/fj.14-255901. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Li R., Li X., Zhao J., et al. Mitochondrial STAT3 exacerbates LPS-induced sepsis by driving CPT1a-mediated fatty acid oxidation. Theranostics. 2022;12:976–998. doi: 10.7150/thno.63751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Fondevila M.F., Fernandez U., Heras V., et al. Inhibition of carnitine palmitoyltransferase 1A in hepatic stellate cells protects against fibrosis. J. Hepatol. 2022;77:15–28. doi: 10.1016/j.jhep.2022.02.003. [DOI] [PubMed] [Google Scholar]
  • 36.Li X., Ge J., Li Y., et al. Integrative lipidomic and transcriptomic study unravels the therapeutic effects of saikosaponins A and D on non-alcoholic fatty liver disease. Acta Pharm. Sin. B. 2021;11:3527–3541. doi: 10.1016/j.apsb.2021.03.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hao M., Guan Z., Gao Y., et al. Huang-Qi San ameliorates hyperlipidemia with obesity rats via activating brown adipocytes and converting white adipocytes into brown-like adipocytes. Phytomedicine. 2020;78 doi: 10.1016/j.phymed.2020.153292. [DOI] [PubMed] [Google Scholar]
  • 38.Phu T.A., Vu N.K., Ng M., et al. ApoE enhances mitochondrial metabolism via microRNA-142a/146a-regulated circuits that suppress hematopoiesis and inflammation in hyperlipidemia. Cell Rep. 2023;42 doi: 10.1016/j.celrep.2023.113206. [DOI] [PubMed] [Google Scholar]
  • 39.Reeskamp L.F., Venema A., Pereira J.P.B., et al. Differential DNA methylation in familial hypercholesterolemia. EBioMedicine. 2020;61 doi: 10.1016/j.ebiom.2020.103079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wu D., Yang Y., Hou Y., et al. Increased mitochondrial fission drives the reprogramming of fatty acid metabolism in hepatocellular carcinoma cells through suppression of Sirtuin 1. Cancer Commun. 2022;42:37–55. doi: 10.1002/cac2.12247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Li J., Huang Q., Long X., et al. CD147 reprograms fatty acid metabolism in hepatocellular carcinoma cells through Akt/mTOR/SREBP1c and P38/PPARα pathways. J. Hepatol. 2015;63:1378–1389. doi: 10.1016/j.jhep.2015.07.039. [DOI] [PubMed] [Google Scholar]
  • 42.Shi J., Zhang Q., Yin X., et al. Stabilization of IGF2BP1 by USP10 promotes breast cancer metastasis via CPT1A in an m6A-dependent manner. Int. J. Biol. Sci. 2023;19:449–464. doi: 10.7150/ijbs.76798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Xiong Y., Liu Z., Zhao X., et al. CPT1A regulates breast cancer-associated lymphangiogenesis via VEGF signaling. Biomed. Pharmacother. 2018;106:1–7. doi: 10.1016/j.biopha.2018.05.112. [DOI] [PubMed] [Google Scholar]
  • 44.Lin H., Patel S., Affleck V.S., et al. Fatty acid oxidation is required for the respiration and proliferation of malignant glioma cells. Neuro Oncol. 2017;19:43–54. doi: 10.1093/neuonc/now128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Schlaepfer I.R., Rider L., Rodrigues L.U., et al. Lipid catabolism via CPT1 as a therapeutic target for prostate cancer. Mol. Cancer Therapeut. 2014;13:2361–2371. doi: 10.1158/1535-7163.MCT-14-0183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Moon J.S., Nakahira K., Chung K.P., et al. NOX4-dependent fatty acid oxidation promotes NLRP3 inflammasome activation in macrophages. Nat. Med. 2016;22:1002–1012. doi: 10.1038/nm.4153. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 47.Namgaladze D., Lips S., Leiker T.J., et al. Inhibition of macrophage fatty acid β-oxidation exacerbates palmitate-induced inflammatory and endoplasmic reticulum stress responses. Diabetologia. 2014;57:1067–1077. doi: 10.1007/s00125-014-3173-4. [DOI] [PubMed] [Google Scholar]
  • 48.Malaisse W.J. Gliquidone contributes to improvement of type 2 diabetes mellitus management: a review of pharmacokinetic and clinical trial data. Drugs R&D. 2006;7:331–337. doi: 10.2165/00126839-200607060-00002. [DOI] [PubMed] [Google Scholar]
  • 49.Kim J., Park J.H., Shah K., et al. The anti-diabetic drug gliquidone modulates lipopolysaccharide-mediated microglial neuroinflammatory responses by inhibiting the NLRP3 inflammasome. Front. Aging Neurosci. 2021;13 doi: 10.3389/fnagi.2021.754123. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.docx (1.6MB, docx)

Articles from Journal of Pharmaceutical Analysis are provided here courtesy of Xi'an Jiaotong University

RESOURCES