Skip to main content
Translational Andrology and Urology logoLink to Translational Andrology and Urology
. 2026 Feb 11;15(2):41. doi: 10.21037/tau-2025-723

Effect of lumbrokinase on a rat model of hyperlipidemia-induced erectile dysfunction

Xiaoxin Li 1,2,#, Yang Sun 2,#, Xinghao Zhang 2, Ziheng Zhang 2, Ziyang Han 3,, Yun Chen 2,
PMCID: PMC12968901  PMID: 41809787

Abstract

Background

Erectile dysfunction (ED), which frequently occurs in individuals with hyperlipidemia, seriously affects quality of life. Lumbrokinase exhibits multiple pharmacological effects. There is currently a lack of evidence to support the use of lumbrokinase in treating ED. We investigated the effect and mechanism of lumbrokinase in a rat model of hyperlipidemia-induced erectile function (HLED).

Methods

There were 28 male Sprague-Dawley rats included. Eight rats received a standard diet as controls; 20 rats were fed a high-cholesterol diet to induce hyperlipidemia. After 8 weeks, the apomorphine test (APO) was used to confirm HLED. Fourteen rats were then allocated into two subgroups: one received lumbrokinase by oral gavage for 4 weeks, and the other received saline as the control group. Erectile function was assessed by intracavernous pressure (ICP) and mean arterial pressure (MAP) measurements. Histopathological and apoptotic changes in the corpus cavernosum were examined, and phosphatidylinositol-3-kinase/protein kinase B (PI3K/Akt) pathway-related protein and gene expression were analyzed using Western blotting and quantitative real-time polymerase chain reaction (RT-qPCR).

Results

ICP/MAP were significantly higher in the treatment group than in the model group. Abnormal lipid levels, imbalance between NO and ET-1 and multi-organ lesions observed in the model group were improved in the treatment group. Moreover, the model group showed a higher rate of apoptotic cells, which was also inhibited by the lumbrokinase treatment. Furthermore, lumbrokinase significantly upregulated the expression of Bcl-2, PI3K and Akt and downregulated the expression of cleaved Caspase-3.

Conclusions

Lumbrokinase improved erectile function in rats with HLED, likely by inhibiting apoptosis. These findings provide evidence of a potential treatment option for HLED.

Keywords: Erectile dysfunction (ED), hyperlipidemia, phosphatidylinositol-3-kinase/protein kinase B (PI3K/Akt), apoptosis, lumbrokinase


Highlight box.

Key findings

• Lumbrokinase can facilitate the restoration of hyperlipidemia-induced erectile function (HLED) by upregulating the phosphatidylinositol-3-kinase/protein kinase B (PI3K/Akt) signaling pathway, thus inhibiting apoptosis.

What is known and what is new?

• Lumbrokinase exerts effects such as thrombolysis, anti-fibrosis and antioxidant stress.

• Lumbrokinase inhibits apoptosis by regulating the PI3K-Akt pathway.

What is the implication, and what should change now?

• These findings provide a potential novel treatment strategy for HLED. Further studies and clinical trials are required to verify the therapeutic efficacy of lumbrokinase.

Introduction

Background

Erectile dysfunction (ED) refers to the persistent difficulty in attaining or sustaining an erection adequate for sexual activity (1). Hyperlipidemia is proven to be an important risk factor of ED, which develops in 42.4% of people with hyperlipidemia (2). The progression of hyperlipidemia-induced erectile function (HLED) is related to structural alterations and diastolic endothelial dysfunction (3,4). To date, phosphodiesterase type 5 inhibitor (PDE5i) remains the primary therapeutic option for ED. But, the efficacy of PDE5i is inefficient in patients with hyperlipidemia (5). Therefore, novel therapeutic methods for HLED are urgently needed.

Rationale and knowledge gap

Current evidence indicates that apoptotic mechanisms significantly contribute to the development of ED in hyperlipidemic conditions (6). Among the key pathways regulating endothelial apoptosis, the phosphatidylinositol-3-kinase/protein kinase B (PI3K/Akt) cascade has emerged as particularly important (7). Mechanistically, extracellular signals activate membrane-bound PI3K, which catalyzes the conversion of PIP2 into PIP3 through phosphorylation (8). This lipid second messenger recruits and activates Akt, ultimately leading to apoptosis suppression through Bcl-2 upregulation and caspase-3 inhibition (9). While this pathway has been documented in ED associated with aging, diabetes mellitus, and neurological disorders (10-12), its potential involvement in HLED remains unexplored.

Lumbrokinase, a bioactive component extracted from earthworm (13), exhibits multiple pharmacological effects including thrombolysis, anticoagulation, anti-fibrosis, and antioxidative stress. Current clinical applications primarily target cardiovascular diseases, chronic kidney disease, and malignancies (14-17). Studies indicate that lumbrokinase suppresses platelet aggregation by elevating the level of adenosine 3',5'-cyclic monophosphate (cAMP), thereby inhibiting platelet activity. Additionally, it mitigates ischemic injury via anti-apoptotic mechanisms, suggesting therapeutic potential for atherosclerosis prevention and treatment (18). ED serves as a sentinel event for cardiovascular disease (19). However, no studies have yet reported lumbrokinase’s efficacy in managing erectile dysfunction.

Objective

This study investigated the efficacy and mechanism of lumbrokinase in a rat model of hyperlipidemia-associated ED. In this study, we constructed a stable and effective HLED model. Additionally, we discovered a notable increase in cell apoptosis and a downregulation of the PI3K/Akt signaling pathway in hyperlipidemic rats. Furthermore, we demonstrated that lumbrokinase preserved erectile function by inhibiting apoptosis of penile tissue via the PI3K/Akt pathway in ED rats with hyperlipidemia. These findings may provide a potential novel treatment strategy for HLED. We present this article in accordance with the ARRIVE reporting checklist (available at https://tau.amegroups.com/article/view/10.21037/tau-2025-723/rc).

Methods

Animal model and treatment of rats

All animal experiments were performed under a project license (No. 202401A040) granted by the Laboratory Animal Users Committee of the Experimental Animal Center of Nanjing University of Chinese Medicine, in compliance with Chinese institutional guidelines for the care and use of animals. A protocol was prepared before the study without registration. The study design diagram is depicted in Figure 1. Twenty-eight male Sprague-Dawley rats (weighing 200 to 240 g, 8–10 weeks old, obtained from the Beijing Weitong Lihua Experimental Animal Technology Co., Ltd., Beijing, China) were used for this study. The rats were raised in a pathogen-free environment at 22–24 ℃ with free access to food and water. Eight rats were designed as a normal control group which were fed a regular diet (Xie Tong Biology Technology Inc., Nanjing, China), while 20 rats were designed as experimental group which were fed supplemented high-cholesterol diet (2% cholesterol, 0.2% methylthiouracil, 0.5% sodium cholate, 10% egg yolk powder, 10% lard and 77.3% standard diet; Shuangshi Experimental Animal Feed, Suzhou, China). After the treatment for 8 weeks, all rats in the experimental group were evaluated with lipid profiles and erectile function by the apomorphine test (APO) (20). Each rat was acclimatized in a transparent observation cage (30 cm × 30 cm × 30 cm) for 10 minutes, followed by a subcutaneous injection of apomorphine (80 µg/kg; Sigma-Aldrich, St.Louis, USA) into the neck region. Erectile responses were monitored for 30 minutes thereafter. Rats with abnormal lipid profiles that did not have erections were considered HLED models. Fourteen APO-negative rats were randomly reassigned as model group (n=7) and lumbrokinase group (n=7, which were administered with lumbrokinase by oral gavage once daily at a dose of 80 mg/kg (21), Aladdin Industrial Corporation, Shanghai, China). Lumbrokinase was dissolved in saline (80 mg/mL). Other rats were given saline for 4 weeks. Rats with erectile response in APO were excluded from the study. During the experiment, no bleeding events were observed in the treatment group. In order to mitigate the influence of potential confounding variables, the procedure involving treatment and measurement was randomized. Animals were randomly assigned to experimental groups. Due to practical constraints related to daily drug administration, blinding was not implemented during the experimental procedures.

Figure 1.

Figure 1

The research design diagram. APO, apomorphine test; ET-1, endothelin-1; HDL, high-density lipoprotein cholesterol; HE, hematoxylin and eosin; HLED, hyperlipidemia-induced erectile dysfunction; ICP, intracavernous pressure; LDL, low-density lipoprotein cholesterol; MAP, mean arterial pressure; NO, nitric oxide; PI3K/Akt, phosphatidylinositol-3-kinase/protein kinase B; RT-qPCR, quantitative real-time polymerase chain reaction; TC, total cholesterol; TG, triglycerides.

Measurement of erection function

After 4 weeks of lumbrokinase treatment, erectile function was evaluated by electrical stimulation of the cavernous nerve according to established protocols (22). Rats were anesthetized with 3% pentobarbital sodium (40 mg/kg, intraperitoneal). One side of the pelvic ganglion and cavernous never were separated, and a 25-G needle was inserted into the penis (filled with 100 IU/mL of a heparin solution). The intracavernous pressure (ICP) was obtained after electrical stimulation at 5 V, frequency 20 HZ, pulse width 5 ms and duration of 60 s. A PE-50 catheter containing heparinized saline was placed in the left carotid artery to measure mean arterial pressure (MAP). The illustrative picture of the procedure is provided in Figure S1. The ratios of the maximal ICP to MAP (ICPmax/MAP) were recorded to evaluate the erectile function of each rat. After measurement, blood was collected from the abdominal aorta, and penile tissues were harvested for subsequent analyses.

Measurement of lipid profiles

The total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL) and high-density lipoprotein cholesterol (HDL) in plasma were detected using an automatic biochemical analyzer (Beckman Coulter AU480, Brea, USA).

Measurement of endothelin-1 (ET-1) and nitric oxide (NO)

The serum concentrations of ET-1 and NO, as the indirect parameters to reflect vascular endothelial function, were detected using ELISA kits (Shanghai Enzyme-linked Biotechnology Co., Ltd., Shanghai, China) according to the manufacturer’s instructions.

Histological analysis

Hematoxylin and eosin (HE) staining of liver tissue was performed to evaluate histopathological changes associated with hyperlipidemia and to verify the establishment of hepatic steatosis in the experimental model. The liver tissue was fixed in 4% formaldehyde, embedded in paraffin, and sectioned at a thickness of 8 µm for HE staining. Similar sections and trichrome staining were performed on the corpus cavernosum tissue by Masson to evaluate the distribution of smooth muscle and collagen. Quantitative analysis was conducted on 6 randomly selected microscopic fields from each group using Image-Pro Plus software (Media Cybernetics Inc., Bethesda, MD, USA).

Detection of the apoptotic level

To investigate the involvement of apoptosis-related processes in penile tissue and to support the mechanistic interpretation of lumbrokinase treatment, apoptotic activity and related molecular markers were evaluated. A TUNEL assay kit (Hunan Aifang Biotechnology Co., Ltd., Changsha, China) based on terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling was used to analyze cell apoptosis in the penis tissue sections according to the manufacturer’s instructions.

Western blot

Total protein was extracted from the penile strips using the appropriate amount of RIPA liquid. The protein concentrations were assayed using a BCA assay kit (Epizyme, Shanghai, China). Equal amounts (20 µg protein) were placed in SDS-PAGE, and then transferred onto a PVDF membrane (Millipore, Burlington, USA). After blocking with 5% bovine serum albumin, the samples were incubated overnight at 4 ℃ with the following primary antibodies: phospho-PI3K p85 (Thermo Fisher Scientific, Waltham, USA; #PA5-104853), PI3 kinase p110α (1:1,000, Cell Signaling Technology, Danvers, USA; #4249), phospho-Akt (Ser473, 1:2,000, Cell Signaling Technology, #4060), Akt (1:1,000, Cell Signaling Technology, #4691), Cleaved Caspase-3 (1:1,000, Cell Signaling Technology, #9664), Bcl-2 (1:2000, Proteintech, Wuhan, China; #26593-1-AP), p-eNOS (1:1,000, Thermo Fisher Scientific, #PA5-104858), Enos (1:1,000, Thermo Fisher Scientific, #PA1-037) and β-actin (1:50,000, Proteintech, #66009-1-1G). After incubation with HRP-conjugated secondary antibodies, protein bands were visualized using a fluorescent & chemiluminescence gel imaging system (Shanghai JiaPeng Science Technology Co., Ltd., Shanghai, China).

Real-time quantitative polymerase chain reaction (RT-qPCR)

RT-qPCR was conducted to quantify the mRNA expression levels of apoptosis-related genes in penile tissue. Caspase-3 and Bcl-2 mRNA levels were analyzed using RT-qPCR method. Caspase-3 and Bcl-2 mRNA levels were analyzed using RT-qPCR method. Total ribonucleic acid (RNA) from penile tissue was extracted using a Total RNA Isolation Kit-Box (Nanjing Vazyme Biotech Co., Ltd., Nanjing, China) and then cDNA was synthesized using the one-step genomic DNA removal and cDNA synthesis SuperMix kit (Vazyme). RT-qPCR was conducted using ChamQ Universal SYBR qPCR Master Mix (Vazyme). The level of β-actin messenger RNA expression was used as an endogenous reference for normalization, and mRNA expression levels in the 3 groups were determined using the 2−∆∆Ct method. The sequences are provided in Table 1.

Table 1. Sequences of primers for RT-qPCR.

Gene symbol Primer sequence
β-actin Forward: AGATGTGGATCAGCAAGCA
Reverse: GCGCAAGTTAGGTTTTGTCA
Caspase-3 Forward: GGACCTGTGGACCTGAAAAA
Reverse: GCATGCCATATCATCGTCAG
Bcl-2 Forward: ACTTCTCTCGTCGCTACCGTCG
Reverse: CCCTGAAGAGTTCCTCCACCACC

RT-qPCR, quantitative real-time polymerase chain reaction.

Statistical analysis

Statistical analysis was performed using GraphPad Prism 9.0 (a product of GraphPad Inc., USA). The data were presented as mean ± standard deviation (SD). The differences between groups were evaluated by one-way analysis of variance (ANOVA), and subsequent pairwise comparisons were conducted using the least significant difference (LSD) post-hoc test. A P<0.05 was considered statistically significant.

Results

Effect of lumbrokinase on erectile function in HLED rats

We evaluated erectile function in the rats by measuring the ICP and ICPmax/MAP by electrically stimulating the cavernous nerve. The erectile function was significantly decreased in the HL model group, as evidenced by ICP and ICPmax/MAP ratio relative to the control group. Lumbrokinase treatment significantly improved erectile function compared to the model group (Figure 2).

Figure 2.

Figure 2

Effect of lumbrokinase on erectile function in HLED rats. (A) Representative traces of the ICP with the following stimulation parameters: 5 V, 20 Hz, 5 ms and 60 s. (B,C) Erectile function is presented as ICP and ICPmax/MAP. Data are expressed as mean ± SD. ##, P<0.01 compared with the control group; **, P<0.01 compared with the model group. Control, rats fed normal diet; Model, rats fed high-cholesterol diet; Treatment, rats fed high-cholesterol diet with lumbrokinase administration. HLED, hyperlipidemia-induced erectile dysfunction; ICP, intracavernous pressure; MAP, mean arterial pressure.

Effect of lumbrokinase on serum of lipid levels

The serum concentrations of TC, TG, HDL, and LDL among the three groups are presented in Figure 3. After 8 weeks of high-fat diet feeding, TC and LDL levels were markedly elevated in the model group compared with the control group (P<0.01), whereas HDL and TG levels showed no significant changes (P>0.05). However, lumbrokinase treatment significantly reduced the serum levels of TC and LDL (P<0.01; Figure 3). The lipid data pre- and post-treatment in each group are provided in Table S1. There were significant differences in TC and LDL levels pre-treatment and post-treatment in the treatment group (P<0.01).

Figure 3.

Figure 3

Effect of lumbrokinase on serum of lipid levels. Data are expressed as mean ± SD. ##, P<0.01 compared with the control group; **, P<0.01 compared with the model group. Control, rats fed normal diet; Model, rats fed high-cholesterol diet; Treatment, rats fed high-cholesterol diet and lumbrokinase administration. HDL, high-density lipoprotein cholesterol; LDL, low-density lipoprotein cholesterol; SD, standard deviation; TC, total cholesterol; TG, triglycerides.

Effect of lumbrokinase on vascular endothelial function

Serum NO levels of the rats in the model group were significantly reduced compared with the control group, whereas ET-1 levels were markedly elevated in the model group relative to controls. However, the lumbrokinase therapy restored the balance between NO and ET-1 (Figure 4).

Figure 4.

Figure 4

Effect of lumbrokinase on vascular endothelial function. Serum NO and ET-1 levels of the rats in the experimental and control groups. Data are expressed as mean ± SD. ##, P<0.01 compared with the control group; *, P<0.05 compared with the model group. Control, rats fed normal diet; Model, rats fed high-cholesterol diet; Treatment, rats fed high-cholesterol diet and lumbrokinase administration. ET-1, endothelin-1; NO, nitric oxide; SD, standard deviation.

Effect of lumbrokinase on hyperlipidemia-induced histopathological alterations

HE staining of the liver and Masson’s trichrome staining of the corporal tissue were used to evaluate tissue damage caused by hyperlipidemia and determine the protective effect of lumbrokinase. Figure 5A showed there were many lipid vacuolar-like changes in the hepatic tissue of rats subjected to a high-fat diet, whereas the control group displayed normal hepatic architecture without lipid accumulation. Likewise, collagen deposition in the penile tissue was markedly elevated in the model group compared with controls (P<0.01). Treatment with lumbrokinase effectively mitigated these pathological alterations (Figure 5A-5C).

Figure 5.

Figure 5

Effect of lumbrokinase on the histological structure of the liver and corpus cavernosum. (A) Hematoxylin and eosin staining of hepatic tissue from each group. (B) Masson’s trichrome staining of penile tissue from different groups. (C) The ratio of the smooth muscle to collagen in a given area. Data are expressed as mean ± SD. ##, P<0.01 compared with the control group; *, P<0.05 compared with the model group. Control, rats fed normal diet; Model, rats fed high-cholesterol diet; Treatment, rats fed high-cholesterol diet and lumbrokinase administration. SD, standard deviation.

Effect of lumbrokinase on corporal apoptosis

Cell apoptosis of penile tissue in all rats was examined by TUNEL assay. The level of apoptosis revealed a markedly higher percentage in the model group than in the control group. We observed a lower rate of apoptotic cells in the lumbrokinase group (Figure 6A,6B). The detection of caspase-3 and Bcl-2 was used to evaluate cell proliferation and apoptosis in penile tissue. The levels of cleaved Caspase-3 protein and Caspase-3 mRNA in the corpora cavernosa were significantly elevated in the model group compared with the control group. Conversely, both the protein and mRNA expression of Bcl-2 were markedly decreased relative to controls. Treatment with lumbrokinase markedly suppressed cleaved Caspase-3 expression and enhanced Bcl-2 expression in HLED rats at both the protein and transcript levels (Figure 6C-6G).

Figure 6.

Figure 6

Effect of lumbrokinase on corporal apoptosis in HLED rats. (A) TUNEL staining (green) and DAPI (blue) representative images. The arrows represent apoptotic cells. (B) Apoptosis rate in the corpus cavernosum for the three groups. (C) Representative images of western blots for Cleaved caspase-3 and Bcl-2. (D,E) Protein expression and quantitative analysis of Cleaved caspase-3 and Bcl-2 in each group of rats. (F,G) Real-time polymerase chain reaction analysis of Caspase-3 and Bcl-2 levels in each group of rats. Data are expressed as mean ± SD. ##, P<0.01 compared with the control group; *, P<0.05, **, P<0.01 compared with the model group. Control, rats fed normal diet; Model, rats fed high-cholesterol diet; Treatment, rats fed high-cholesterol diet and lumbrokinase administration. DAPI, 4',6-diamidino-2-phenylindole; HLED, hyperlipidemia-induced erectile dysfunction; SD, standard deviation.

Effect of lumbrokinase treatment on PI3K/Akt signaling pathway

We evaluated the effect of lumbrokinase on PI3K/Akt signaling pathway. Protein expression ratios of p-PI3K/PI3K, p-Akt/Akt and p-eNOS/eNOS were markedly reduced in the model group. Lumbrokinase administration significantly restored these phosphorylation levels relative to the model group (Figure 7).

Figure 7.

Figure 7

Effect of lumbrokinase treatment on PI3K/Akt signaling pathway in HLED rats. (A) Representative images of western blots for PI3K/Akt pathway. (B-D) Expressions and quantitative analysis of PI3K/Akt pathway at the protein levels in each group of rats. Data are expressed as mean ± SD. #, P<0.05, ##, P<0.01 compared with the control group; *, P<0.05, compared with the model group. Control, rats fed normal diet; Model, rats fed high-cholesterol diet; Treatment, rats fed high-cholesterol diet and lumbrokinase administration. Akt, protein kinase B; HLED, hyperlipidemia-induced erectile dysfunction; PI3K, phosphatidylinositol-3-kinase; SD, standard deviation.

Discussion

In the present study, we investigated the therapeutic impact of lumbrokinase on erectile function in a rat model of HLED. We found that lumbrokinase enhanced erectile function by inhibiting apoptosis of penile tissue via the PI3K-Akt pathway.

Hyperlipidemia is an important risk factor for ED (23,24). We constructed a high cholesterol diet-induced hyperlipidemic rat model and found that erectile function in hyperlipidemic rats was lower than that in normal rats. The experiment results showed that the high cholesterol diet caused a significant increase in blood lipid profiles (TC and LDL). Similar to the serum lipid levels, a significant increase in fat vacuoles was observed in the liver samples of the model group, indicating signs of hepatic steatosis. Interestingly, in the current study, the levels of TC and LDL in the lumbrokinase treatment group were significantly lower than those in the model group. This is consistent with the result from a study that has reported the lipid-lowering effect of lumbrokinase in a hyperglycemia-induced mouse model (16). Based on the known fibrinolytic properties of lumbrokinase, its lipid-lowering effect may be related to its ability to dissolve lipid plaques in blood vessels, thereby improving blood circulation and metabolism. Moreover, our results suggested that lumbrokinase supplementation ameliorated fatty degeneration in the liver cells of hyperlipidemic rats. In addition, the levels of NO and ET-1 were measured to evaluate vascular endothelial function. It is commonly known that NO suppression contributes to the impairment of cavernosal function (25). We found that the NO level of rats in the model group was decreased and that the ET-1 level was increased. However, the treatment with lumbrokinase restored the balance between NO and ET-1 and improved erectile function.

The structural integrity of corpus cavernosum is crucial for the physiology of penile erection and its pathological changes play significant roles in the process of ED (26,27). Li et al. (6) demonstrated that hyperlipidemic rats exhibited decreased erectile response and structural alteration, specifically including increased collagen content and cavernous fibrosis. Our results also showed that collagen content was increased and smooth muscle levels were significantly lower in the model group than those in the control group, which indicated the presence of fibrosis in the corpus cavernosum. However, lumbrokinase treatment decreased the collagen content and inhibited the progression of fibrosis. Similarly, this result is similar to that of Sun et al. (28) who found lumbrokinase restricted renal fibrosis in diabetic rats, possibly related to an increase in the activity of extracellular matrix (ECM) degrading enzymes. There is also evidence suggesting a close relationship between fibrosis and apoptosis. Lin et al. (29) reported that apoptosis played a significant role in fibrosis in a diabetic animal model. However, there are limited reports on apoptosis causing fibrosis in hyperlipidemic conditions. Therefore, apoptosis was observed in our study. We found that there was a significant amount of cell apoptosis in the penile tissue of hyperlipidemic rats, accompanied by an increase in Caspase-3 expression and a decrease in Bcl-2 expression, resulting in the initiation of apoptosis (30,31). In addition, lumbrokinase treatment could protect against apoptosis by regulating Caspase-3 and Bcl-2. Similar to our results, accumulating evidence has demonstrated that lumbrokinase exerts a protective effect against cell apoptosis. Liao et al. (32) reported that lumbrokinase could inhibit myocardial apoptosis induced by second-hand tobacco smoke.

The PI3K/Akt pathway plays a pivotal role in regulating cell proliferation and survival (9,33). Several studies have shown that PI3K/Akt signaling pathway is involved in the development of erectile dysfunction (10-12). Whether PI3K/Akt signaling is also involved in the onset of HLED was unknown at present. So, in our study, the effect of lumbrokinase on PI3K/Akt signaling pathway in rats with ED was determined. As shown in Figure 7, phosphorylation ratios of PI3K and Akt were markedly reduced in the model group, whereas lumbrokinase administration significantly restored their expression levels. Likewise, a previous study showed lumbrokinase could enhance the protein levels of PI3K and Akt (34). In addition, after treatment with lumbrokinase, the phosphorylation ratio of eNOS also increased, which can promote the production of NO to promote erectile function (35). Thereby, lumbrokinase’s beneficial effect on erectile dysfunction induced by hyperlipidemia may be partly related to its efficacy in enhancing PI3K/Akt pathway. Through this study, the effect of lumbrokinase on PI3K/Akt pathway on hyperlipidemia associated ED was first revealed. While lumbrokinase treatment significantly reversed the pathological trends, it did not achieve a complete return to baseline levels. Irreversible damage, such as corpora cavernosa fibrosis and neuronal damage, may have already occurred in the penis tissue during the modeling phase.

This study has several limitations. Firstly, due to the fibrinolytic properties of lumbrokinase, the risk of bleeding has not been further evaluated. Additionally, there is a lack of a high-dose group of lumbrokinase to compare differences in therapeutic efficacy. Finally, we did not use PI3K inhibitors to further validate the role of lumbrokinase through this pathway. Future research should address these limitations in order to comprehensively evaluate the therapeutic potential of lumbrokinase.

Conclusions

This study demonstrated that apoptosis is a key mechanism contributing to erectile dysfunction induced by hyperlipidemia. Lumbrokinase treatment effectively improved erectile function in rats fed a high-cholesterol diet through multifaceted regulation of vascular and cellular pathways. Specifically, it lowered serum TC and LDL levels, restored the NO/ET-1 balance, alleviated hepatic steatosis, and reduced collagen deposition in the corpus cavernosum. Furthermore, lumbrokinase inhibited apoptosis by downregulating cleaved Caspase-3 and enhancing Bcl-2 expression, effects that are closely associated with the activation of the PI3K/Akt signaling pathway. These results indicate that lumbrokinase exerts protective effects on penile tissue by promoting cell survival and vascular integrity, providing experimental evidence for its potential as a therapeutic agent for hyperlipidemia-induced erectile dysfunction.

Supplementary

The article’s supplementary files as

tau-15-02-41-rc.pdf (890KB, pdf)
DOI: 10.21037/tau-2025-723
tau-15-02-41-coif.pdf (246.6KB, pdf)
DOI: 10.21037/tau-2025-723
DOI: 10.21037/tau-2025-723

Acknowledgments

The authors would like to thank the entire team for their invaluable support and assistance throughout the course of this study.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All animal experiments were performed under a project license (No. 202401A040) granted by the Laboratory Animal Users Committee of the Experimental Animal Center of Nanjing University of Chinese Medicine, in compliance with Chinese institutional guidelines for the care and use of animals.

Footnotes

Reporting Checklist: The authors have completed the ARRIVE reporting checklist. Available at https://tau.amegroups.com/article/view/10.21037/tau-2025-723/rc

Funding: This work was supported by the Natural Science Foundation of Nanjing University of Traditional Chinese Medicine (No. XZR20240235).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tau.amegroups.com/article/view/10.21037/tau-2025-723/coif). The authors have no conflicts of interest to declare.

Data Sharing Statement

Available at https://tau.amegroups.com/article/view/10.21037/tau-2025-723/dss

tau-15-02-41-dss.pdf (69.5KB, pdf)
DOI: 10.21037/tau-2025-723

References

  • 1.Salonia A, Bettocchi C, Boeri L, et al. European Association of Urology Guidelines on Sexual and Reproductive Health-2021 Update: Male Sexual Dysfunction. Eur Urol 2021;80:333-57. 10.1016/j.eururo.2021.06.007 [DOI] [PubMed] [Google Scholar]
  • 2.Seftel AD, Sun P, Swindle R. The prevalence of hypertension, hyperlipidemia, diabetes mellitus and depression in men with erectile dysfunction. J Urol 2004;171:2341-5. 10.1097/01.ju.0000125198.32936.38 [DOI] [PubMed] [Google Scholar]
  • 3.Huang YC, Wu CT, Chen MF, et al. Intracavernous Injection of Autologous Platelet-Rich Plasma Ameliorates Hyperlipidemia-Associated Erectile Dysfunction in a Rat Model. Sex Med 2021;9:100317. 10.1016/j.esxm.2020.100317 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Yeşilli C, Yaman O, Anafarta K. Effect of experimental hypercholesterolemia on cavernosal structures. Urology 2001;57:1184-8. 10.1016/s0090-4295(01)00974-8 [DOI] [PubMed] [Google Scholar]
  • 5.Lyu F, Long W, Ma L. Atherosclerosis-induced arterial erectile dysfunction: pathogenesis, diagnosis, and therapeutic strategies. Transl Androl Urol 2025;14:2732-53. 10.21037/tau-2025-241 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Li R, Cui K, Wang T, et al. Hyperlipidemia impairs erectile function in rats by causing cavernosal fibrosis. Andrologia 2017. [DOI] [PubMed] [Google Scholar]
  • 7.Vanhaesebroeck B, Perry MWD, Brown JR, et al. PI3K inhibitors are finally coming of age. Nat Rev Drug Discov 2021;20:741-69. 10.1038/s41573-021-00209-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Gong GQ, Bilanges B, Allsop B, et al. A small-molecule PI3Kα activator for cardioprotection and neuroregeneration. Nature 2023;618:159-68. 10.1038/s41586-023-05972-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Zheng T, Jiang T, Ma H, et al. Targeting PI3K/Akt in Cerebral Ischemia Reperfusion Injury Alleviation: From Signaling Networks to Targeted Therapy. Mol Neurobiol 2024;61:7930-49. 10.1007/s12035-024-04039-1 [DOI] [PubMed] [Google Scholar]
  • 10.Sun T, Liu Y, Chen Y, et al. Study on the mechanism of aging-related erectile dysfunction based on bioinformatics and experimental verification. Transl Androl Urol 2023;12:197-208. 10.21037/tau-22-511 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Liu S, Li K, Zhao Y, et al. Fermented Gynochthodes officinalis (F.C.How) Razafim. & B.Bremer alleviates diabetic erectile dysfunction by attenuating oxidative stress and regulating PI3K/Akt/eNOS pathway. J Ethnopharmacol 2023;307:116249. 10.1016/j.jep.2023.116249 [DOI] [PubMed] [Google Scholar]
  • 12.Ge Y, Xia T, Feng Z, et al. Knockdown of programmed cell death factor 4 restores erectile function by attenuating apoptosis in rats with bilateral cavernous nerve crush injury. Andrology 2024;12:1439-48. 10.1111/andr.13592 [DOI] [PubMed] [Google Scholar]
  • 13.Mihara H, Sumi H, Yoneta T, et al. A novel fibrinolytic enzyme extracted from the earthworm, Lumbricus rubellus. Jpn J Physiol 1991;41:461-72. 10.2170/jjphysiol.41.461 [DOI] [PubMed] [Google Scholar]
  • 14.Wang YH, Liao JM, Chen KM, et al. Lumbrokinase regulates endoplasmic reticulum stress to improve neurological deficits in ischemic stroke. Neuropharmacology 2022;221:109277. 10.1016/j.neuropharm.2022.109277 [DOI] [PubMed] [Google Scholar]
  • 15.Chen Y, Liu Y, Zhang J, et al. Efficacy and safety of lumbrokinase plus aspirin versus aspirin alone for acute ischemic stroke (LUCENT): study protocol for a multicenter randomized controlled trial. Trials 2022;23:285. 10.1186/s13063-022-06200-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Yang F, Zhang X, Huang J, et al. Lumbrokinase (LK) ameliorates diabetic kidney disease renal fibrosis through regulating snail via m6A RNA methyltransferase 3. Sci Rep 2024;14:28671. 10.1038/s41598-024-80168-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Hu B, Yan Y, Tong F, et al. Lumbrokinase/paclitaxel nanoparticle complex: potential therapeutic applications in bladder cancer. Int J Nanomedicine 2018;13:3625-40. 10.2147/IJN.S166438 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ji H, Wang L, Bi H, et al. Mechanisms of lumbrokinase in protection of cerebral ischemia. Eur J Pharmacol 2008;590:281-9. 10.1016/j.ejphar.2008.05.037 [DOI] [PubMed] [Google Scholar]
  • 19.Roumeguère T, Wespes E, Carpentier Y, et al. Erectile dysfunction is associated with a high prevalence of hyperlipidemia and coronary heart disease risk. Eur Urol 2003;44:355-9. 10.1016/s0302-2838(03)00306-3 [DOI] [PubMed] [Google Scholar]
  • 20.Wang H, Liu X, Zhang Z, et al. Effects of tadalafil on sexual behavior of male rats induced by chronic unpredictable mild stress. Sex Med 2023;11:qfad019. 10.1093/sexmed/qfad019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Metkar SK, Girigoswami A, Vijayashree R, et al. Attenuation of subcutaneous insulin induced amyloid mass in vivo using Lumbrokinase and Serratiopeptidase. Int J Biol Macromol 2020;163:128-34. 10.1016/j.ijbiomac.2020.06.256 [DOI] [PubMed] [Google Scholar]
  • 22.Fu Y, Zhang X, Xu R, et al. Fisetin-mediated PPAR-γ upregulation: a novel therapeutic approach for corpus cavernosum smooth-muscle-cell apoptosis and restoration of erectile function after cavernous nerve injury. Transl Androl Urol 2025;14:1429-43. 10.21037/tau-2025-63 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Goldstein I, Goren A, Li VW, et al. Epidemiology Update of Erectile Dysfunction in Eight Countries with High Burden. Sex Med Rev 2020;8:48-58. 10.1016/j.sxmr.2019.06.008 [DOI] [PubMed] [Google Scholar]
  • 24.Ding W, Fan JH, Zhong LR, et al. N-acetylcysteine ameliorates erectile dysfunction in rats with hyperlipidemia by inhibiting oxidative stress and corpus cavernosum smooth muscle cells phenotypic modulation. Asian J Androl 2024;26:99-106. 10.4103/aja202324 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Burnett AL, Lowenstein CJ, Bredt DS, et al. Nitric oxide: a physiologic mediator of penile erection. Science 1992;257:401-3. 10.1126/science.1378650 [DOI] [PubMed] [Google Scholar]
  • 26.Engin S, Barut EN, Kaya Yaşar Y, et al. Niclosamide attenuates erectile dysfunction and corporal fibrosis via reversal of Smad signaling in diabetic rat model. J Sex Med 2024;21:1111-9. 10.1093/jsxmed/qdae129 [DOI] [PubMed] [Google Scholar]
  • 27.Song J, Sun T, Tang Z, et al. Exosomes derived from smooth muscle cells ameliorate diabetes-induced erectile dysfunction by inhibiting fibrosis and modulating the NO/cGMP pathway. J Cell Mol Med 2020;24:13289-302. 10.1111/jcmm.15946 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Sun H, Ge N, Shao M, et al. Lumbrokinase attenuates diabetic nephropathy through regulating extracellular matrix degradation in Streptozotocin-induced diabetic rats. Diabetes Res Clin Pract 2013;100:85-95. 10.1016/j.diabres.2013.01.012 [DOI] [PubMed] [Google Scholar]
  • 29.Lin H, Wang T, Ruan Y, et al. Rapamycin Supplementation May Ameliorate Erectile Function in Rats With Streptozotocin-Induced Type 1 Diabetes by Inducing Autophagy and Inhibiting Apoptosis, Endothelial Dysfunction, and Corporal Fibrosis. J Sex Med 2018;15:1246-59. 10.1016/j.jsxm.2018.07.013 [DOI] [PubMed] [Google Scholar]
  • 30.Liu L, Liu B, Zhang B, et al. Polystyrene micro(nano)plastics damage the organelles of RBL-2H3 cells and promote MOAP-1 to induce apoptosis. J Hazard Mater 2022;438:129550. 10.1016/j.jhazmat.2022.129550 [DOI] [PubMed] [Google Scholar]
  • 31.Chen Z, Han X, Ouyang X, et al. Transplantation of induced pluripotent stem cell-derived mesenchymal stem cells improved erectile dysfunction induced by cavernous nerve injury. Theranostics 2019;9:6354-68. 10.7150/thno.34008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Liao HE, Lai CH, Ho TJ, et al. Cardio Protective Effects of Lumbrokinase and Dilong on Second-Hand Smoke-Induced Apoptotic Signaling in the Heart of a Rat Model. Chin J Physiol 2015;58:188-96. 10.4077/CJP.2015.BAD277 [DOI] [PubMed] [Google Scholar]
  • 33.Cui Y, Wu J, Wang Y, et al. Protective effects of ginsenoside F(2) on isoproterenol-induced myocardial infarction by activating the Nrf2/HO-1 and PI3K/Akt signaling pathways. Phytomedicine 2024;129:155637. 10.1016/j.phymed.2024.155637 [DOI] [PubMed] [Google Scholar]
  • 34.Han CK, Kuo WW, Shen CY, et al. Dilong prevents the high-KCl cardioplegic solution administration-induced apoptosis in H9c2 cardiomyoblast cells mediated by MEK. Am J Chin Med 2014;42:1507-19. 10.1142/S0192415X14500943 [DOI] [PubMed] [Google Scholar]
  • 35.Mao Y, Zha Y, Zang Y, et al. Isorhamnetin improves diabetes-induced erectile dysfunction in rats through activation of the PI3K/AKT/eNOS signaling pathway. Biomed Pharmacother 2024;177:116987. 10.1016/j.biopha.2024.116987 [DOI] [PubMed] [Google Scholar]

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    The article’s supplementary files as

    tau-15-02-41-rc.pdf (890KB, pdf)
    DOI: 10.21037/tau-2025-723
    tau-15-02-41-coif.pdf (246.6KB, pdf)
    DOI: 10.21037/tau-2025-723
    DOI: 10.21037/tau-2025-723

    Data Availability Statement

    Available at https://tau.amegroups.com/article/view/10.21037/tau-2025-723/dss

    tau-15-02-41-dss.pdf (69.5KB, pdf)
    DOI: 10.21037/tau-2025-723

    Articles from Translational Andrology and Urology are provided here courtesy of AME Publications

    RESOURCES