Skip to main content
Immunity, Inflammation and Disease logoLink to Immunity, Inflammation and Disease
. 2026 Mar 7;14(3):e70359. doi: 10.1002/iid3.70359

Mast Cell‐Derived CXCL4: A Key Mediator of Ferroptosis and Cardiac Damage in Septic Cardiomyopathy

Jing Wei 1, Zhi‐ying Jiang 1, Ling‐feng Ye 1, Hong‐xiang Lu 1,
PMCID: PMC12967251  PMID: 41794413

ABSTRACT

Background

Septic cardiomyopathy (SCM) is a common and life‐threatening complication of severe sepsis, with high mortality due to unclear underlying mechanisms. CXCL4, a key pro‐inflammatory factor, is implicated in various heart diseases, while ferroptosis (iron and lipid hydrogen peroxide‐dependent regulated cell death) plays a crucial role in SCM progression. However, the specific crosstalk between CXCL4, ferroptosis, and SCM remains unelucidated.

Methods

BALB/c mice were randomly divided into six groups (Control, LPS, LPS + Sodium Cromoglycate (CS), LPS + Ferrostatin‐1 (Fer‐1), LPS + Pifithrin‐α (PFT‐α), LPS + Niclosamide) to establish the SCM model via intraperitoneal LPS injection. In vivo experiments included histopathological examination (H&E, toluidine blue staining), survival analysis, ELISA, Western blot, immunofluorescence, immunohistochemistry, TUNEL staining, and detection of myocardial markers (CK‐MB, AST, LDH) and oxidative stress indicators (SOD, MDA, iron content). In vitro, RAW264.7 macrophages were treated with CXCL4 alone or combined with inhibitors (Fer‐1, PFT‐α, Niclosamide), followed by CCK‐8 assay, ROS detection, qRT‐PCR, Western blot, and phagocytosis microbead assay.

Results

In vivo, SCM mice exhibited significantly elevated CXCL4 levels in serum and heart tissue, accompanied by mast cell activation and degranulation. Inhibiting mast cell activation (with CS) reduced CXCL4 production, alleviated cardiac inflammation and ferroptosis (increased SLC7A11/GPX4 expression, decreased 4‐HNE), and improved survival. TUNEL staining revealed predominant macrophage death in SCM hearts. In vitro, CXCL4 induced macrophage ferroptosis (downregulated SLC7A11/GPX4) and impaired phagocytic function (reduced CD36/MERTK expression), which was reversed by Fer‐1. Mechanistically, CXCL4 activated STAT3 phosphorylation, regulating downstream P53; inhibiting STAT3 (Niclosamide) or P53 (PFT‐α) alleviated macrophage ferroptosis, restored phagocytosis, and mitigated cardiac injury in SCM mice.

Conclusion

Mast cell‐derived CXCL4 induces macrophage ferroptosis via the STAT3/P53 signaling pathway, impairs macrophage phagocytic function, and exacerbates myocardial injury in SCM. Targeting mast cell activation, CXCL4 release, or the STAT3/P53‐ferroptosis axis may serve as promising therapeutic strategies for SCM.

Clinical trial number: Not applicable.

Keywords: CXCL4, ferroptosis, macrophage, mast cell, SCM

1. Introduction

Sepsis is capable of inducing organ dysfunction, which typically stems from the host's inadequate immune response to infectious agents [1]. Septic cardiomyopathy (SCM) is an acute myocardial injury mediated by sepsis [2, 3]. Statistical data indicates that the mortality rate of septic patients complicated with myocardial injury is as high as 70%–90% [4]. Despite the extensive research efforts devoted to septic cardiomyopathy, its underlying mechanisms remain incompletely understood. Currently, it is widely believed that the form of cell death is closely related to septic cardiomyopathy.

Ferroptosis is an emerging form of programmed cell death, distinguishable from other programmed cell death modalities like pyroptosis, apoptosis, and autophagy [5]. Ferroptosis is usually triggered by imbalanced iron homeostasis and lipid peroxidation [6]. A growing body of research has established an association between ferroptosis and the progression of cardiovascular disorders, including myocardial ischemia‐reperfusion injury, myocardial infarction, and septic cardiomyopathy [7]. On the one hand, overproduction of ROS can promote inflammation, oxidative stress, lipid peroxidation, and lead to cardiovascular ferroptosis [8]. On the other hand, overproduction of inflammatory factors such as IL‐1β, TNF‐α and IL‐6 lead to ROS production, further causing ferroptosis in myocardial cells [9]. CXCL4, a key inflammatory factor implicated in the pathogenesis of multiple diseases (including sepsis), may also have a potential link to ferroptosis [10, 11, 12].

Mast cells serve as crucial immune cells, capable of regulating the body's immune responses via degranulation and the secretion of diverse cytokines [13, 14]. Macrophages, another vital type of immune cells, are primarily responsible for phagocytosing damaged or dead cells, thereby preventing further production of reactive oxygen species (ROS) [15]. When stimulated, macrophages can exhibit a series of biological changes, including migration, polarization, alterations in phagocytic activity, and even cell death [16]. Multiple studies have demonstrated that macrophages are susceptible to ferroptosis in disease states, and inhibiting macrophage ferroptosis holds significant implications for disease prognosis [17]. For instance, itaconate inhibits macrophage ferroptosis via the Nrf2 pathway against sepsis‐induced acute lung injury [18], while cigarette tar induces macrophage ferroptosis in pulmonary fibrosis through the hepcidin/FPN/SLC7A11 signaling pathway [19]. However, whether mast cell activation can modulate macrophage ferroptosis by secreting CXCL4 remains to be verified.

The p53 protein, a well‐characterized tumor suppressor, exerts regulatory effects on multiple cellular processes. These include controlling cell division, preventing DNA mutations, and promoting either cell apoptosis or ferroptosis [20]. Signal transducer and activator of transcription 3 (STAT3) mediates the expression of a variety of genes in response to cell stimuli and thus plays a key role in many cellular processes [21]. Classical STAT3 is an upstream regulatory factor of P53 and can interact with P53, which involves the phosphorylation of STAT3 at Tyr705 (p‐STAT3 (705)) [22]. Zhong et al. reported that elabela alleviates ferroptosis by modulating STAT3 [23]. Tao et al. reported that ferroptosis and alleviates acute lung injury via regulating P53 [24]. there tudies have also confirmed that STAT3 and P53 regulates ferroptosis in various forms, but their role is still unclear in septic cardiomyopathy [25, 26, 27].

In this study, we hypothesize that CXCL4, secreted by mast cells upon activation and degranulation, exerts a pivotal role in promoting macrophage ferroptosis through the STAT3/P53 signaling pathway. Considering the substantial therapeutic potential of ferroptosis in various pathological contexts, our findings may pave the way for innovative and targeted strategies in the comprehensive management of septic cardiomyopathy, thereby contributing to improved clinical outcomes and therapeutic approaches for this complex condition.

2. Material and Methods

2.1. Animals and Models

BALB/c male mice 20 g–24 g and aged 6–8 weeks were purchased from Aniphe Biolaboratory Inc. (Jiangsu, China). All mice were housed in constant temperature (24° C ± 2° C) under a 12‐h light/dark cycle with free access to food and water. The mice were randomly divided into six groups: Control group, LPS group, LPS + Sodium Cromoglycate (CS) group, LPS + Ferrostatin‐1 (Fer‐1) group, LPS + Pifithrin‐α (PFT‐α) group, LPS + Niclosamide group. To establish the SCM injury model, mice were intraperitoneally injected with LPS at a dose of 20 mg/kg for 24 h. Control group mice were intravenously injected with saline at the same dose. The mice in LPS + CS group were injected intravenously with Sodium Cromoglycate (100 μL, 10 mg/mL) 1 h before LPS injection. The mice in group were injected intravenously with Sodium Cromoglycate (10 mg/kg) 1 h before LPS injection. The mice in LPS + Fer‐1 group were injected intravenously with Fer‐1 (1 mg/kg) 1 h before LPS injection. The mice in LPS + PFT‐α group were injected intravenously with PFT‐α (1.1 mg/kg) 1 h before LPS injection. The mice in LPS + Niclosamide group were injected intravenously with Niclosamide (10 mg/mL) 1 h before LPS injection. After 24 h, the mice were sacrificed. Serum and heart were collected and stored at −80°C for subsequent experiments. Ferrostatin‐1 (a ferroptosis inhibitor, MCE), Pifithrin‐α (a P53 inhibitor, MCE). All animal experiments were approved by the Ethics Committee of Experimental Animal Welfare at Nanjing Medical University.

2.2. Survival Analysis

The mice in each group were intraperitoneally injected with 30 mg/kg LPS for survival analysis. The survival rate was observed and calculated every 12 h for 5 days after LPS injection.

2.3. Cell Culture

RAW246.7 were purchased from the Procell (China) and were cultured with DMEM medium (Gibco) containing 10% FBS in a 5% CO2 incubator. The 3–6 passages of cells were used for experiments. The cells were divided into five groups: Control group, CXCL4 (5 μg/mL, PeproTech) group, CXCL4 + Fer‐1 (1 μM, MCE) group, CXCL4 + PFT‐α (5 μM, MCE) group and LPS + Niclosamide (5 μg/mL, MCE) group. Cells were collected for further analysis.

2.4. Quantitative RT‐PCR

A RNA extraction kit (Invitrogen) was used to extract total RNA from cells and tissues. Total RNA was reverse transcribed into cDNA, then amplified by SYBR‐Green master mix kit according to the manufacturer's instructions. The relative expression of genes was calculated by the 2−ΔΔCt method. Primer sequences were showed in Table 1.

Table 1.

Quantitative RT‐PCR primers.

Target DNA Forward primer (5′ → 3′) Reverse primer (5′ → 3′)
CXCL4 CCAGACACTCATGTTGCCTGTTC GAGGCTCCGGTTGGTGCTTA
SCL7A11 ACGTGTTCCAGGACACAACA GGCGCATGTGTGCTAATCAT
GPX4 TTGCTTCCCAGATGTCCTATG CTTCCCCATCATCTCCATTCT
CD36 CCAGACACTCATGTTGCCTGTTC GAGGCTCCGGTTGGTGCTTA
Mertk GTCCCAGACATCAGGGAGTAA TCGGATACTTCAGCGTCAGGA
MRC GAAGTCCCTCACCCTCCCAA GGCATGGACGCGACCA
IL‐1β, CCCTGCAGTGGTTCGAGG GACAGCCCAGGTCAAAGGTT
IL‐6 TGGAGTACCATAGCTACCTGG AAAAAGTGCCGCTACCCTGA
TNF‐α GAAAGAAGCCGTGGGTTGGA ATCCCATGCCTAACTGCCCT

2.5. Western Blot

Hearts and cells were lysed in RIPA lysis buffer containing protease and phosphatase inhibitors. Subsequently, the total proteins were collected. The proteins were separated by SDS‐PAGE and transferred to PVDF membranes (Millipore). The membranes were blocked with 1% BSA for 1 h at room temperature. After blocking, the membranes were washed three times with TBS‐0.1% Tween 20 (TBST). The membranes were then incubated with primary antibodies at 4°C overnight. The primary antibodies used were as follows: anti‐SLC7A11 (1:1000, Proteintech), anti‐GPX4 (1:2000, Proteintech), anti‐CD36 (1:1000, Abclonal), anti‐p‐STAT3 (1:2000, Cell Signaling), anti‐STAT3 (1:2000, Cell Signaling), anti‐p53 (1:1000, Immunoway), anti‐CXCL4 (1:3000, Proteintech), anti‐GAPDH (1:20000, Proteintech), and anti‐Actin (1:5000, Bioworld). Following this, the membranes were incubated with secondary antibodies (1:5000, Proteintech) at room temperature for 1 h. The protein bands were developed using a chemiluminescence (ECL) kit. Finally, the intensity of the protein bands was quantified using ImageJ software.

2.6. ELISA

The levels of CXCL4 in the serum was quantified according to the manufacturer's instructions. The data were expressed as fold changes relative to the control conditions.

2.7. ROS Detection

DCFH‐DA was diluted in serum‐free medium at a ratio of 1:1000 to achieve a final concentration of 1 mmol/L. The diluted DCFH‐DA was then added to cover the cells, which were subsequently incubated in a cell incubator at 37°C for 25 min. Upon completion of the incubation period, the cells were washed three times with serum‐free medium to thoroughly remove any unincorporated DCFH‐DA. Finally, the cells were observed under a fluorescence microscope.

2.8. Immunofluorescence Staining

Mice were sacrificed by cervical dislocation, and mid‐heart tissue was selected for paraffin sectioning. The sections were placed in an oven at 60°C for 1 h. They were then deparaffinized with xylene twice (15 min each) and rehydrated through a gradient ethanol series (100%, 95%, 85%, 70%) for 6 min each. The sections were immersed in 10 mM citrate buffer, boiled for 10 min, and cooled for 30 min. A 5% BSA solution (0.05 g BSA in 1 mL PBS) was applied to the sections and incubated for 1 h. Primary antibody was added and incubated overnight at 4°C. After discarding the primary antibody, the sections were washed with PBS three times (10 min each). Secondary antibody (1:200) was applied and incubated for 1 h at room temperature in the dark. The secondary antibody was removed, and the sections were washed with PBS three times (10 min each). Finally, diluted DAPI was added and incubated in the dark for 15 min.

2.9. Histopathological Examination of the Heart

Mice heart tissues were fixed in 4% polyformaldehyde and embedded in paraffin. And then, stained with hematoxylin‐eosin (H&E). H&E staining was used to analyze the level of inflammation under a microscope in random order.

2.10. Immunohistochemistry (IHC)

Heart tissues were fixed and embedded in paraffin, and analyzed by immunohistochemical analysis. Heart tissues were incubated with anti‐xCT(1:100, Proteintech), Typtase (1:200, Proteintech), Ki‐67 (1:200, Proteintech) and anti‐GPX4 (1:100, Proteintech) at 4°C overnight. Then, heart tissue was incubated with biotin‐labeled secondary antibodies. The immunoreaction signal was developed with DAB staining, Finally, sections were viewed under a light microscope.

2.11. CCK‐8 Assay

Cell viability was assessed using the Cell Counting Kit‐8 (CCK‐8) Assay Kit (Meilunbio, China). RAW264.7 cells were seeded into 96‐well plates at a density of 2 × 10⁴ cells per well and incubated for 24 h prior to treatment. Each experimental group included three replicates. At the designated time points, 10 μL of CCK‐8 solution was added to each well and incubated at 37°C with 5% CO₂ for 3 h. Absorbance was measured at 450 nm using a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA). Higher absorbance values indicated greater cell viability.

2.12. Examination of Myocardial Markers

Detection kits were used to measure the levels of lactate dehydrogenase (LDH), creatine kinase (CK‐MB) and glutamic oxalacetic transaminase(AST) in serum.

2.13. Detection of GSH, MDA and Iron Content

The SOD was detected by the corresponding commercial kit (Nanjing Jiancheng Biotechnology, China) and MDA was measured using the Lipid Peroxidation MDA Assay Kit (Beyotime, China). The content of iron was measured by Cell Iron Content Detection Kit (Solarbio, China). All kits were used under the manufacturer's instructions.

2.14. TUNEL Staining

The TUNEL assay was conducted on heart tissue sections collected 24 h after LPS stimulation, using the FragEL DNA Fragmentation Detection Kit (Calbiochem, Billerica, MA, USA) in accordance with the manufacturer's protocols. The slides were imaged with a fluorescence microscope. The results were presented as the percentage of TUNEL‐positive cells relative to the total cell count, calculated as (number of TUNEL‐positive cells/total cells) × 100%.

2.15. Phagocytosis Microbead Assay

RAW 264.7 macrophages were grown in DMEM/10% FBS at 37°C, 5% CO2. Log‐phase cells were harvested, adjusted to 1–5 × 10⁵ cells mL⁻¹, and seeded in 24‐well plates (1 mL per well). After 24 h (≥ 80% confluence), medium was replaced with 500 µL serum‐free DMEM. Fluorescent carboxylate‐modified microbeads (2 µm; Thermo) were vortexed, sonicated, diluted in PBS or serum‐free medium (10–100 beads per cell), and added to each well (500 µL). Plates were centrifuged at 200 × g for 2 min and incubated at 37°C, 5% CO₂ for 0.5–4 h. Extracellular beads were removed by three ice‐cold PBS washes. Phagocytosis was quantified by fluorescence microscopy (≥ 300 cells per condition) or flow cytometry (10000 events, FACSCanto II); data are expressed as percentage bead‐positive cells.

2.16. Statistical Analysis

All data were analyzed using GraphPad Prism 8.0 (GraphPad Software Inc.). In ImageJ, grayscale scans were performed on western blot analysis results. The data were expressed as mean ± standard deviation. A t test was used to compare the data between two groups and the differences between multiple groups were analyzed via a one‐way analysis of variance. A ‐p value of 0.05 or less was considered statistically significant.

3. Results

3.1. Activation of Mast Cells in the Heart Tissue of SCM Mice Accompanied by Upregulation of CXCL4 Expression

Septic cardiomyopathy is a serious complication of sepsis, in which the heart is severely damaged. Among them, various immune cells and cytokines are involved in the development of diseases. Mast cells are important immune cells that can participate in the development of diseases by activating and releasing various cytokines. Although mast cells play an important role in the heart, there is currently limited research on the role of mast cells in septic cardiomyopathy. Firstly, we constructed a mouse model of septic cardiomyopathy by intraperitoneal injection of LPS, and results of HE staining showed inflammatory cell infiltration in the mouse heart (Figure 1A). Further research has found that in the hearts of mice with septic cardiomyopathy, toluidine blue staining revealed degranulation of mast cells; histological staining showed significant proliferation of mast cells in the cardiac tissue, with increased expression of tryptase. (Figure 1B–D). In addition, the levels of CXCL4 were assessed using ELISA assay and western blot, and results showed that the levels of CXCL4 in serum and heart were increased in the mice with septic cardiomyopathy (Figure 1E–F). Together, these results indicate that activation of mast cell is accommodated by regulation of CXCL4 expression in the heart tissue of septic cardiomyopathy mice.

Figure 1.

Figure 1

Mast cells in cardiac tissue are activated with upregulated expression of CXCL4. Mice were intraperitoneally injected with LPS to construct a SCM model. Heart tissues and serum from Control, LPS mice were collected at the indicated time points. The SCM model was established successfully after 24 h. (A) HE staining of mouse heart tissues. (B) Mast cell activation is detected by toluidine blue staining. (C, D) Immunohistochemical staining is used to detect mast cell proliferation and degranulation. (E, F) Representative image of western blot results and quantitative analysis of CXCL4 in heart tissues (***p < 0.001). Comparisons between groups were performed using paired t‐test or one‐way ANOVA with Bonferroni correction.

3.2. Inhibition of Mast Cell Degranulation Alleviates Cardiac Injury

Next, we will further investigate the effect of mast cell activation on septic cardiomyopathy. HE staining was performed on the heart tissue, and the results showed that compared with the LPS group, the LPS + CS group had a significant reduction in inflammatory cell infiltration in the heart (Figure 2A). Then, we injected 20 mg/kg LPS into the abdominal cavity of the mice and observed their survival every 12 h. The results showed that CS significantly increased the survival rate of mice with septic cardiomyopathy (Figure 2B). In addition, the levels of serum IL‐1β, IL‐6, TNF‐α in mice were detected by ELISA, and the results showed that their levels in LPS group significantly increased, but significantly decreased in the LPS + CS group (Figure 2C–E). Finally, the results of myocardial enzyme spectrum detection showed that the levels of serum CK‐MB, AST, LDH in LPS group significantly increased, but significantly decreased in the LPS + CS group (Figure 2F–H). In summary, these results indicate that inhibiting mast cell activation can alleviate cardiac damage caused by septic cardiomyopathy.

Figure 2.

Figure 2

Inhibition of mast cell degranulation alleviates cardiac injury. Mice were intraperitoneally injected with LPS or/and CS. Heart tissues and serum from Control, LPS, LPS + CS mice were collected at the indicated time points. (A) HE staining of mouse heart tissues. (B) Kaplan‐Meier survival curves of mice in the control, LPS, and LPS + CS groups over 80 h. The survival rate in the LPS + CS group was significantly higher than in the LPS group (**p < 0.01), each group have 10 mice. (C–E) IL‐1β, IL‐6, TNF‐α mRNA expression levels in heart tissues (*p < 0.05, **p < 0.01, ***p < 0.001). (F–H) AST, CK‐MB, LDH levels in serum (*p < 0.05, **p < 0.01, ***p < 0.001). Data are presented as mean ± SEM. Statistical significance was determined using one‐way ANOVA followed by Tukey's multiple comparisons test.

3.3. Mast Cell Degranulation Releases CXCL4 to Promote the Occurrence of Ferroptosis in Cardiac Tissue

Although cardiac ferroptosis is involved in the development of sepsis, its mechanism is still not fully understood. Ferroptosis is an important form of death, although studies have shown that ferroptosis is involved in heart damage caused by septic cardiomyopathy, the specific mechanism is still unclear. To explore whether there is a correlation between mast cell activation and CXCL4, we detected the expression of ferroptosis related proteins CXCL4 in mouse heart tissue by western blot. We found that inhibiting mast cell activation significantly reduced the expression of proteins CXCL4 (Figure 3A). The results of immunohistochemical test also showed that compared with the LPS group, the CXCL4 levels in the hearts of mice in the LPS + CS group significantly reduced (Figure 3B). In addition, we conducted ELISA tests on mouse serum to detect CXCL4 levels, and the results showed that inhibiting mast cell activation can reduce CXCL4 levels (Figure 3C). To explore whether there is a correlation between mast cell activation and ferroptosis, we detected the expression of ferroptosis related proteins SCL7A11 and GPX4 in mouse heart tissue by western blot. We found that inhibiting mast cell activation significantly reduced the expression of proteins SCL7A11 and GPX4 (Figure 3A). The results of immunohistochemical test also showed a decrease in SCL7A11 levels in the hearts of mice in the LPS + CS group compared to the LPS group (Figure 3D). In addition, the results of 4‐HNE detection in cardiac tissue showed a significant decrease in the LPS + CS group compared to the LPS group (Figure 3E). Finally, we also conducted SOD and MDA tests on mouse serum and heart, and the results showed that inhibiting mast cell activation can reduce oxidative stress (Figure 3F–I). These results preliminarily demonstrate that mast cell activation mediates upregulation of CXCL4 and the occurrence of ferroptosis. Macrophages are important immune cells in the heart, and their phagocytosis is crucial. Through TUNEL staining, we found that macrophages died in septic cardiomyopathy (Figure 3J). Therefore, CXCL4 may be involved in the occurrence of macrophage ferroptosis.

Figure 3.

Figure 3

Inhibition of mast cell activation reduces CXCL4 expression and alleviates cardiac ferroptosis. (A) Western blot analysis of CXCL4, SCL7A11, GPX4, and GAPDH protein levels in heart tissues from control, LPS, and LPS + CS groups. (B) Immunohistochemical staining for CXCL4 in heart sections from control, LPS, and LPS + CS groups. (C) ELISA analysis of CXCL4 in serum from control, LPS, and LPS + CS groups. (D, E) Immunofluorescence staining for SCL7A11 and 4‐HNE in heart sections from control, LPS, and LPS + CS groups. (F, G) Serum MDA and SOD levels. (H, I) Cardiac MDA and SOD levels. (J) Immunofluorescence staining co‐localization for CD68 and TUNEL in heart sections from control, LPS, and LPS + CS groups. (*p < 0.05, **p < 0.01, ***p < 0.001). Data are presented as mean ± SEM. Statistical significance was determined using one‐way ANOVA followed by Tukey's multiple comparisons test.

3.4. CXCL4 Induces Ferroptosis in Macrophages

Firstly, in order to further verify that ferroptosis participated in cardiac injury caused by septic cardiomyopathy, we conducted some experiments in the mice injected intraperitoneally with ferroptosis inhibitor Fer‐1. The results of HE staining indicated that inhibiting ferroptosis can reduce inflammatory cell infiltration in cardiac tissue (Figure 4A). Analysis of survival curve showed that inhibiting ferroptosis can improve the survival rate of septic cardiomyopathy (Figure 4B). Results of western blot showed that the expression of protein SCL7A11 and GPX4 decreased in the hearts of septic cardiomyopathy mice (Figure 4C). In summary, these results collectively indicate that ferroptosis participated in cardiac injury caused by septic cardiomyopathy. Then, we need to determine whether CXCL4 lead to ferroptosis of macrophages. Macrophages were treated with CXCL4 in vitro and differential gene expression was detected through transcriptome sequencing (Figure 4D). Analysis revealed significant expression of ferroptosis related genes after CXCL4 treatment (Figure 4F). In addition, the expression of GPX4 and SLC7A11 genes was significantly reduced (Figure 4E). Then, the results of q‐PCR also showed a significant decrease in gene expression of SLC7A11 and GPX4 after CXCL4 treatment (Figure 4G,H). In addition, the results of western blot also showed a decrease in protein expression of SLC7A11 and GPX4 after CXCL4 treatment (Figure 4I). Not only that, we also used Fer‐1 to treat macrophages. The results of western blot and iron ion content measurement showed that the ferroptosis of macrophages was reduced after Fer‐1 treatment (Figure 4J,K). In summary, these results indicate that CXCL4 mediates ferroptosis in macrophages. Therefore, CXCL4 may mediate macrophage ferroptosis by activating the STAT3/P53 signaling pathway.

Figure 4.

Figure 4

CXCL4 induces ferroptosis in macrophages. Mice were intraperitoneally injected with LPS or/and CS. Heart tissues and serum from Control, LPS, LPS + Fer‐1 mice were collected at the indicated time points. (A) HE staining of mouse heart tissues. (B) Kaplan‐Meier survival curves indicating improved survival in LPS + Fer‐1 group compared to LPS alone. (C) Western blot analysis of SCL7A11, GPX4, and GAPDH protein levels in heart tissues from control, LPS, and LPS + Fer‐1 groups, each group have 10 mice. (D) Heatmap of gene expression changes in response to CXCL4 treatment. (E) Volcano plot showing differential gene expression with significant upregulation and downregulation in Control and CXCL4 groups. (F) Enrichment analysis indicating significant involvement of ferroptosis in CXCL4 treated group. (G–I) Quantitative RT‐PCR and Western blot analysis showing reduced SCL7A11 and GPX4 mRNA expression in CXCL4 treated group compared to control. (J) Western blot analysis showing reduced SCL7A11 and GPX4 protein levels in CXCL4 + Fer‐1 treated group compared to CXCL4 alone. (K) Quantification of lipid peroxides showing increased levels in CXCL4 treated group, with reduction in CXCL4 + Fer‐1 group (*p < 0.05, **p < 0.01, ***p < 0.001). Data are presented as mean ± SEM. Statistical significance was determined using one‐way ANOVA followed by Tukey's multiple comparisons test.

3.5. CXCL4‐Mediated Ferroptosis Affects Macrophage Phagocytosis

One important function of macrophages is phagocytosis. When the body is damaged, macrophages will infiltrate the injured area and engulf the damaged cells, avoiding further expansion of inflammation. Therefore, next we will investigate whether ferroptosis inhibits macrophage phagocytic function in septic cardiomyopathy. In vitro, we induced macrophage ferroptosis using CXCL4, and qPCR results showed that the expression of phagocytic related genes CD36 and MERTK in macrophages was significantly reduced after CXCL4 treatment (Figure 5A and B). Subsequently, Fer‐1 was used to inhibit ferroptosis, and qPCR results showed that Fer‐1 treatment significantly increased the expression of phagocytosis related genes CD36 and MERTK, but did not increase the expression of MRC and LRP (Figure 5C–F). Macrophage microbead phagocytosis assay demonstrates the same phenomenon (Figure 5G). In addition, we also found that the protein and gene expression of CD36 in the LPS group's heart tissue was significantly reduced, while the protein and gene expression of CD36 in the Fer‐1 treatment group's heart tissue was significantly increased (Figure 5H–J). These results collectively indicate that ferroptosis inhibits macrophage phagocytic function in septic cardiomyopathy.

Figure 5.

Figure 5

CXCL4‐mediated ferroptosis affects macrophage phagocytosis. (A, B) CD36 and MERTK mRNA expression in control and CXCL4 group. (C–F) CD36, MERTK, MRC1 and LRP1 mRNA expression in control, CXCL4, and CXCL4 + Fer‐1 groups. (G) Detection of the proportion of phagocytosed microbeads in control, CXCL4, and CXCL4 + Fer‐1 groups. (H) Western blot analysis of SCL7A11 and GPX4 in control, siCD36, siCD36 + CXCL4 and CXCL4 treated macrophages. (I) Western blot analysis of CD36 and GAPDH in control, LPS, and LPS + Fer‐1 treated group. (J) Immunofluorescence staining for CD68 (green), CD36 (red), and DAPI (blue) in LPS and LPS + Fer‐1 treated group. (*p < 0.05, **p < 0.01, ***p < 0.001). Data are presented as mean ± SEM. Statistical significance was determined using one‐way ANOVA followed by Tukey's multiple comparisons test.

3.6. CXCL4 Mediates Macrophage Ferroptosis by Activating the STAT3/P53 Signaling Pathway

Numerous studies have been reported that P53 can promote cell ferroptosis. Therefore, we suspect that CXCL4 mediates macrophage ferroptosis by upregulating the expression of P53. The CCK8 test results indicate that CXCL4 treatment reduces the cellular activity of macrophages, while PFT‐α (P53 inhibitor) can enhance the cellular activity of macrophages (Figure 6A). The results of immunofluorescence test showed that CXCL4 treatment increased the ROS level of macrophages, while PFT‐α could reduce the ROS level of macrophages (Figure 6B). The results of qPCR showed that CXCL4 treatment increased the genes expression of SLC7A11 and GPX4, while PFT‐α could reduce the genes expression of SLC7A11 and GPX4 (Figure 6G). In addition, the results of western blot indicated that PFT‐α can inhibit protein expression of SLC7A11 and GPX4 (Figure 6C). STAT3 is an upstream regulatory factor of P53, which mediates the expression of a variety of genes in response to cell stimuli. Consistent with our hypothesis, Niclosamide (STAT3 inhibitor) can enhance the cellular activity of macrophages, reduce their ROS levels and inhibit genes expression of SLC7A11 and GPX4 (Figure 6D, E and H). In addition, the results of western blot showed that Niclosamide can increase the protein expression of SLC7A11 and GPX4, and inhibit the protein expression of P53 (Figure 6H). In summary, these results indicate that CXCL4 mediates macrophage ferroptosis by activating the STAT3/P53 signaling pathway.

Figure 6.

Figure 6

CXCL4 mediates macrophage ferroptosis by activating the STAT3/P53 signaling pathway. (A) Cell viability assay showing significantly reduced viability in CXCL4 treated cells compared to control, with further reduction in CXCL4 + Niclosamide treated cells. (B) The level of ROS in control, CXCL4, and CXCL4 + Niclosamide treated cells. (C) Western blot analysis of STAT3, p‐STAT3, P53, SCL7A11 and GPX4 in control, CXCL4, and CXCL4 + Niclosamide treated cells. (D) Cell viability assay showing significantly reduced viability in CXCL4 treated cells compared to control, with further reduction in CXCL4 + PFT‐α treated cells. (E) The level of ROS in control, CXCL4, and CXCL4 + PFT‐α treated cells. (F) Western blot analysis of P53, SCL7A11, GPX4 in control, CXCL4, and CXCL4 + PFT‐α treated cells. (G, H) The SCL7A11 and GPX4 mRNA expression in control, CXCL4, CXCL4 + Niclosamide and CXCL4 + PFT‐α treated cells. (*p < 0.05, **p < 0.01, ***p < 0.001). Data are presented as mean ± SEM. Statistical significance was determined using one‐way ANOVA followed by Tukey's multiple comparisons test.

3.7. STAT3/P53 Signaling Pathway Is Involved in Ferroptosis Induced Cardiac Injury in SCM

It has been confirmed in vitro that CXCL4 mediates macrophage ferroptosis by activating the STAT3/P53 signaling pathway. Next, we need to demonstrate in vivo the impact of the STAT3/P53 signaling pathway on septic cardiomyopathy. Cardiac inflammatory damage was evaluated through HE staining, and the results showed that Niclosamide and PFT‐α can alleviate inflammatory damage (Figure 7A,B). In addition, Niclosamide and PFT‐α can significantly improve the survival rate of mice with septic cardiomyopathy (Figure 7C,D). Myocardial enzymes were also detected in mouse serum, and the results showed that Niclosamide and PFT‐α can reduce the levels of CK‐MB, AST and LDH (Figure 7E–G). These results indicate that the STAT3/P53 signaling pathway is involved in the development of septic cardiomyopathy. Next, we will investigate whether the STAT3/P53 signaling pathway mediates ferroptosis in vivo. The results of western blot showed that Niclosamide and PFT‐α can increase the expression of proteins SCL7A11 and GPX4, and STAT3 inhibitors can also increase the expression of protein P53 (Figure 7H,I). Results of immunofluorescence and immunohistochemistry also indicate that Niclosamide can increase the expression of SCL7A11 in the heart (Figure 7J,K). In summary, these results indicate that the STAT3/P53 signaling pathway is involved in ferroptosis induced cardiac injury in septic cardiomyopathy.

Figure 7.

Figure 7

STAT3/P53 signaling pathway is involved in ferroptosis induced cardiac injury in SCM. Mice were intraperitoneally injected with PFT‐α and Niclosamide before LPS treated. Heart tissues and serum from Control, LPS, LPS + PFT‐α and LPS + Niclosamide mice were collected at the indicated time points. (A, B) HE staining of mouse heart tissues. (C, D) Cell survival curves of different treatment groups. (E–G) AST, CK‐MB and LDH levels in different treatment groups. (H) Western blot analysis of p‐STAT3, STAT3, P53, SCL7A11, GPX4, and GAPDH in different treatment groups. (I) Western blot analysis of P53, SCL7A11, GPX4, and GAPDH in different treatment groups. (J) Immunofluorescence staining of P53, SCL7A11, DAPI, and merged images in different treatment groups. (K) Representative IHC staining images of Heart tissue in different treatment groups. (*p < 0.05, **p < 0.01, ***p < 0.001). Data are presented as mean ± SEM. Statistical significance was determined using one‐way ANOVA followed by Tukey's multiple comparisons test.

4. Discussion

In this study, our primary objective was to investigate the effect of CXCL4 on septic cardiomyopathy and elucidate the relevant mechanisms. We odserved a significant increase in CXCL4 level during the progression of septic cardiomyopathy, accompanied by severe ferroptosis in the heart. Further investigations revealed that CXCL4 can induce the activation and degranulation of mast cells, which in turn promotes cardiac ferroptosis. Collectively, this study identifies a novel mechanism wherein CXCL4, derived from the activation and degranulation of mast cells during septic cardiomyopathy, facilitates the occurrence of ferroptosis and contributes to cardiac injury.

Ferroptosis, a newly identified mode of regulated cell death, is distinguished by the accumulation of intracellular iron and excessive lipid peroxidation [28, 29, 30]. Mounting evidence indicates that ferroptosis exerts a pivotal role in the pathological progression of septic cardiomyopathy [7, 31, 32], and targeted inhibition of ferroptosis has been shown to mitigate myocardial damage [33]. For instance, Liu and colleagues demonstrated that melanin nanoparticles alleviated sepsis‐induced myocardial injury by suppressing the ferroptotic pathway [34]. Similarly, Zhou et al. reported that puerarin protected against sepsis‐related myocardial impairment through the AMP‐activated protein kinase (AMPK)‐mediated ferroptosis signaling pathway [35]. Although studies supported that ferroptosis offers new perspective for the treatment of septic cardiomyopathy, its specific regulatory mechanism remains unclear.

CXCL4, a multifunctional cytokine linked to various heart diseases [10, 36]. It is noteworthy that the CXCL4 concentration (5 μg/mL) used in vitro exceeds basal physiological levels, a design justified by the study context: (1) SCM is characterized by cytokine storm, and our in vivo data confirmed significantly elevated CXCL4 in the serum and cardiac tissues of LPS‐induced SCM mice (Figure 1E–F), consistent with sepsis‐related pathological cytokine accumulation; (2) This concentration is widely adopted in prior studies on CXCL4‐mediated macrophage functions [37], ensuring comparability with existing literature; (3) In vitro systems lack in vivo microenvironmental complexity, so supra‐physiological cytokine doses are necessary to elicit robust pathological responses recapitulating in vivo effects. Critically, our in vivo data showed that inhibiting CXCL4 release via mast cell stabilization alleviated cardiac ferroptosis and injury (Figure 3A–E), consistent with in vitro findings of CXCL4‐induced macrophage ferroptosis, validating the biological relevance of the selected concentration. The study stated that exogenous CXCL4 infusion inhibits macrophage phagocytosis to enhance post‐myocardial infarction cardiac dilation and mortality [37]. Our study extends this: elevated CXCL4 in septic cardiomyopathy promotes cardiac injury by enhancing macrophage ferroptosis via STAT3/P53 signaling. Ferroptosis impairs macrophage phagocytosis (which protects the heart by clearing damaged cells and reducing inflammation). In vivo, inhibiting mast cell activation lowers CXCL4 and ferroptosis; ferroptosis inhibition alleviates heart damage. Our study suggests that CXCL4 can be a therapeutic target for septic cardiomyopathy.

P53 is a tumor suppressor protein that can promote cell ferroptosis [20]. STAT3, a key intracellular signal transducer, is capable of mediating the transcriptional expression of the p53 gene. Notably, The STAT3/P53 signaling pathway is often involved in the occurrence of ferroptosis [38, 39]. In this paper, we observed that stimulation with CXCL4 induced ferroptosis in macrophages, accompanied by a significant upregulation in the expression levels of STAT3 and P53. Furthermore, we also found that the role of CXCL4 in promoting macrophage ferroptosis is inhibited through treatment with STAT3 inhibitors and P53 inhibitors. In addition, STAT3 inhibitors can reduce expression of P53 [40]. This indicates that CXCL4 mediates macrophage ferroptosis by activating the STAT3/P53 signaling pathway (Figure 8).

Figure 8.

Figure 8

Schematic Diagram of the molecular mechanism by which CXCL4 induces macrophage ferroptosis and aggravates cardiac injury in septic cardiomyopathy via activating the STAT3/P53 signaling Pathway. In septic cardiomyopathy, activated mast cells degranulate to secrete CXCL4, which activates the STAT3/P53 signaling pathway in macrophages. This activation inhibits the expression of ferroptosis suppressors SLC7A11 and GPX4, leading to iron accumulation, ROS overproduction, and macrophage ferroptosis. Ferroptosis impairs macrophage phagocytic function (via downregulating CD36), exacerbating myocardial inflammation and oxidative stress. Inhibiting mast cell activation, CXCL4 release, the STAT3/P53 pathway, or ferroptosis directly alleviates cardiac damage and improves prognosis.

In summary, the present study shows that CXCL4 produced by mast cell activation in septic cardiomyopathy can have a deleterious effect on the heart by inhibiting ferroptosis of macrophages, aggravating cardiac injury. Therefore, our findings may provide a novel therapeutic target to alleviate septic cardiomyopathy. It should be noted that this study only indirectly demonstrates that CXCL4 is derived from mast cells, which represents a limitation that needs to be addressed in future research—further in‐depth studies, such as direct detection of CXCL4 expression in mast cells or mast cell depletion experiments, could help to more definitively confirm the source of CXCL4 and strengthen the reliability of the current research conclusions.

Author Contributions

Jing Wei performed the biological and pharmacological experiments. Zhi‐ying Jiang and Ling‐feng Ye performed molecular experiments. Hong‐xiang Lu designed the experiments and revised the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Authorship‐change‐form_AS_1.

Acknowledgments

The authors wish to acknowledge Jiangning Hospital Affiliated to Nanjng Medical University. This work was supported by General Research Topics on the Development of Medical Science and Technology in Nanjing (No. YKK24226) and National Natural Science Foundation of China (No. 82101851).

Wei J., Jiang Z.‐y., Ye L.‐f., and Lu H.‐x., “Mast Cell‐Derived CXCL4: A Key Mediator of Ferroptosis and Cardiac Damage in Septic Cardiomyopathy,” Immunity, Inflammation and Disease 14 (2026): e70359, 10.1002/iid3.70359.

These authors contributed equally: Jing Wei, Zhi‐ying Jiang, and Ling‐feng Ye contributed equally to the work.

References

  • 1. Sun H., Hong Q., Li C., et al., “Immunosenescence in Sepsis: Molecular Mechanisms and Potential Therapeutic Targets,” Aging and Disease 17 (2025): 780–811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Beesley S. J., Weber G., Sarge T., et al., “Septic Cardiomyopathy,” Critical Care Medicine 46, no. 4 (2018): 625–634. [DOI] [PubMed] [Google Scholar]
  • 3. Ehrman R. R., Sullivan A. N., Favot M. J., et al., “Pathophysiology, Echocardiographic Evaluation, Biomarker Findings, and Prognostic Implications of Septic Cardiomyopathy: A Review of the Literature,” Critical Care 22, no. 1 (2018): 112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Zhang M., Duan M., Zhi D., Lin J., Liu P., and Wang Y., “Risk Factors for 28‐day Mortality in Patients With Sepsis‐Related Myocardial Injury in Intensive Care Units,” Journal of International Medical Research 49, no. 4 (2021): 3000605211004759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Dixon S. J., Lemberg K. M., Lamprecht M. R., et al., “Ferroptosis: An Iron‐Dependent Form of Nonapoptotic Cell Death,” Cell 149, no. 5 (2012): 1060–1072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Tang D., Chen X., Kang R., and Kroemer G., “Ferroptosis: Molecular Mechanisms and Health Implications,” Cell Research 31, no. 2 (2021): 107–125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Fang X., Ardehali H., Min J., and Wang F., “The Molecular and Metabolic Landscape of Iron and Ferroptosis in Cardiovascular Disease,” Nature Reviews Cardiology 20, no. 1 (2023): 7–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Momtahan N., Crosby C. O., and Zoldan J., “The Role of Reactive Oxygen Species in In Vitro Cardiac Maturation,” Trends in Molecular Medicine 25, no. 6 (2019): 482–493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Jin B., Zhang Z., Zhang Y., et al., “Ferroptosis and Myocardial Ischemia‐Reperfusion: Mechanistic Insights and New Therapeutic Perspectives,” Frontiers in Pharmacology 15 (2024): 1482986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Wei J., Peng M. Y., Wang S. N., and Lu H. X., “CXCL4:NLRP3‐Mediated Pyroptosis Product That Regulates Cardiac Fibrosis,” International Immunopharmacology 133 (2024): 112096. [DOI] [PubMed] [Google Scholar]
  • 11. Koenen R. R., “No Hearty Reception: Infusion of CXCL4 Impedes Tissue Repair by Macrophages After Myocardial Infarction,” Cardiovascular Research 115, no. 2 (2019): 264–265. [DOI] [PubMed] [Google Scholar]
  • 12. Vajen T., Koenen R. R., Werner I., et al., “Blocking CCL5‐CXCL4 Heteromerization Preserves Heart Function After Myocardial Infarction by Attenuating Leukocyte Recruitment and NETosis,” Scientific Reports 8, no. 1 (2018): 10647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Yu X., Kasprick A., Hartmann K., and Petersen F., “The Role of Mast Cells in Autoimmune Bullous Dermatoses,” Frontiers in Immunology 9 (2018): 386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. González‐de‐Olano D. and Álvarez‐Twose I., “Mast Cells as Key Players in Allergy and Inflammation,” Journal of Investigational Allergology and Clinical Immunology 28, no. 6 (2018): 365–378. [DOI] [PubMed] [Google Scholar]
  • 15. Casey A. M., Ryan D. G., Prag H. A., et al., “Pro‐Inflammatory Macrophages Produce Mitochondria‐Derived Superoxide by Reverse Electron Transport at Complex I That Regulates IL‐1β Release During NLRP3 Inflammasome Activation,” Nature Metabolism 7, no. 3 (2025): 493–507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Zhang K. and Jagannath C., “Crosstalk Between Metabolism and Epigenetics During Macrophage Polarization,” Epigenetics & Chromatin 18, no. 1 (2025): 16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Chen J., Fu C., Shen G., et al., “Macrophages Induce Cardiomyocyte Ferroptosis via Mitochondrial Transfer,” Free Radical Biology and Medicine 190 (2022): 1–14. [DOI] [PubMed] [Google Scholar]
  • 18. He R., Liu B., Xiong R., et al., “Itaconate Inhibits Ferroptosis of Macrophage via Nrf2 Pathways Against Sepsis‐Induced Acute Lung Injury,” Cell Death Discovery 8, no. 1 (2022): 43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Bao X., Luo X., Bai X., et al., “Cigarette Tar Mediates Macrophage Ferroptosis in Atherosclerosis Through the Hepcidin/FPN/SLC7A11 Signaling Pathway,” Free Radical Biology and Medicine 201 (2023): 76–88. [DOI] [PubMed] [Google Scholar]
  • 20. Vousden K. H. and Lane D. P., “p53 in Health and Disease,” Nature Reviews Molecular Cell Biology 8, no. 4 (2007): 275–283. [DOI] [PubMed] [Google Scholar]
  • 21. Hirano T., Ishihara K., and Hibi M., “Roles of STAT3 in Mediating the Cell Growth, Differentiation and Survival Signals Relayed Through the IL‐6 Family of Cytokine Receptors,” Oncogene 19, no. 21 (2000): 2548–2556. [DOI] [PubMed] [Google Scholar]
  • 22. Pham T. H., Park H. M., Kim J., Hong J. T., and Yoon D. Y., “STAT3 and p53: Dual Target for Cancer Therapy,” Biomedicines 8, no. 12 (2020): 637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Zhang Z., Tang J., Song J., et al., “Elabela Alleviates Ferroptosis, Myocardial Remodeling, Fibrosis and Heart Dysfunction in Hypertensive Mice by Modulating the IL‐6/STAT3/GPX4 Signaling,” Free Radical Biology and Medicine 181 (2022): 130–142. [DOI] [PubMed] [Google Scholar]
  • 24. Yang Y., Ma Y., Li Q., et al., “STAT6 Inhibits Ferroptosis and Alleviates Acute Lung Injury via Regulating P53/SLC7A11 Pathway,” Cell Death & Disease 13, no. 6 (2022): 530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Zhou J., Li S., Yang Y., Zhou C., Wang C., and Zeng Z., “Triptolide Alleviates Acute Lung Injury by Reducing Mitochondrial Dysfunction Mediated Ferroptosis Through the STAT3/p53 Pathway,” Free Radical Biology and Medicine 230 (2025): 79–94. [DOI] [PubMed] [Google Scholar]
  • 26. Xu Q., Deng H., Huang X., et al., “Design, Synthesis, and In Vitro and In Vivo Biological Evaluation of Dihydroartemisinin Derivatives as Potent Anti‐Cancer Agents With Ferroptosis‐Inducing and Apoptosis‐Activating Properties,” European Journal of Medicinal Chemistry 281 (2025): 117018. [DOI] [PubMed] [Google Scholar]
  • 27. Li Y., Zhang Y., Qiu Q., et al., “Energy‐Stress‐Mediated AMPK Activation Promotes GPX4‐Dependent Ferroptosis Through the JAK2/STAT3/P53 Axis in Renal Cancer,” Oxidative Medicine and Cellular Longevity 2022 (2022): 2353115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Mou Y., Wang J., Wu J., et al., “Ferroptosis, a New Form of Cell Death: Opportunities and Challenges in Cancer,” Journal of Hematology & Oncology 12, no. 1 (2019): 34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Liang D., Minikes A. M., and Jiang X., “Ferroptosis at the Intersection of Lipid Metabolism and Cellular Signaling,” Molecular Cell 82, no. 12 (2022): 2215–2227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Jiang X., Stockwell B. R., and Conrad M., “Ferroptosis: Mechanisms, Biology and Role in Disease,” Nature Reviews Molecular Cell Biology 22, no. 4 (2021): 266–282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Li N., Wang W., Zhou H., et al., “Ferritinophagy‐Mediated Ferroptosis is Involved in Sepsis‐Induced Cardiac Injury,” Free Radical Biology and Medicine 160 (2020): 303–318. [DOI] [PubMed] [Google Scholar]
  • 32. Fang W., Xie S., and Deng W., “Ferroptosis Mechanisms and Regulations in Cardiovascular Diseases in the Past, Present, and Future,” Cell Biology and Toxicology 40, no. 1 (2024): 17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Fang X., Wang H., Han D., et al., “Ferroptosis as a Target for Protection Against Cardiomyopathy,” Proceedings of the National Academy of Sciences 116, no. 7 (2019): 2672–2680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Liu C., Zou Q., Tang H., et al., “Melanin Nanoparticles Alleviate Sepsis‐Induced Myocardial Injury by Suppressing Ferroptosis and Inflammation,” Bioactive Materials 24 (2023): 313–321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Zhou B., Zhang J., Chen Y., et al., “Puerarin Protects Against Sepsis‐Induced Myocardial Injury Through AMPK‐Mediated Ferroptosis Signaling,” Aging 14, no. 8 (2022): 3617–3632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Wei J., Wang D., Cui C., Tan J., Peng M., and Lu H., “CXCL4/CXCR3 Axis Regulates Cardiac Fibrosis by Activating TGF‐β1/Smad2/3 Signaling in Mouse Viral Myocarditis,” Immunity, Inflammation and Disease 12, no. 4 (2024): e1237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Lindsey M. L., Jung M., Yabluchanskiy A., et al., “Exogenous CXCL4 Infusion Inhibits Macrophage Phagocytosis by Limiting CD36 Signalling to Enhance Post‐Myocardial Infarction Cardiac Dilation and Mortality,” Cardiovascular Research 115, no. 2 (2019): 395–408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Zhang W., Gong M., Zhang W., et al., “Thiostrepton Induces Ferroptosis in Pancreatic Cancer Cells Through STAT3/GPX4 Signalling,” Cell Death & Disease 13, no. 7 (2022): 630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Dai Y., Cui C., Jiao D., and Zhu X., “JAK/STAT Signaling as a Key Regulator of Ferroptosis: Mechanisms and Therapeutic Potentials in Cancer and Diseases,” Cancer Cell International 25, no. 1 (2025): 83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Liu Y., Stockwell B. R., Jiang X., and Gu W., “p53‐regulated Non‐Apoptotic Cell Death Pathways and Their Relevance in Cancer and Other Diseases,” Nature Reviews Molecular Cell Biology 26 (2025): 600–614. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Authorship‐change‐form_AS_1.


Articles from Immunity, Inflammation and Disease are provided here courtesy of Wiley

RESOURCES