Skip to main content
NCBI home page
Springer logoLink to Springer
. 2026 Jan 9;62(1):57–68. doi: 10.1007/s11626-025-01143-x

PTIP inhibits proliferation, migration, and angiogenesis of retinal microvascular endothelial cells in a high-glucose environment

Jinfeng Zhang 1,3, Xiaohan Zhang 3, Changhua Gao 2, Cuiting Huang 3, Xuesong Lin 1,3,✉
PMCID: PMC12967632  PMID: 41514145

Abstract

The abnormal proliferation, migration, and angiogenesis of retinal microvascular endothelial cells (RMECs) are key pathological mechanisms involved in diabetic retinopathy (DR). This study aims to investigate the regulatory role of PAX interacting protein 1 (PTIP) in modulating proliferation, angiogenesis, and inflammatory responses in RMECs under high-glucose conditions. The levels of PTIP, VEGF, MDA, and SOD were measured in RMECs cultured under both normal and high-glucose conditions. A PTIP overexpression vector and a PTIP interference vector were constructed and transfected into RMECs exposed to high glucose. Cell proliferation was assessed using the CCK-8 assay, cell migration capacity was evaluated through wound healing assays, and tube formation ability was analyzed using Matrigel-based assays. Intracellular MDA and SOD levels were determined biochemically, while TNF-α and IL-6 concentrations in the culture supernatants were quantified by ELISA. The expression levels of EGR3, VEGF, MMP3, and MMP9 were detected using Western blotting and immunofluorescence techniques. The results showed that the expressions of PTIP and SOD were down-regulated in RMECs exposed to high glucose, whereas the levels of VEGF and MDA were up-regulated. Overexpression of PTIP in high-glucose-treated RMECs significantly suppressed cell proliferation, tube formation, and migration abilities. Additionally, it markedly reduced the levels of MDA, IL-6, TNF-α, EGR3, VEGF, MMP3, and MMP9 while increasing the level of SOD. Conversely, PTIP knockdown in RMECs under high-glucose conditions elicited opposite effects. Thus, overexpression of PTIP mitigated the impairment of proliferation, migration, and tube formation abilities, as well as reduced the inflammatory response induced by high glucose in RMECs.

Keywords: PTIP, Retinal microvascular endothelial cells, Diabetic retinopathy, Proliferation, Migration, Angiogenesis

Introduction

Diabetic retinopathy (DR) is one of the leading causes of blindness worldwide, characterized primarily by retinal microvascular lesions (Ntentakis et al. 2024; Sinclair and Schwartz 2024). Chronic hyperglycemia induces endothelial cell damage via intricate pathophysiological mechanisms, resulting in significant retinal ischemia and hypoxia. This pathological state triggers the upregulation of multiple angiogenic factors, promoting the proliferation and migration of vascular endothelial cells (Bohler et al. 2024; Mishra et al. 2024). Subsequent sprouting leads to the formation of abnormal new blood vessels (Nouri et al. 2024). If left untreated, neovascularization can cause severe complications, including neovascular glaucoma, vitreous hemorrhage, and tractional retinal detachment, ultimately leading to profound vision loss (Li et al. 2024; Reddy et al. 2024). Therefore, identifying novel target molecules and developing more efficacious drugs to inhibit pathological neovascularization are of critical importance for delaying the progression of DR.

PAX interacting protein 1 (PTIP) is a protein that interacts with Pax2 and was initially identified via the yeast two-hybrid system in 2000 (Lechner et al. 2000). PTIP is a chromatin regulatory factor containing six BRCT domains, which is broadly expressed in the cell nucleus and is intricately involved in gene regulation, DNA replication, and DNA repair processes (Liang et al. 2024a, b; Tan and Xu 2024). Research has demonstrated that PTIP plays a critical role in regulating the onset and progression of various diseases, including diabetic nephropathy (Cao et al. 2021a, b), lung cancer (Wu et al. 2018), and acute myeloid leukemia (Das et al. 2018). However, to date, no research has explicitly reported the specific role of PTIP in the occurrence and progression of DR. Interestingly, Mu et al. demonstrated that PTIP is indispensable for vascular development in mouse embryos, and the point mutation (L5Jcs36) of PTIP can impair embryonic development in mice (Mu et al. 2008). Retinal microvascular lesions are the main pathological feature of DR (Chen et al. 2023). Therefore, this study aimed to investigate the effects of PTIP on the proliferation, migration, and angiogenesis of rat retinal microvascular endothelial cells (RMECs) in a high-glucose environment and investigated its underlying molecular mechanisms.

Materials and methods

Materials

RMECs (RAT-iCell-m009) and iCell Primary Endothelial Cell Culture System were purchased from iCell Bioscience Inc. (Shanghai, China). Cell counting kit-8 was purchased from Solaibao Technology Co., LTD (Beijing, China). Antibodies against PTIP, EGR3, VEGF, MMP3, MMP9, and β-actin were purchased from Abcam (Cambridge, UK). Malondialdehyde (MDA) assay kit and Superoxide Dismutase (SOD) assay kit were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Rat TNF-α ELISA Kit and Rat IL-6 ELISA Kit were purchased from Shanghai Enzyme-linked Biotechnology Co., Ltd. (Shanghai, China). PTIP-pcDNA3.1 (+), si-PTIP-1, si-PTIP-2, si-PTIP-3, and si-NC were obtained from GENERAL BIOL (Chuzhou, China). The sequences of siRNAs targeting rat PTIP mRNA were si-PTIP-1: 5′ -GGUUAUUCAGCUUCUUAAATT UUUAAGAAGCUGAAUAACCTT-3′, si-PTIP-2: 5′ -GCUCCAGUUUCCACAGCAATT UUGCUGUGGAAACUGGAGCTT-3′, si-PTIP-3: 5′-GAAGGUGACUGCAGAGCUATT UAGCUCUGCAGUCACCUUCTT-3′, and si-NC: UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT.

Cell culture and transfection

RMECs was cultured in iCell Primary Endothelial Cell Culture System at 37 °C in an atmosphere containing 5% CO2. PCR was used to detect whether RMECs were contaminated by mycoplasma on February 13, 2025, at iCell Bioscience Inc. We ensure that the cells used in the experiment are not contaminated with mycoplasma. Then, the in vitro DR model was constructed by treating RMECs with 40 mM glucose for 48 h. And cell transfection was performed using Lipofectamine 3000 reagent. After transfection for 48 hours, the following experiments were performed.

Quantitative real-time PCR (qRT-PCR)

Samples were collected and the total RNA was isolated using a Total RNA Miniprep Kit. Subsequently, cDNA synthesis was carried out following the instructions provided by the manufacturer. A qRT-PCR analysis was conducted using real-time PCR machine (CFX Connect™, Bio-Rad, Hercules, CA) under the following conditions: initial denaturation at 95 °C for 5 min, followed by denaturation at 95 °C for 10 s, annealing at 60 °C for 30 s, extension from 65 to 95 °C with a temperature increment of 0.5°C every 5 s, 40 cycles. After completion of the reaction, average cycle threshold (Ct) values were determined for each gene as well as for the reference gene. The relative expression levels of genes were evaluated using the widely accepted method known as 2−ΔΔCT. The sequences of the primers are shown in Table 1.

Table 1.

Primer sequence

Gene symbol Forward primer Reverse primer
PTIP GCTTCAAGCGGAGATCCTACC CACTGGCTCATCATCAAAGTCAAA
GAPDH GACAACTTTGGCATCGTGGA ATGCAGGGATGATGTTCTGG
Open in a new tab

Western blotting

The total protein was extracted and the content was tested using a BCA protein assay kit. Then, the protein (30 mg) was separated by 10% SDS-PAGE and transferred onto a PVDF membrane. Membranes for target protein (and β-actin) were blocked with 5% skimmed milk at 25 °C for 1 h. Relative membranes were incubated with primary antibody of PTIP (1:500), EGR3 (1:1000), VEGF (1:1000), MMP3 (1:1000), and MMP9 (1:1000), followed by incubation with secondary antibody for 1 h. Finally, the protein bands were tested by an ECL-detecting kit, and β-actin was served as loading control.

Measurement of MDA and SOD

The MDA and SOD content assays in the RMECs of different groups were performed according to the manufacturer’s protocol.

CCK-8 assay

Cell viability was measured using a cell counting kit-8. Briefly, cells (2 × 104/well) were seeded in 96-well plate and cultured for 48 h. Then, each well was supplement with 10 µL CCK-8 solution and incubated for 1 h. Afterwards, the absorbance was measured using a microplate reader (SuPerMax3100, Shanghai Shanspu Biotechnology Co., Ltd., Shanghai, China) at the wavelength of 450 nm.

Wound healing assay

Scratch treatment was performed in each well using a 200-µL pipette tip. The wells were washed three times with PBS after discarding the culture medium, and scratches were photographed in incomplete culture medium. Cells were incubated, and scratch images were taken again after 24 h. Scratch areas at 0 and 24 h were calculated based on the images, and the wound healing rate of RMECs was determined.

Tube formation assay

RMECs from different treatment groups were harvested, followed by trypsinization, quantification, and seeding into 48-well plates pre-coated with matrix gel at a density of 40,000 cells per well. After 6 h of incubation, the cultures were examined and imaged, followed by data analysis.

Enzyme-linked immunosorbent assay (ELISA)

The TNF-α and IL-6 content assays in the supernatants of RMECs were performed according to the manufacturer’s protocol.

Immunofluorescence

RMECs were harvested after various treatments, fixed with 4% paraformaldehyde for 30 min, permeabilized with 0.5% Triton X-100 for 20 min, and blocked with 5% BSA at 37 °C for 30 min. The samples were subsequently incubated overnight at 4 °C with an antibody. Following washing steps, the fluorescent secondary antibody Cy3 Goat Anti-Rabbit IgG (H + L) was applied. After restaining with DAPI, the slides were mounted and imaged under a fluorescence microscope (CKX53, Olympus).

Statistical analyses

SPSS 26.0 was applied for statistical analysis, and experimental data were expressed as mean ± standard deviation (x ± s). One-way ANOVA is used to compare the means of three or more independent groups, while paired samples t-tests are employed to assess the difference between two related groups, and P < 0.05 was considered a statistically significant difference.

Results

PTIP was down-regulated in RMECs treated with high glucose

Immunofluorescence and flow cytometry were used to identify the marker proteins (CD31) of RMECs (Fig. 1A, B); the results showed that CD31 were expressed positively in RMECs. As shown in Fig. 1C, CCK-8 was employed to explore the concentration of the in vitro DR model of RMECs induced by high glucose. The cell proliferation activity of RMECs in the 40 mM glucose treatment group was significantly higher than that in the 0 mM glucose treatment group (0 mM means there is no added glucose concentration), as evidenced by a marked difference between the two groups. To further confirm that this high-glucose concentration can effectively simulate the in vitro DR model, we measured the levels of MDA (Fig. 1D), SOD (Fig. 1E), and VEGF (Fig. 1F, G) in RMECs across different treatment groups. Compared with the 0 mM glucose treatment, the activity of SOD in RMECs of the 40 mM glucose treatment group was significantly reduced, whereas the levels of MDA content was markedly increased. Compared with the control group, the level of VEGF protein expression was markedly increased. Therefore, exposing RMECs to a 40 mM glucose concentration effectively establishes an in vitro model of DR. In addition, we found that the expression of PTIP protein was significantly decreased in the model group of RMECs (Fig. 1H). And this result suggests that PTIP can be involved in regulating the development of DR Models in vitro.

Figure 1.

Figure 1.

Open in a new tab

PTIP was down-regulated in RMECs treated with high glucose. (A) The RMECs marker protein (CD31) was identified by immunofluorescence and (B) flow cytometry; (C) CCK-8 was employed to explore the concentration of the in vitro DR model of RMECs induced by high glucose; (D) SOD activity and (E) MDA concentration in RMECs of different groups were detected; (F) the protein expressions of VEGF and PTIP in different RMECs were detected by WB, (G, H) quantitative analysis of protein expression in different RMECs, (G) VEGF and (H) PTIP. Data are presented as the mean ± SD. *P < 0.05 vs. 0 mM or control.

Effect of PTIP overexpression on cell proliferation, migration, and inflammation factors of RMECs treated with high glucose

As shown in Fig. 2A–C, the transfection efficiency of PTIP overexpression vector in RMECs was verified by qRT-PCR (Fig. 2A) and WB (Fig. 2B, C). Compared with the OE-NC group, the mRNA and protein expressions of PTIP in OE-PTIP group were significantly increased in RMECs (P < 0.05). And this result confirms the successful overexpression of PTIP through transfection. Then, we used CCK-8 to detect the effect of PTIP overexpression on the proliferation activity of RMECs (Fig. 2D). Compared with the model + OE-NC group, the cell proliferation activity of RMECs in the Model + OE-PTIP group was significantly decreased. In addition, we further detected the migration ability of different RMECs by wound healing assay (Fig. 2E, F). Compared with the control group, the model group showed significantly increased cell migration ability. Compared with the model + OE-NC group, the model + OE-PTIP group exhibited significantly reduced cell migration ability. Besides, as shown in Fig. 2G–J, we employed distinct kits to quantify the levels of SOD, MDA, TNF-α, and IL-6 in RMECs across various treatment groups. Compared with the model + OE-NC group, the SOD activity of RMECs was significantly increased in the model + OE-PTIP group (P < 0.05), while the MDA, TNF-α, and IL-6 concentrations were significantly decreased (P < 0.05).

Figure 2.

Figure 2.

Open in a new tab

Effect of PTIP overexpression on cell proliferation, migration, and inflammation factors of RMECs treated with high glucose. (A) Transfection efficiency of PTIP overexpression vector in RMECs was verified by qRT-PCR and (B, C) WB; (D) CCK-8 was used to detect the effect of PTIP overexpression on the proliferation of RMECs treated with high glucose; (E, F) the migration of different RMECs was detected by wound healing assay; (G) SOD activity, (H) MDA, (I) TNF-α, and (J) IL-6 concentration in RMECs of different groups were detected. Data are presented as the mean ± SD. *P < 0.05 vs. control; #P < 0.05 vs. model + OE-NC.

Effect of PTIP overexpression on angiogenesis of RMECs treated with high glucose

To further analyze the tube formation ability in different RMECs, we used tube formation assay to analyze it (Fig. 3A). And the analysis results are shown in Fig. 3B and C. Compared with the control group, both Nb junctions and Tot. length in RMECs of the model group were significantly increased. However, compared with the model + OE-NC group, both Nb junctions and Tot. length in RMECs of the model + OE-PTIP group were significantly decreased. In addition, we further detected the expression of angiogenesis-related proteins (MMP9, MMP3, EGR3, and VEGF) and PTIP in different RMECs by WB (Fig. 3D–I). Compared with the control group, the protein expression of MMP9, MMP3, EGR3, and VEGF in the model group was significantly increased (P < 0.05), while the protein expression of PTIP in the model group was significantly decreased (P < 0.05). Besides, compared with the model + OE-NC group, the protein expression of MMP9, MMP3, EGR3, and VEGF in the model + OE-PTIP group was significantly decreased (P < 0.05), while the protein expression of PTIP in the Model + OE-PTIP group was significantly increased (P < 0.05). Interestingly, as shown in Fig. 4A–E, the expression of angiogenic-related proteins (MMP9, MMP3, EGR3, and VEGF) in RMECs of different groups was detected by immunofluorescence, and the results were consistent with that of WB. The above results indicate that PTIP overexpression can inhibit angiogenesis of RMECs treated with high glucose.

Figure 3.

Figure 3.

Open in a new tab

Effect of PTIP overexpression on angiogenesis of RMECs treated with high glucose. (A) The tube formation ability of different RMECs was detected; (B, C) quantitative analysis of tube formation ability in different RMECs; (D) the protein expressions of MMP9, MMP3, EGR3, VEGF, and PTIP in different RMECs were detected by WB; (E-I) quantitative analysis of protein expression in different RMECs, (E) MMP9, (F) MMP3, (G) EGR3, (H) VEGF, and (I) PTIP. Data are presented as the mean ± SD. *P < 0.05 vs. control; #P < 0.05 vs. model + OE-NC.

Figure 4.

Figure 4.

Open in a new tab

Effect of PTIP overexpression on the protein expressions of VEGF, EGR3, MMP3, and MMP9 of RMECs treated with high glucose. (A) Immunofluorescence results of different RMECs. (B–E) Quantitative analysis of protein expression in different RMECs, (B) VEGF, (C) EGR3, (D) MMP3, and (E) MMP9.

Effect of interfering PTIP on cell proliferation, migration, and inflammation factors of RMECs treated with high glucose

As shown in Fig. 5A–C, si-NC and three different si-PTIP were transfected into RMECs, and the silencing effect of PTIP was verified by qPCR (Fig. 5A) and WB (Fig. 5B, C). Compared with the si-NC group, the PTIP mRNA expressions of RMECs in the si-PTIP-1 group were significantly decreased (P < 0.05), while the PTIP protein expressions of RMECs in the si-PTIP-1 and the si-PTIP-2 group were significantly decreased (P < 0.05). According to the results of silencing PTIP, we used si-PTIP-1 for follow-up experiments. Then, we used CCK-8 to detect the effect of silencing PTIP on the proliferation activity of RMECs (Fig. 5D). Compared with the model + si-NC group, the cell proliferation activity of RMECs in the model + si-PTIP group was significantly increased. In addition, we further detected the migration ability of different RMECs by wound healing assay (Fig. 5E, F). Compared with the model + si-NC group, the model + si-PTIP group exhibited significantly enhanced cell migration ability. Besides, as shown in Fig. 5G–J, we employed distinct kits to quantify the levels of SOD, MDA, TNF-α, and IL-6 in RMECs across various treatment groups. Compared with the model + si-NC group, the SOD activity of RMECs was significantly decreased in the model + si-PTIP group (P < 0.05), while the MDA, TNF-α, and IL-6 concentrations were significantly increased (P < 0.05).

Figure 5.

Figure 5.

Open in a new tab

Effect of interfering PTIP on cell proliferation, migration, and inflammation factors of RMECs treated with high glucose. (A) Transfection efficiency of different si-PTIP in RMECs was verified by qRT-PCR and (B–C) WB; (D) CCK-8 was used to detect the effect of interfering PTIP on the proliferation of RMECs treated with high glucose; (E, F) the migration of different RMECs was detected by wound healing assay; (G) SOD activity, (H) MDA, (I) TNF-α, and (J) IL-6 concentration in RMECs of different groups were detected. Data are presented as the mean ± SD. *P < 0.05 vs. control; #P < 0.05 vs. model + si-NC.

Effect of interfering PTIP on angiogenesis of RMECs treated with high glucose

Subsequently, tube formation assay was used to detect the tube formation ability of different treated RMECs (Fig. 6A–C). Compared with the model + si-NC group, both Nb junctions and Tot. length in RMECs of the model + si-PTIP group were significantly increased (P < 0.05). In addition, we detected the expression of angiogenesis-related proteins (MMP9, MMP3, EGR3, and VEGF) and PTIP in different RMECs by WB (Fig. 6D–I). Compared with the model + si-NC group, the protein expressions of MMP9, MMP3, EGR3, and VEGF in the model + si-PTIP group were significantly increased (P < 0.05), while the protein expression of PTIP in the model + si-PTIP group was significantly decreased (P < 0.05). Interestingly, as shown in Fig. 7A–E, the expression of angiogenic-related proteins (MMP9, MMP3, EGR3, and VEGF) in RMECs of different groups was detected by immunofluorescence, and the results were consistent with that of WB. The above results indicate that interfering PTIP can promote angiogenesis of RMECs treated with high glucose.

Figure 6.

Figure 6.

Open in a new tab

Effect of interfering PTIP on angiogenesis of RMECs treated with high glucose. (A) The tube formation ability of different RMECs was detected; (B, C) quantitative analysis of tube formation ability in different RMECs; (D) the protein expressions of MMP9, MMP3, EGR3, VEGF, and PTIP in different RMECs were detected by WB; (E–I) quantitative analysis of protein expression in different RMECs, (E) MMP9, (F) MMP3, (G) EGR3, (H) VEGF, and (I) PTIP. Data are presented as the mean ± SD. *P < 0.05 vs. control; #P < 0.05 vs. model + si-NC.

Figure 7.

Figure 7.

Open in a new tab

Effect of interfering PTIP on the protein expressions of VEGF, EGR3, MMP3, and MMP9 of RMECs treated with high glucose. (A) Immunofluorescence results of different RMECs. (B–E) Quantitative analysis of protein expression in different RMECs, (B) VEGF, (C) EGR3, (D) MMP3, and (E) MMP9.

Discussion

Diabetic retinopathy (DR) is the most prevalent microvascular complication of diabetes and a leading cause of visual impairment and blindness in diabetic patients (Chong et al. 2024; Dorweiler et al. 2024). Currently, there are limited clinical treatment options available for slowing the progression of DR. Therefore, it is imperative to elucidate the regulatory mechanisms underlying DR and develop novel therapeutic strategies to delay its progression. The early clinical manifestations of diabetic retinopathy are characterized by structural and functional impairments in retinal microvasculature, including disruption of endothelial cell tight junctions and compromised integrity of the blood-retinal barrier. A hyperglycemic milieu can directly induce damage to RMECs, resulting in altered cellular behaviors such as dysregulated proliferation, impaired migration, and defective lumen formation. These pathological alterations closely mirror the hallmark features observed in diabetic retinopathy, including vascular leakage and pathological neovascularization (Niu et al. 2025; Shi et al. 2025). In numerous studies, RMECs exposed to high glucose have been utilized as in vitro models of DR to investigate the effects of specific genes on the disease (Fu et al. 2023; Xue et al. 2023; Yu et al. 2023). In this study, an in vitro DR model was established by exposing RMECs to high-glucose conditions. It was observed that the expression level of PTIP in high-glucose-treated RMECs was significantly down-regulated, suggesting that PTIP plays a role in regulating the development of the in vitro DR model.

The abnormal proliferation, migration, and angiogenesis of RMECs are central pathological mechanisms in DR (Mai et al. 2023; Qin et al. 2023; Su et al. 2023). High-glucose stimulation induces abnormal proliferation and migration of endothelial cells (Wang et al. 2022). Upon stimulation, quiescent endothelial cells acquire a “pro-angiogenic phenotype,” leading to their proliferation and migration into the surrounding matrix for new blood vessel formation (Gu et al. 2021). Additionally, high-glucose exposure significantly enhances the tube formation capacity of RMECs, contributing to abnormal retinal neovascularization (Cao et al. 2021a, b; Wang et al. 2024). These newly formed vessels are fragile and prone to leakage, which can result in retinal edema, hemorrhage, vitreous hemorrhage, and tractional retinal detachment (Chen et al. 2025). Therefore, this study investigated the effects of PTIP on the proliferation, migration, and tube formation ability of RMECs under high-glucose conditions. The findings demonstrate that overexpression of PTIP markedly suppresses the proliferation, migration, and tube formation ability of high-glucose-treated RMECs. In contrast, PTIP knockdown significantly promotes these processes in RMECs exposed to high glucose.

In addition, inflammatory response and oxidative stress are critical factors contributing to vascular endothelial cell injury in DR (Zou et al. 2022; Padovani-Claudio et al. 2024). In a hyperglycemic environment, oxidative stress and inflammation are significantly elevated, leading to reduced SOD enzyme activity and increased levels of MDA, TNF-α, and IL-6 (Yu et al. 2015; Chen et al. 2024). These findings align with our research results. Furthermore, our study demonstrated that overexpression of PTIP could effectively suppress high glucose-induced oxidative stress (restoring SOD activity and reducing MDA levels) and inflammatory responses (decreasing TNF-α and IL-6 levels) in RMECs. Conversely, interfering with PTIP expression exacerbates the high-glucose-induced increase in oxidative stress and inflammatory markers in RMECs.

VEGF, a key vascular endothelial growth factor, drives the activation of endothelial cells (Alsoudi et al. 2024). MMP3 and MMP9 degrade and remodel extracellular matrix (ECM) components, creating space for endothelial cell migration and the formation of new blood vessels (Salzmann et al. 2000; Wei et al. 2021). EGR3, as a stress-responsive transcription factor, activates inflammatory genes, thereby indirectly promoting the inflammatory response of the vascular endothelium (Bai et al. 2024). The synergistic actions of these three factors can facilitate pathological neovascularization in DR. Our research demonstrates that overexpression of PTIP significantly suppresses the expression of VEGF, MMP3, MMP9, and EGR3 proteins in RMECs. Conversely, interfering PTIP markedly enhances the expression of these proteins in RMECs. In summary, overexpression of PTIP may inhibit the progression of DR by suppressing the proliferation, migration, tube formation, oxidative stress, and inflammatory responses in RMECs. However, this study also has some limitations. Additional animal and clinical investigations are necessary to obtain conclusive evidence regarding the regulatory impact of PTIP on DR. In addition, Han et al. demonstrated that PTIP suppresses the invasion of esophageal squamous cell carcinoma cells through modulation of EphA2 expression (Han et al. 2021). Nakata et al. demonstrated that PTIP epigenetically regulates DNA damage-induced cell cycle arrest by upregulating PRDM1 (Nakata et al. 2024). Currently, the specific signaling pathway in RMECs regulated by PTIP remains unclear. Future studies will aim to address these limitations through further investigation.

Author contribution

Xuesong Lin conceived and designed the experiments. Jinfeng Zhang, Xiaohan Zhang, Changhua Gao, and Cuiting Huang carried out the experiments. Jinfeng Zhang and Cuiting Huang participated in data analyzing. Jinfeng Zhang drafted the manuscript. Xuesong Lin revised the manuscript.

Funding

This research was supported by grants from the Natural Science Foundation of Fujian Province, China (grant number: 2023J011088, Xuesong Lin).

Data availability

All data of this article are available on request from the corresponding author.

Declarations

Conflict of interest

The authors declare no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Alsoudi AF, Wai KM, Koo E, Parikh R, Mruthyunjaya P, Rahimy E (2024) Initial therapy of panretinal photocoagulation vs anti-VEGF injection for proliferative diabetic retinopathy. JAMA Ophthalmol 142:972–975 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bai CW, Lu L, Zhang JN, Zhou C, Ni YC, Li KR, Yao J, Zhou XZ, Lan CG, Cao C (2024) G protein subunit alpha i2’s pivotal role in angiogenesis. Theranostics 14:2190–2209 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bohler F, Bohler L, Taranikanti V (2024) Targeting pericyte retention in diabetic retinopathy: a review. Ann Med 56:2398200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cao A, Li J, Asadi M, Basgen JM, Zhu B, Yi Z, Jiang S, Doke T, El Shamy O, Patel N, Cravedi P, Azeloglu EU, Campbell KN, Menon M, Coca S, Zhang W, Wang H, Zen K, Liu Z, Murphy B, He JC, D’Agati VD, Susztak K, Kaufman L (2021) DACH1 protects podocytes from experimental diabetic injury and modulates PTIP-H3K4Me3 activity. J Clin Invest 131:e141279 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cao X, Xue LD, Di Y, Li T, Tian YJ, Song Y (2021) MSC-derived exosomal lncRNA SNHG7 suppresses endothelial-mesenchymal transition and tube formation in diabetic retinopathy via miR-34a-5p/XBP1 axis. Life Sci 272:119232 [DOI] [PubMed] [Google Scholar]
  6. Chen M, Zhang Q, Wang S, Zheng F (2023) Inhibition of diabetes-induced Drp1 deSUMOylation prevents retinal vascular lesions associated with diabetic retinopathy. Exp Eye Res 226:109334 [DOI] [PubMed] [Google Scholar]
  7. Chen Y, Ye L, Cui S, Shao J, Xin Y (2025) Peptides based on the interface of hnRNPA2B1-transthyretin complex repress retinal angiogenesis in diabetic retinopathy. J Transl Med 23:458 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chen Z, Liu B, Zhou D, Lei M, Yang J, Hu Z, Duan W (2024) AQP4 regulates ferroptosis and oxidative stress of Muller cells in diabetic retinopathy by regulating TRPV4. Exp Cell Res 439:114087 [DOI] [PubMed] [Google Scholar]
  9. Chong DD, Das N, Singh RP (2024) Diabetic retinopathy: screening, prevention, and treatment. Cleve Clin J Med 91:503–510 [DOI] [PubMed] [Google Scholar]
  10. Das P, Veazey KJ, Van HT, Kaushik S, Lin K, Lu Y, Ishii M, Kikuta J, Ge K, Nussenzweig A, Santos MA (2018) Histone methylation regulator PTIP is required to maintain normal and leukemic bone marrow niches. Proc Natl Acad Sci U S A 115:E10137–E10146 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dorweiler TF, Singh A, Ganju A, Lydic TA, Glazer LC, Kolesnick RN, Busik JV (2024) Diabetic retinopathy is a ceramidopathy reversible by anti-ceramide immunotherapy. Cell Metab 36:1521-1533.e5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fu C, Peng J, Ling Y, Zhao H, Zhao Y, Zhang X, Ai M, Peng Q, Qin Y (2023) Apigenin inhibits angiogenesis in retinal microvascular endothelial cells through regulating of the miR-140-5p/HDAC3-mediated PTEN/PI3K/AKT pathway. BMC Ophthalmol 23:302 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Gu Y, Hu D, Xin Y, Shao J (2021) Transthyretin affects the proliferation and migration of human retinal microvascular endothelial cells in hyperglycemia via hnRNPA2B1. Biochem Biophys Res Commun 557:280–287 [DOI] [PubMed] [Google Scholar]
  14. Han X, Zhu Y, Shen L, Zhou Y, Pang L, Zhou W, Gu H, Han K, Yang Y, Jiang C, Xie J, Zhang C, Ding L (2021) PTIP inhibits cell invasion in esophageal squamous cell carcinoma via modulation of EphA2 expression. Front Oncol 11:629916 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  15. Lechner MS, Levitan I, Dressler GR (2000) PTIP, a novel BRCT domain-containing protein interacts with Pax2 and is associated with active chromatin. Nucleic Acids Res 28:2741–2751 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Li H, Jia W, Vujosevic S, Sabanayagam C, Grauslund J, Sivaprasad S, Wong TY (2024) Current research and future strategies for the management of vision-threatening diabetic retinopathy. Asia Pac J Ophthalmol (Phila) 13:100109 [DOI] [PubMed] [Google Scholar]
  17. Liang J, Wang J, Sui B, Tong Y, Chai J, Zhou Q, Zheng C, Wang H, Kong L, Zhang H, Bai Y (2024) Ptip safeguards the epigenetic control of skeletal stem cell quiescence and potency in skeletogenesis. Sci Bull 69:2099–2113 [DOI] [PubMed] [Google Scholar]
  18. Liang J, Wang J, Ye C, Bai Y, Tong Y, Li Y, Ji Y, Zhang Y (2024) Ptip is essential for tooth development via regulating Wnt pathway. Oral Dis 30:1451–1461 [DOI] [PubMed] [Google Scholar]
  19. Mai H, Liu C, Fu B, Ji X, Chen M, Zhang Y, Lin Y, Chen J, Song Y, Gu S (2023) Methylene blue reduces retinal cell inflammation, apoptosis, and oxidative stress in a rat model of diabetic retinopathy via Sirtuin 1 activation. Altern Ther Health Med 29:156–165 [PubMed] [Google Scholar]
  20. Mishra S, Vishwakarma PK, Tripathi M, Ojha S, Tripathi SM (2024) Diabetic retinopathy: clinical features, risk factors, and treatment options. Curr Diabetes Rev 20:e271023222871 [DOI] [PubMed] [Google Scholar]
  21. Mu W, Wang W, Schimenti JC (2008) An allelic series uncovers novel roles of the BRCT domain-containing protein PTIP in mouse embryonic vascular development. Mol Cell Biol 28:6439–6451 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Nakata Y, Nagasawa S, Sera Y, Yamasaki N, Kanai A, Kobatake K, Ueda T, Koizumi M, Manabe I, Kaminuma O, Honda H (2024) PTIP epigenetically regulates DNA damage-induced cell cycle arrest by upregulating PRDM1. Sci Rep 14(1):17987 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Niu C, Dong D, Cui L, Dong Y, Wang W (2025) Exosomal FOXL1 from bone marrow mesenchymal stem cells activates the METTL3/ATXN2L pathway to ameliorate high glucose-induced human retinal microvascular endothelial cell injury. Diabetol Metab Syndr 17(1):229 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Nouri H, Abtahi SH, Mazloumi M, Samadikhadem S, Arevalo JF, Ahmadieh H (2024) Optical coherence tomography angiography in diabetic retinopathy: a major review. Surv Ophthalmol 69:558–574 [DOI] [PubMed] [Google Scholar]
  25. Ntentakis DP, Correa VSMC, Ntentaki AM, Delavogia E, Narimatsu T, Efstathiou NE, Vavvas DG (2024) Effects of newer-generation anti-diabetics on diabetic retinopathy: a critical review. Graefes Arch Clin Exp Ophthalmol 262:717–752 [DOI] [PubMed] [Google Scholar]
  26. Padovani-Claudio DA, Morales MS, Smith TE, Ontko CD, Namburu NS, Palmer SA, Jhala MG, Ramos CJ, Capozzi ME, McCollum GW, Penn JS (2024) Induction, amplification, and propagation of diabetic retinopathy-associated inflammatory cytokines between human retinal microvascular endothelial and Müller cells and in the mouse retina. Cell Signal 124:111454 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Qin T, Xi X, Wu Z (2023) Downregulation of glycoprotein non-metastatic melanoma protein B prevents high glucose-induced angiogenesis in diabetic retinopathy. Mol Cell Biochem 478:697–706 [DOI] [PubMed] [Google Scholar]
  28. Reddy SK, Devi V, Seetharaman ATM, Shailaja S, Bhat KMR, Gangaraju R, Upadhya D (2024) Cell and molecular targeted therapies for diabetic retinopathy. Front Endocrinol (Lausanne) 15:1416668 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Salzmann J, Limb GA, Khaw PT, Gregor ZJ, Webster L, Chignell AH, Charteris DG (2000) Matrix metalloproteinases and their natural inhibitors in fibrovascular membranes of proliferative diabetic retinopathy. Br J Ophthalmol 84:1091–1096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Shi J, Liu M, Zhu H, Jiang C (2025) SIRT3 mitigates high glucose-induced damage in retinal microvascular endothelial cells via OPA1-mediated mitochondrial dynamics. Exp Cell Res 444(2):114320 [DOI] [PubMed] [Google Scholar]
  31. Sinclair SH, Schwartz S (2024) Diabetic retinopathy: new concepts of screening, monitoring, and interventions. Surv Ophthalmol 69:882–892 [DOI] [PubMed] [Google Scholar]
  32. Su X, Yang X, Liu H (2023) Long non-coding RNA SPAG5-AS1 attenuates diabetic retinal vascular dysfunction by inhibiting human retinal microvascular endothelial cell proliferation, migration, and tube formation by regulating the microRNA-1224-5p/IRS-1 axis. Mol Biotechnol 65:904–912 [DOI] [PubMed] [Google Scholar]
  33. Tan Q, Xu X (2024) PTIP UFMylation promotes replication fork degradation in BRCA1-deficient cells. J Biol Chem 300:107312 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Wang XL, Xian Y, Chen XL (2024) YAP/TAZ signaling enhances angiogenesis of retinal microvascular endothelial cells in a high-glucose environment. Curr Eye Res 49:524–532 [DOI] [PubMed] [Google Scholar]
  35. Wang Z, Zhang X, Wang Y, Xiao D (2022) Dysregulation of miR-374a is involved in the progression of diabetic retinopathy and regulates the proliferation and migration of retinal microvascular endothelial cells. Clin Exp Optom 105:287–292 [DOI] [PubMed] [Google Scholar]
  36. Wei S, Wu Q, Gao H, Pei C (2021) Correlations of MMP-3 and MMP-9 gene polymorphisms with diabetic retinopathy. Panminerva Med 63:239–240 [DOI] [PubMed] [Google Scholar]
  37. Wu Q, Tian Y, Zhang J, Tong X, Huang H, Li S, Zhao H, Tang Y, Yuan C, Wang K, Fang Z, Gao L, Hu X, Li F, Qin Z, Yao S, Chen T, Chen H, Zhang G, Liu W, Sun Y, Chen L, Wong KK, Ge K, Chen L, Ji H (2018) In vivo CRISPR screening unveils histone demethylase UTX as an important epigenetic regulator in lung tumorigenesis. Proc Natl Acad Sci U S A 115:E3978–E3986 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Xue L, Huang L, Tian Y, Cao X, Song Y (2023) Trimethylamine-N-oxide promotes high-glucose-induced dysfunction and NLRP3 inflammasome activation in retinal microvascular endothelial cells. J Ophthalmol 2023:8224752 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Yu H, Zhang X, Wang X, Chen W, Lao W, Chen Y (2023) MiR-99a-5p inhibits the proliferation and migration of human retinal microvascular endothelial cells by targeting NOX4. Horm Metab Res 55:142–148 [DOI] [PubMed] [Google Scholar]
  40. Yu Z, Lu B, Sheng Y, Zhou L, Ji L, Wang Z (2015) Andrographolide ameliorates diabetic retinopathy by inhibiting retinal angiogenesis and inflammation. Biochim Biophys Acta 1850:824–831 [DOI] [PubMed] [Google Scholar]
  41. Zou J, Tan W, Liu K, Chen B, Duan T, Xu H (2022) Wnt inhibitory factor 1 ameliorated diabetic retinopathy through the AMPK/mTOR pathway-mediated mitochondrial function. FASEB J 36:e22531 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data of this article are available on request from the corresponding author.

Articles from In Vitro Cellular & Developmental Biology. Animal are provided here courtesy of Springer

RESOURCES