Prenatal exposure to an environmentally relevant phthalate mixture alters oxidative stress, apoptosis, cell cycle regulators, and steroidogenic factors in the ovaries of F1 mice

Abstract

Phthalates are synthetic chemical compounds found in consumer products and known endocrine-disrupting chemicals. However, it is not well known if prenatal exposure to phthalate mixtures can affect reproductive health in female offspring. Thus, this study tested the hypothesis that prenatal exposure to an environmentally relevant phthalate mixture disrupts long-term ovarian function in adult F1 mice. Pregnant CD-1 dams were dosed orally with vehicle control (corn oil) or phthalate mixture (20 μg/kg/day-500 mg/kg/day) from gestational day 10 until birth. After birth, the F1 female ovaries and sera were collected on postnatal day (PND) 60, 3 months, and 6 months. F1 ovaries were used for evaluation of the proliferative marker, Ki67, and to quantify gene expression of steroidogenic regulators, antioxidant enzymes, apoptotic factors and cell cycle regulators. Sera were collected to measure sex steroid hormone levels. At PND60, prenatal exposure to the mixture decreased the expression of Star, Cyp11a1, Bad, and Casp3 in F1 females at PND60 compared to controls. At 3 months, the mixture decreased expression of Cyp11a1, Hsd3b1, Sod1, Casp3, Casp8, and Fas and increased gene expression of Star and Gpx in F1 ovaries compared to the controls. At 6 months, the mixture decreased testosterone levels and expression of Gsr, Bad, Bok, Casp8, Fas and Traf3, and it increased expression of Star in F1 females compared to the controls. Collectively, these data suggest that the prenatal exposure to an environmentally relevant phthalate mixture may have long-term consequences on ovarian health and function in F1 females long after initial exposure.

1. Introduction

Phthalates are a group of synthetic chemical compounds commonly used in the manufacturing of plastics, solvents, and personal care products [1]. Phthalates are also found in consumer products such as food and beverages [2]. Humans can be exposed to phthalates via ingestion, inhalation, dermal absorption, and parenteral administration. Ingestion is the primary route of phthalate exposure in humans [3].

Several phthalates have been classified as endocrine-disrupting chemicals (EDCs). Exposure to EDCs such as phthalates can have long-term consequences on the female reproductive system. Studies have shown phthalates can impact sexual development, hormone production, follicular growth and maturation, estrous cyclicity, and sexual behaviors in invertebrates, marine and freshwater animals, rodents, and humans [4-10]. Although studies have evaluated the impact of phthalates on female reproduction, most toxicological studies have focused on the effects of single phthalate exposure [11-14]. Phthalates are more prevalently seen in the environment as mixtures than as individual chemicals. Humans and animals can be repeatedly exposed to phthalates in various mixtures that may differ based on geographic location, race/ethnicity, age, and co-exposure to other EDCs [15-18]. Phthalates can act synergistically as mixtures, causing different adverse reproductive and developmental effects than those observed in studies evaluating single phthalate exposure [19].

The ovary is particularly sensitive to EDCs during development. Several rodent studies indicate that prenatal exposure to EDCs can alter ovarian function in the F1 generation, leading to long-term adverse reproductive outcomes such as infertility [20-24]. This is because the female reproductive system is dependent on the normal development and function of the ovary. The ovaries are important for producing a mature oocyte required for fertilization and synthesizing sex steroid hormones that help regulate the female reproductive cycle and fertility [6]. However, little information is available about the effects of prenatal exposure to an environmentally relevant phthalate mixture on the function of the adult ovary in the F1 generation. Given that oxidative stress, apoptosis, and dysregulation of the cell cycle are common mechanisms underlying abnormal ovarian function, the goal of this study was to determine the extent to which developmental exposure to an environmentally relevant phthalate mixture alters the long-term ovarian health and function of adults in the F1 generation of mice. Thus, this study was designed to examine the effects of prenatal exposure to a phthalate mixture on markers that are critical for regulating development and physiology of the ovary and female reproductive system. This included evaluating key factors involved in the steroidogenic pathway, antioxidant production, apoptosis, cell cycle regulation, and ovarian cell proliferation. Specifically, this study tested the hypothesis that prenatal exposure to an environmentally relevant phthalate mixture disrupts long-term ovarian function in adult F1 mice. The current study is unique because it evaluates the effects of prenatal exposure to a phthalate mixture on the F1 ovary at time-points and on endpoints previously not evaluated in other studies [24-27].

2. Methods

The phthalate mixture used in this study was based on human exposure levels of pregnant women located in central Illinois and the broader US population [18]. Further, the mixture has been used in several previous studies in rodents demonstrating that the mixture is a reproductive toxicant [26,27]. The mixture was composed of diethyl phthalate (DEP), dibutyl phthalate (DBP), diisobutyl phthalate (DiBP), di(2-ethylhexyl) phthalate (DEHP), benzylbutyl phthalate (BzBP), and di-isononyl phthalate (DiNP) purchased from Sigma-Aldrich (St. Louis, MO). The phthalate composition included DEP (35.22 %), DEHP (21.03 %), DBP (14.91 %), DiBP (8.61 %), DiNP (15.10 %), and BzBP (5.13 %).

3. Animals

CD-1 adult and normally cycling female mice (PND 60) were purchased from Charles River Laboratories (Wilmington MA) and housed individually in the College of Veterinary Medicine Animal Facility at the University of Illinois Urbana-Champaign (Urbana IL). Mice were acclimated to the facility for one week with 12-hour light/12-hour dark cycles before the experiment was started. All mice received Teklad Rodent Diet 8604 (Envigo Madison, Wisconsin) and reverse-osmosis filtered high-purity water ad libitum. Animal handling procedures, including euthanasia and tissue collections, were approved by the University of Illinois Institutional Animal Care and Use Committee (IACUC) at the University of Illinois (Protocol#:23010).

4. Study design

A total of 60 adult F0 female mice (PND 60) were mated with non-treated proven breeder CD-1 adult males. Gestational day (GD) 1 of pregnancy was marked by the presence of a vaginal plug and indicated successful mating. Pregnant F0 female dams were then separated from males and housed separately. Then, the pregnant dams were divided into five different treatment groups of 12 dams each. Dams were dosed orally with tocopherol-stripped corn oil (vehicle control) or various concentrations of the phthalate mixture (20 µg/mg/day, 200 μg/mg/ day, 200 mg/mg/day, 500 mg/mg/day) from GD 10 until birth (corn oil catalog# 401100, Dyets, Inc, (Bethlehem Pennsylvania,) DEHP catalog#: D201154–500mL, DEP catalog#: 524972–5 mL, BzBP catalog#: 308501–5 mL, DiBP catalog#: 152641–100 mL, DBP catalog#:524980–25 mL, and DiNP catalog#: 376663–1 L). The oral route of exposure was used to mimic the most common route of exposure in humans [3,28].

The selected doses of most phthalates present in the mixture are closely related to human exposure levels [29,30]. The estimated DEHP exposure range in humans is about 3–30 μg/kg/day. In our mixture, the 20 and 200 μg/kg/day doses contain approximately 4.2 and 42 μg of DEHP and are closely related to human exposure levels. DEP human exposure levels range from 2.32–12 μg/kg/day and the 20 μg/kg/day dose of phthalate mixture used in this study contains approximately 7 μg of DEP. Another phthalate in the mixture, BzBP, ranges from 0.26–0.88 μg/kg/day in humans and the 20 μg/kg/day phthalate mixture dose contains approximately 1 μg of BzBP. Similarly, human exposure levels for DiBP range from 0.12–1.4 μg/kg/day and the 20 μg/kg/day dose contains approximately 1.6 μg of DiBP. Additionally, DBP exposure in humans falls within 0.84–5.22 μg/kg/day and approximately 3 μg is present in the 20 μg/kg/day mixture dose. Lastly, DiNP can range in humans from approximately 26 μg/kg/day for occupational exposure and 120 μg/kg/day in infants [31,32]. The 200 μg/kg/day phthalate mixture dose for this study contains approximately 30 μg of DiNP, which is within range of occupational and infant exposure levels. This study also included two higher doses of the phthalate mixture (200 mg/kg/day and 500 mg/kg/day). The higher doses were selected to compare our results to other studies evaluating single phthalate exposure on similar female reproductive endpoints [22, 23,33]. The timing of exposure was selected to represent critical windows of ovarian development [25,26]. In mice, primordial germ cells migrate to the site of the developing ovary around gestational day 10 to form germ cell nests [34,35]. During embryonic development, the germ cell nests are broken down to form the finite pool of primordial follicles, which are recruited to more mature follicles through the process of folliculogenesis [6]. The exposure window from gestational day 10.5 until birth was chosen for this study because it represents a highly sensitive window for ovarian development and sets the stage for the fate of the follicle pool in the developing ovary. All dams were allowed to give birth naturally, producing the F1 generation. The F1 generation females were then euthanized at selected timepoints to evaluate ovarian health. In all experiments, the F0 dam represents the experimental unit “n.” All analyses were conducted on at least 1 female F1 pup per litter for n = 6 dams.

5. Tissue collection

The F1 female mice from each dam were randomly selected and euthanized on PND 60, 3 months, and 6 months. Ovaries and sera were collected during the diestrous stage of the estrous cycle to minimize hormonal and ovarian variation among animals. The diestrous stage of the estrous cycle was determined by vaginal lavage with 1x phosphate-buffered saline. Sera were stored at −80°C for measurement of hormone levels by enzyme-linked immunosorbent assays (ELISAs) as described below. Select ovaries were frozen at −80°C for RNA extraction and used for quantitative real-time polymerase chain reaction (qPCR) analysis as described below. Some ovaries were also placed in 10 % neutral buffered formalin, embedded in paraffin, and sectioned for immunohistochemical staining as described below.

6. Gene expression analysis

Frozen whole ovaries collected at PND 60, 3 months, and 6 months were used for qPCR analysis (n = 3–6 ovaries per treatment group). RNA was isolated using RNA easy Mini Kits (Qiagen, Inc, Valencia CA) according to the manufacturer’s protocol. RNA was eluted in RNase-free water and the concentration was determined using a Nanodrop (λ = 260/280 nm; ND 1000; Nanodrop Technologies Inc., Wilmington, DE). RNA (1000 ng) was reverse transcribed to complementary DNA (cDNA) using iScript Reverse Transcriptase (Bio-Rad Laboratories, Inc., Hercules, CA). Analysis of qPCR was performed using the CFX96 C1000 Real-Time PCR Detection System and CFX Manager Software (Bio-Rad Laboratories, Inc., Hercules, CA) according to the manufacturer’s protocol. All gene expression data were normalized to the housekeeping gene beta-actin (ActB). The genes examined were those involved in the steroidogenic pathway: FSH receptor (Fshr), LH receptor (Lhcgr), steroidogenic acute regulatory protein (Star), cytochrome P450 side-chain cleavage (Cyp11a1), 3β-hydroxysteroid dehydrogenase 1 (Hsd3b1), cytochrome P450 steroid 17-α-hydroxylase 1 (Cyp17a1), 17β-hydroxysteroid dehydrogenase 1 (Hsd17b1), cytochrome P450 aromatase (Cyp19a1) (Table 1).

Table 1.

DNA oligonucleotide primers used for qPCR gene expression assays.

Gene Name	Gene Symbol	5’-Forward-3’	5’-Reverse-3’
Beta-actin	Actb	GGGCACAGTGTGGGTGAC	CTGGCACCACACCTTCTAC
FSH receptor	Fshr	GGAGAGACTGGATCTTGTGAAAGG	GCAGATGTGTTCTCCAACCTACC
LH receptor	Lhcgr	AACCCGGTGCTTTTTACAAACC	TCCCATTGAATGCATGGCTT
Steroidogenic acute regulatory protein	Star	CAGGGAGAGGTGGCTATGCA	CCGTGTCTTTTCCAATCCTCTG
Cytochrome P450 side-chain cleavage	Cyp11a1	AGATCCCTTCCCCTGGTGACAATG	CGCATGAGAAGAGTATCGACGCATC
3β-hydroxysteroid dehydrogenase 1	Hsd3b1	CAGGAGAAAGAACTGCAGGAGGTC	GCACACTTGCTTGAACACAGGC
Cytochrome P450 steroid 17-α-hydroxylase 1	Cyp17a1	CCAGGACCCAAGTGTGTTCT	CCTGATACGAAGCACTTCTCG
17β-hydroxysteroid dehydrogenase 1	Hsd17b1	ACTGTGCCAGCAAGTTTGCG	AAGCGGTTCGTGGAGAAGTAG
Cytochrome P450 aromatase	Cyp19a1	CATGGTCCCGGAAACTGTGA	GTAGTAGTTGCAGGCACTTC
Catalase	Cat	GCAGATACCTGTGAACTGTC	GTAGAATGTCCGCACCTGAG
Glutathione peroxidase	Gpx	CCTCAAGTACGTCCGACCTG	CAATGTCGTTGCGGCACACC
Glutathione reductase	Gsr	CAGTTGGCATGTCATCAAGCA	CGAATGTTGCATAGCCGTGG
Superoxide dismutase 1	Sod1	TTCCGTCCGTCGGCTTCTCGT	CGCACACCGCTTTCATCGCC
BCL2-associated agonist of cell death	Bad	AAGTCCGATCCCGGAATCC	GCTCACTCGGCTCAAACTCT
BCL2-associated X protein	Bax	TGAAGACAGGGGCCTTTTTG	AATTCGCCGGAGACACTCG
B cell leukemia/lymphoma 2	Bcl2	ATGCCTTTGTGGAACTATATGGC	GGTATGCACCCAGAGTGATGC
Bcl2-like 10	Bcl2l10	CGCTACACACACTGACTGGA	CTTTAGGATCCCCTGCCCTG
BCL2-related ovarian killer protein	Bok	CTGCCCCTGGAGGACGCTTG	CCGTCACCACAGGCTCCGAC
Caspase 3	Casp3	TGGTGATGAAGGGGTCATTTATG	TTCGGCTTTCCAGTCAGACTC
Caspase 8	Casp8	CGAGAGGAGATGGTGAGAGAGC	CAGGCTCAAGTCATCTTCCAGC
Fas cell surface death receptor	Fas	TATCAAGGAGGCCCATTTTGC	TGTTTCCACTTCTAAACCATGCT
TNF receptor-associated factor 3	Traf3	CAGCCTAACCCACCCCTAAAG	TCTTCCACCGTCTTCACAAAC
Cyclin A2	Ccna2	GCTCTACTGCCCGGAGGCTGA	TGGCCTACATGTCCTCTGGGGAA
Cyclin E1	Ccne1	GGTGTCCTCGCTGCTTCTGCTT	CCGGATAACCATGGCGAACGGA
Cyclin B1	Ccnb1	TGCATTCTCTCAGTGCCCTCCACA	AGACAGGAGTGGCGCCTTGGT
Cyclin D2	Ccnd2	CCTTTGACGCAGGCTCCCTTCT	ACCCTGGTGCACGCATGCAAA
Cyclin-dependent kinase 4	Cdk4	AGAAACCCTCGCTGAAGCGGCA	TGGGGGTGAACCTCGTAAGGAGA
Cyclin-dependent kinase inhibitor 1 A	Cdkn1a	TTAGGCAGCTCCAGTGGCAACC	ACCCCCACCACCACACACCATA

Other genes included oxidative stress markers: catalase (Cat), glutathione peroxidase (Gpx), glutathione reductase (Gsr), superoxide dismutase 1 (Sod1); apoptotic factors: BCL2-associated agonist of cell death (Bad), BCL2-associated X protein (Bax), B cell leukemia/lymphoma 2 (Bcl2), Bcl2-like 10 (Bcl2l10), BCL2-related ovarian killer protein (Bok), caspase 3 (Casp3), caspase 8 (Casp8), Fas cell surface death receptor (Fas), TNF receptor-associated factor 3 (Traf3); and cell cycle regulators: cyclin A2 (Ccna2), cyclin E1 (Ccne1), cyclin B1(Ccnb1), cyclin D2 (Ccnd2), cyclin-dependent kinase 4 (Cdk4), and cyclin-dependent kinase inhibitor 1 A (Cdkn1a) (Table 1). The relative fold changes were calculated and compared to the control group using the Pfaffl analysis model [36].

7. Enzyme-linked immunosorbent assays (ELISAs)

Sera from mice (3-month and 6-month-old) were obtained by centrifugation of blood samples at 2000 x g for 10 minutes. Estradiol, testosterone, and pregnenolone concentrations were measured using ELISAs (DRG International Inc., Springfield, NJ, USA) following the manufacturer’s protocol. The analytical sensitivities of the assays for each hormone were 10.6 pg/mL for estradiol, 0.083 ng/mL for testosterone, and 0.05 ng/mL for pregnenolone. The intra- and inter-assay coefficients of variability were less than 10 %. Based on protocol-specific absorbances, a BioTek Gen5 microplate reader was used to generate standard curves and calculate hormone concentrations.

8. Immunohistochemical proliferation analysis

Ovaries were fixed in 10 % neutral buffered formalin, embedded in paraffin, and serial sectioned at 5 μm. About 6 sections per ovary were mounted on glass slides for each individual ovary sample collected, and 3 animals per treatment group were analyzed. Slides were randomly assigned and stained in multiple batches. The slides went through a series of steps including deparaffinization and heat-induced antigen retrieval (10 mM sodium citrate buffer at pH 6.0) for 15 minutes in a pressure cooker. Following heat exposure, slides were treated with 3 % hydrogen peroxide for 10 minutes at room temperature. Slides were then blocked with 2.5 % normal horse serum (ImmPRESS Horse Anti-Rabbit IgG Polymer Kit, catalog no. MP-7401, Vector Laboratories) for 1 hour, and incubated with Ki67 rabbit polyclonal primary antibody (ab15580 at 1:2000, Abcam) overnight at 4°C. After overnight exposure to primary antibody, slides were washed in 1x TBS-T (1x Tris Buffer Saline and Triton X-100) and incubated with the Impress Horse Anti-Rabbit IgG Polymer Reagent secondary antibody (catalog no. MP-7401, Vector Laboratories) for 30 minutes. To visualize Ki67 location, ImmPACT Diaminobenzi-dine (DAB) peroxidase substrate solution (SK-4105, Vector Laboratories) was then applied to each sample for approximately 30 seconds, until color optimally developed before rinsing with tap water. The slides were then counterstained with Tacha’s Hematoxylin, Tacha’s Bluing Reagent and cover-slipped.

9. Analysis of protein staining

Analysis of the amount of Ki67 staining in the ovary was done to assess the rate of cell proliferation in antral follicles. Levels of Ki67 staining were quantified using methods adapted from the literature [14, 37,38]. Slides were imaged using a NanoZoomer Digital Pathology System (Hamamatsu) and analyzed using the FIJI version of ImageJ [39]. Three sections from each ovary were assessed from three animals per treatment group. All antral follicles from each three sections were outlined using the area selection tool via ImageJ and counted individually. Images were converted to black and white and inverted using the threshold method [37]. The threshold minimum for all images analyzed was set to 123 and maximum was set to 255. The area was measured to determine the percentage of stained pixels. The Cell Counter plugin (GitHub) was used to calculate the number of stained cells. Cell counts and percentages of total area in antral follicles were then averaged amongst individual animals and used for statistical analysis.

10. Statistical analysis

If data were normally distributed and met the assumption of homogeneity of variance, one-way ANOVAs followed by Dunnett post-hoc comparison tests were performed. If equal variance was not assumed, a Games-Howell post-hoc comparisons test was performed. If normal distribution was not assumed, the Kruskal-Wallis test was used for comparison between groups, followed by the Dunn’s multiple comparison test. Statistical significance was assigned P ≤ 0.05. If P-values were greater than 0.05, but less than 0.1, data were considered to exhibit borderline significance. The software GraphPad Prism (GraphPad Prism version 10.0.0 for Windows, GraphPad Software, Boston, Massachusetts USA, www.graphpad.com) was used for data analysis.

11. Results

11.1. Effects of prenatal exposure to an environmentally relevant phthalate mixture on ovarian gene expression in F1 female mice at PND 60

Prenatal exposure to the phthalate mixture at some doses significantly decreased expression of the steroidogenic regulator Star (20 and 200 μg/kg/day, and 500 mg/kg/day) and borderline decreased the expression of the steroidogenic regulator Cyp11a1 (500 mg/kg/day) in the F1 ovary on PND60 in comparison to controls (Fig. 1A and B; n = 6, significant difference if p value is ≤ 0.05, borderline significant difference if is p value is 0.05 < p < 0.10). In contrast, prenatal exposure to the phthalate mixture did not significantly affect the expression of several genes involved in the steroidogenic pathway (i.e., Cyp17a1, Hsd3b1, Hsd17b1, Cyp19a1, Fshr, and Lhcgr) in the F1 ovary on PND60 in comparison to controls (Fig. 1C-H).

Fig. 1.

Effects of prenatal exposure to a phthalate mixture on key genes regulating steroidogenesis in F1 female mice at PND 60. Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, 200 and 500 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then ovaries were collected from selected F1 females on PND 60 to measure gene expression via qPCR (panels A-H; n = 6, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05, borderline difference if p is 0.05 < p < 0.10).

Prenatal exposure to the phthalate mixture did not significantly affect the ovarian expression of genes involved in the regulation of oxidative stress in the F1 generation. Specifically, prenatal exposure to the mixture did not affect expression of the antioxidant factors known as Cat, Gpx, Sod1, and Gsr in the F1 ovary on PND 60 in comparison to controls (Fig. 2A-D).

Fig. 2.

Effects of prenatal exposure to a phthalate mixture on key antioxidant genes in F1 female mice at PND 60. Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, 200 and 500 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then ovaries were collected from select F1 females on PND 60 to measure gene expression via qPCR (panels A-D; n = 6).

Prenatal exposure to the phthalate mixture significantly affected the expression of several regulators of apoptosis in the F1 ovary. Specifically, prenatal exposure to the phthalate mixture (200 mg/kg/day) significantly decreased the expression of genes involved in the promotion and execution of apoptotic cell death (Bad, Casp3) on PND60 in comparison to controls (Fig. 3A, and D; n = 6, significant difference, p ≤ 0.05). However, prenatal exposure to the phthalate mixture did not affect ovarian gene expression of other apoptotic regulators such as Bcl2, Bok, Bcl2l10, Casp8, Fas, Bax, and Traf3 in the F1 ovary on PND 60 in comparison to controls (Fig. 3B, C, E, F, G, H and I).

Fig. 3.

Effects of prenatal exposure to a phthalate mixture on key genes regulating apoptosis in F1 female mice at PND 60. Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, 200 and 500 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then ovaries were collected from select F1 females on PND 60 to measure gene expression via qPCR (panels A-I; n = 6, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05, borderline difference if p is 0.05 < p < 0.10).

Prenatal exposure to the phthalate mixture did not alter selected cell cycle regulators. Specifically, prenatal exposure to the phthalate mixture did not affect the expression of the cell cycle regulators Ccne1, Cdkna1, Ccnd2, Ccna2, and Cdk4 in the F1 ovary on PND60 in comparison to controls (Fig. 4A-E).

Fig. 4.

Effects of prenatal exposure to a phthalate mixture on key genes regulating cell cycle in F1 female mice at PND 60. Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, 200 and 500 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then ovaries were collected from select F1 females on PND 60 to measure gene expression via qPCR (panels A-E; n = 6).

11.2. Effects of prenatal exposure to an environmentally relevant phthalate mixture on ovarian gene expression in F1 female mice at 3 months

Prenatal exposure to the phthalate mixture (200 mg/kg/day) borderline increased the expression of the steroidogenic regulator Star in the 3-month-old F1 ovary in comparison to controls (Fig. 5A; n = 6, borderline difference, 0.05 < p < 0.10). Prenatal exposure to the phthalate mixture (200 μg/kg/day) also significantly decreased the expression of the steroidogenic enzyme Cyp11a1 and borderline decreased the expression of the steroidogenic enzyme Hsd3b1 in the 3-month-old F1 ovary in comparison to controls (Fig. 5B, and D; n = 6, significant difference, p ≤ 0.05, borderline difference, 0.05 < p < 0.10). However, prenatal exposure to the phthalate mixture did not significantly affect the expression of other genes involved in steroidogenesis (Cyp17a1, Hsd17b1, Cyp19a1, Fshr, and Lhcgr) in the 3-month-old F1 ovary in comparison to the controls (Fig. 5C, E, F, G, H).

Fig. 5.

Effects of prenatal exposure to a phthalate mixture on key genes involved in the steroidogenic pathway in F1 female mice at 3 months. Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, and 200 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then ovaries were collected from select F1 females at 3 months to measure gene expression via qPCR (panels A-H; n = 6, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05, borderline difference if p is 0.05 < p < 0.10).

Prenatal exposure to the mixture did not significantly affect the ovarian expression of antioxidant factor Cat in the 3-month-old F1 ovary comparison to controls (Fig. 6A). In contrast, prenatal exposure to the phthalate mixture (200 mg/kg/day) significantly increased the expression of the antioxidant factor Gpx in the 3-month-old F1 ovary in comparison to controls (Fig. 6B; n = 6, significant difference, p ≤ 0.05). Prenatal exposure to the phthalate mixture (200 μg/kg/day and 200 mg/kg/day) also significantly decreased expression of the antioxidant factor Sod1 in the 3-month-old F1 ovary in comparison to controls (Fig. 6C; n = 6, significant difference, p ≤ 0.05).

Fig. 6.

Effects of prenatal exposure to a phthalate mixture on key enzymes involved in antioxidant production in F1 female mice at 3 months. Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, and 200 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then ovaries were collected from select F1 females at 3 months to measure gene expression via qPCR. (panels A-C; n = 6, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05, borderline difference if p is 0.05 < p < 0.10).

Prenatal exposure to the phthalate mixture did not significantly alter the ovarian apoptotic factors Bad, Bcl2, Bok, Bcl2l10, Bax, and Traf3 in the 3-month-old F1 ovary in comparison to controls (Fig. 7A, B, C, E, H, and I; n = 6). However, exposure to the phthalate mixture significantly or borderline decreased the expression of pro-apoptotic factors Casp3 (20 and 200 μg/kg/day, and 200 mg/kg/day), Casp8 (20 and 200 μg/ kg/day), and Fas (200 μg/kg/day, and 200 mg/kg/day) in the 3-month-old F1 ovary in comparison to controls (Fig. 7D, F, and G; n = 6, significant difference, p ≤ 0.05, borderline difference, p is 0.05 < p < 0.10).

Fig. 7.

Effects of prenatal exposure to a phthalate mixture on key genes regulating apoptosis in F1 female mice at 3 months. Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, and 200 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then ovaries were collected from select F1 females at 3 months to measure gene expression via qPCR (panels A-I; n = 6, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05, borderline difference if p is 0.05 < p < 0.10).

Prenatal exposure to the phthalate mixture did not alter the selected cell cycle regulators. Specifically, prenatal exposure to the phthalate mixture did not affect expression of the cell cycle regulators Ccne1, Cdkna1, Ccnd2, Ccna2, Ccnb1, and Cdk4 in the F1 ovary at 3 months in comparison to controls (Fig. 8A-F).

Fig. 8.

Effects of prenatal exposure to a phthalate mixture on key genes regulating cell cycle in F1 female mice at 3 months. Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, and 200 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then ovaries were collected from select F1 females at 3 months to measure gene expression via qPCR (panels A-F; n = 6).

11.3. Effects of prenatal exposure to an environmentally relevant phthalate mixture on steroid hormone levels in F1 female mice at 3 months

Prenatal exposure to the phthalate mixture did not significantly alter the levels of steroid hormones in F1 females at 3 months. Specifically, prenatal exposure to the phthalate mixture did not affect the levels of pregnenolone, testosterone, or estradiol in 3-month-old F1 females in comparison to controls (Fig. 9A-C).

Fig. 9.

Effects of prenatal exposure to a phthalate mixture on serum hormone levels in F1 female mice at 3 months. Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, and 200 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then sera were collected from the F1 females at 3 months to measure pregnenolone (Panel A), testosterone (Panel B), and estradiol (Panel C). (panels A-C; n = 6).

11.4. Effects of prenatal exposure to an environmentally relevant phthalate mixture on ovarian gene expression in F1 female mice at 6 months

Prenatal exposure to the phthalate mixture did not significantly affect the expression of several genes involved in the regulation of steroidogenesis (Cyp11a1, Cyp17a1, Hsd3b1, Hsd17b1, Cyp19a1, and Fshr) in the 6-month-old F1 ovary in comparison to the controls (Fig. 10B-G). In contrast, prenatal exposure to the phthalate mixture (20 μg/kg/day) significantly increased expression of Star in the 6-month-old F1 ovary in comparison to controls (Fig. 10A; n = 6 significant difference, p ≤ 0.05).

Fig. 10.

Effects of prenatal exposure to a phthalate mixture on genes regulating steroidogenesis in F1 female mice at 6 months. Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, and 200 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then ovaries were collected from select F1 females at 6 months to measure gene expression via qPCR (panels A-G; n = 6, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05).

Prenatal exposure to the phthalate mixture did not significantly affect expression of the antioxidant factors Cat, Gpx, and Sod1 in the 6-month-old F1 ovary in comparison to controls (Fig. 11A, B, and C). However, prenatal exposure to the mixture (200 mg/kg/day) significantly decreased expression of the antioxidant enzyme (Gsr) in the 6-month-old F1 ovary in comparison to controls (Fig. 11D; n = 6, significant difference, p ≤ 0.05).

Fig. 11.

Effects of prenatal exposure to a phthalate mixture on key enzymes involved in antioxidant production in F1 female mice at 6 months. Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, and 200 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then ovaries were collected from select F1 females at 6 months to measure gene expression via qPCR (panels A-D; n = 6, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05).

Prenatal exposure to the phthalate mixture significantly or borderline decreased expression of the apoptotic factors Bad (20 and 200 μg/kg/day, and 200 mg/kg/day), Bok (20 μg/kg/day and 200 mg/kg/day), Casp8 (200 mg/kg/day), Fas (200 mg/kg/day), and Traf3 (20 μg/kg/ day and 200 mg/kg/day) in the 6-month-old F1 ovary in comparison to controls (Fig. 12A, C, F, G and I; n = 6, significant difference, p ≤ 0.05, borderline difference, p is 0.05 < p < 0.10). In contrast, prenatal exposure to the mixture did not significantly alter Bcl2, Casp3, Bcl2l10, and Bax gene expression the 6-month-old F1 ovary in comparison to controls (Fig. 12B, D, E, and H).

Fig. 12.

Effects of prenatal exposure to a phthalate mixture on key genes regulating apoptosis in F1 female mice at 6 months. Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, and 200 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then ovaries were collected from select F1 females at 6 months to measure gene expression via qPCR (panels A-I; n = 6, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05, borderline difference if p is 0.05 < p < 0.10).

Prenatal exposure to the phthalate mixture significantly or borderline decreased the expression of cell cycle regulators Ccne1 (20 μg/kg/day), Cdkn1a (20 μg/kg/day), and Ccnd2 (20 μg/kg/day and 200 mg/ kg/day) in the 6-month-old F1 ovary in comparison to controls (Fig. 13A-C; n = 6, significant difference, p ≤ 0.05, borderline difference, p is 0.05 < p < 0.10). However, prenatal exposure to the phthalate mixture did not significantly alter the expression of the cell cycle regulators Ccna2, Ccnb1, and Cdk4 in the 6-month-old F1 ovary in comparison to controls (Fig. 13D-F).

Fig. 13.

Effects of prenatal exposure to a phthalate mixture on key genes regulating the cell cycle in F1 female mice at 6 months. Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, and 200 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then ovaries were collected from select F1 females at 6 months to measure gene expression via qPCR (panels A-F; n = 6, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05, borderline difference if p is 0.05 < p < 0.10).

11.5. Effects of prenatal exposure to an environmentally relevant phthalate mixture on hormone levels in F1 female mice at 6 months

Prenatal exposure to the phthalate mixture did not significantly alter pregnenolone or estradiol levels in 6-month-old F1 females in comparison to controls (Fig. 14A, and C). In contrast, prenatal exposure to the phthalate mixture (20 μg/kg/day) borderline decreased the levels of testosterone in 6-month-old F1 females in comparison to the controls (Fig. 14B; n = 6, borderline difference, 0.05 < p < 0.10).

Fig. 14.

Effects of prenatal exposure to a phthalate mixture on serum hormone levels in F1 female mice at 6 months. Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, and 200 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then sera were collected from the F1 females at 6 months to measure pregnenolone (Panel A), testosterone (Panel B) and estradiol (Panel C) (panels A-C; n = 6, p values are shown above comparison lines on the graphs; borderline difference if p is 0.05 < p < 0.10).

11.6. Effects of prenatal exposure to an environmentally relevant phthalate mixture on Ki67 in F1 female mice at 3 and 6 months

Prenatal exposure to the phthalate mixture did not significantly alter the number of Ki67-stained cells or the percentage of Ki-67-stained cells in 3-month-old F1 females in comparison to controls (Fig. 15 and Fig. 16A,B). Similarly, prenatal exposure to the phthalate mixture did not significantly alter the number of Ki-67-stained cells or the percentage of Ki-67-stained cells in 6-month-old F1 females in comparison to controls (Fig. 16C and D)

Fig. 15.

Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, and 200 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then ovaries from F1 females at 3 momths were fixed, embedded in paraffin, and sectioned for immunohistochemical evaluation. Representative image of an F1 female ovary vehicle control section with Ki67 staining shows antral follicles evaluated and the different cell types present within a zoomed in image of a single antral follicle.

Fig. 16.

Effects of prenatal exposure to a phthalate mixture on Ki67 staining in F1 female mice at 3 and 6 months. Pregnant CD-1 dams were dosed with vehicle control (corn oil) or phthalate mixture (20 and 200 μg/kg/day, and 200 mg/kg/day) from gestational day 10 until birth. The dams were allowed to give birth naturally and then ovaries from the F1 females at 3 and 6 months were fixed, embedded in paraffin, and sectioned for immunohistochemical evaluation (panels A-D; n = 3).

12. Discussion

This study tested the hypothesis that prenatal exposure to an environmentally relevant phthalate mixture disrupts long-term ovarian function in adult F1 mice. While evaluating the impacts of single phthalate exposure are important, humans are more frequently exposed to phthalate as mixtures [3]. Several phthalates have been classified as known endocrine disrupting chemicals that may negatively impact reproductive health in women and children [40]. This study highlights the importance of evaluating phthalates as mixtures and the potential long-term effects of developmental exposure to phthalates. The results indicate that prenatal exposure to an environmentally relevant phthalate mixture altered ovarian gene expression of steroidogenic enzymes, antioxidant factors, and pro-apoptotic factors compared to control, but that the specific mixture-induced alterations differed between the PND60, 3 month, and 6 month time points (Table 2). For example, at PND60, prenatal exposure to the mixture decreased the expression of Star, Cyp11a1, Bad, and Casp3 in F1 females in comparison to controls. In contrast, at the 3 month timepoint, prenatal exposure to the phthalate mixture decreased ovarian gene expression of Cyp11a1, Hsd3b1, Sod1, Casp3, Casp8, and Fas and increased ovarian gene expression of the steroidogenic enzyme Star and antioxidant enzyme Gpx in F1 females in comparison to the controls (Table 2). Further, at 6 months, prenatal exposure to the phthalate mixture decreased ovarian gene expression of Gsr, Bad, Bok, Casp8, Fas and Traf3 and increased ovarian gene expression of the steroidogenic enzyme Star in F1 females in comparison to the controls (Table 2). The results also indicate that prenatal exposure to the phthalate mixture differentially affects steroid hormone levels in F1 females, with significant effects only at the 6 month timepoint. Specifically, prenatal exposure to the mixture did not significantly affect pregnenolone or progesterone levels in F1 females at any time point, but it borderline decreased testosterone levels in F1 females at 6 months in comparison to the controls (Table 2). These data suggest that prenatal exposure to the phthalate mixture may impact F1 ovarian health uniquely at each timepoint, causing different changes in ovarian gene expression of key factors regulating steroidogenesis, antioxidant defense, and apoptosis as well testosterone levels.

Table 2.

Summary of all factors altered and evaluated in prenatal phthalate mixture exposed PND 60, 3 months and 6 months tissues and sera.¹.

Key	Increased, Decreased
Timepoint	Factors altered
PND 60	Steroidogenic regulators: Star 20 μg, 200 μg, 500 mg; Cyp11a1 500 mg Oxidative stress markers: No change Apoptotic factors: Bad 200 mg; Casp3 200 mg Cell cycle regulators: No change
3 months	Steroidogenic regulators: , Star 200 mg; Cyp11a1 200 μg; Hsd3b1 200 μg Oxidative stress markers: Gpx 20 μg; Sod1 200 μg, 200 mg Apoptotic factors: Casp3 ALL; Casp8 20, 200 μg; Fas 200 μg, 200mg Cell cycle regulators: No change Ki67: No change
6 months	Steroidogenic regulators: Star 20 μg; Testosterone 20 μg Oxidative stress markers: Gsr 200 mg Apoptotic factors: Bad ALL; Bok 20 μg, 200m; Casp8 200 mg; Fas 200 mg; Traf3 20 μg, 200 mg Cell cycle regulators: Ccne1 20 μg; Cdkn1a 20 μg; Ccnd2 20 μg, 200 mg Ki67: No change

¹Blue and or underlined in bold italics represent significantly or borderline increased factors in comparison to controls. Red and or normal arial font represent significantly or borderline decreased factors in comparison to controls. No change represents factors that were not significantly, or borderline altered in comparison to controls.

Although most effects of prenatal exposure to the mixture differed over time, one of the major similarities across the PND 60, 3 month, and 6 month timepoints was a mixture-induced decrease in F1 ovarian expression of pro-apoptotic factors compared to control. Apoptosis in the ovary is a natural process that is critical for the elimination of subordinate follicles, allowing for the selection of dominant follicles and resulting in the most competitive follicle pool [41]. Dominant follicles have a significantly higher chance of being ovulated and fertilized, resulting in pregnancy than subordinate follicles [41]. Significant decreases in pro-apoptotic factors such as Bad, Bok, Casp3, Casp8, Fas and Traf3 can ultimately interrupt normal follicular atresia and thus, inhibit elimination of subordinate follicles [41]. This may allow for an increased number of subordinate follicles within the ovary, resulting in the selection of unhealthy antral follicles for ovulation and decreasing the probability of successful pregnancy [41,42]. This possibility correlates with previous studies indicating that exposure to the same phthalate mixture increased the percentages of primordial follicles and decreased the number and percentages of F1 preantral and antral follicles, suggesting that the mixture inhibits normal progression of primordial follicles to antral follicles [43]. Similarly, in vitro exposure to the same phthalate mixture significantly decreased growth of antral follicles and it decreased antral follicle gene expression of Bax and Casp8, which are both pro-apoptotic factors [44]. These mixture-induced abnormalities in folliculogenesis could partially explain why previous studies show that prenatal exposure to the same phthalate mixture disrupts the ability of F1 females to give birth at later timepoints such as 11 and 13 months of age in comparison to controls [25]. It is important to note that our data show that prenatal exposure to the mixture decreased expression of pro-apoptotic factors in the F1 ovary at PND 60 though 6 months. However, a previous study indicates that prenatal exposure to the phthalate mixture did not decrease F1 follicle numbers or increase the number of F1 atretic follicles at 13 months [26]. Thus, the mixture-induced changes in apoptosis regulators at PND60 through 6 months do not necessarily translate into changes in follicle numbers at 13 months. Interestingly, the same previous study found that prenatal exposure to the mixture led to the presence of ovarian cysts in the F1 generation. Specifically, 77.8 % of F1 ovaries had cysts in the 200 μg/kg/day group and 62.5 % of F1 ovaries had cysts in the 200 mg/kg/day group compared to 33.3 % of F1 ovaries with cysts in controls at 13 months [26]. The presence of cysts may be another indicator of abnormal follicular development. Thus, it is possible that mixture-induced decreased expression of pro-apoptotic factors observed in this study contributes to abnormal follicular development that results in cysts.

Our study also found that prenatal exposure to the mixture decreased the expression of cell cycle regulators that induce cell cycle progression (Ccnd2 and Ccne1) as well as inhibit cell cycle progression (Cdkn1a) in the F1 ovary at the 6 month timepoint (Table 2). These data indicate that the mixture-induced changes in cell cycle inducers (Ccnd2 and Ccne1) were not sufficient to offset the mixture-induced changes in the cell cycle inhibitor, Cdkn1a. These data are consistent with our data showing that prenatal exposure to the mixture does not alter the proliferative marker Ki67. Our data are also consistent with previous studies showing the exposure to the same phthalate mixture causes similar changes in expression of cell cycle inhibitors and inducers promoters in F1 ovaries at 13 months [25].

Additionally, our data suggest that prenatal exposure to the phthalate mixture causes differences in F1 ovarian expression of steroidogenic regulators at the PND 60, 3 month, and 6 month timepoints (Table 2). One of the similarities across all timepoints is that prenatal exposure to the mixture alters ovarian gene expression of steroidogenic enzyme Star. Prenatal exposure to the mixture decreased Star expression at PND 60 and increased Star expression at 3 months and 6 months. Star is important for regulating the transfer of cholesterol within the mitochondria and it is known as the rate limiting step in the production of sex steroid hormones. The mixture-induced decrease in Star at PND 60 is consistent with previous studies showing that the mixture decreased circulating levels of sex steroids, including estradiol and testosterone in F1 females at PND60 [43]. It is also consistent with our data showing that the mixture causes a borderline decrease in testosterone levels at 6 months.

It is possible that the ovary was able to compensate for the initial mixture-induced decrease in Star at PND60 by the 3 month time point, resulting in the observed normal circulating levels of testosterone by 3 months. However, this is not the case at the 6 month time point. By 6 months, the levels of Star were higher in the F1 ovaries prenatally exposed to the mixture compared to controls, but the levels of testosterone were lower in F1 females compared to controls. It is possible that the mixture affected protein levels of Star or other steroidogenic regulators at the 6 month time point and that this led to the mixture-induced decrease in testosterone levels. Testosterone is produced in thecal cells and needed for the conversion of androgens to estradiol, which is the major sex steroid hormone in females [45]. During folliculogenesis, testosterone can stimulate the growth and development of ovarian follicles [45]. Our data are consistent with previous studies that show that prenatal exposure to phthalates decreased testosterone in F1 females at 13 months [26]. This indicates that the phthalate mixture’s impact on testosterone levels may affect the folliculogenesis process, allowing for increased number of subordinate follicles within the ovary and consistent with the changes in the expression of the selected of apoptotic factors in this study. Ultimately, a decrease in testosterone levels can further negatively impact follicle growth causing an accumulation of immature follicles and/or leading to reduced oocyte quality and follicle percentages.

Lastly, our data indicate minimal changes in the expression of the selected antioxidant enzymes evaluated. Our data also suggest that prenatal exposure to the mixture may impact antioxidant enzymes differently at each time point. The phthalate mixture did not affect expression of the selected antioxidant enzymes at PND 60, but it increased ovarian expression of Gpx and decreased expression of Sod1 in comparison to controls at 3 months. Furthermore, the mixture decreased the expression of Gsr in comparison to controls at 6 months. Although we observed minimal changes in ovarian expression of key antioxidant enzymes, phthalates have been shown to cause oxidative stress in ovarian tissues. An in vitro study evaluating the effects of single phthalate exposure (DEHP) on mouse antral follicles found that DEHP can inhibit follicle growth and increase reactive oxygen species levels by reducing antioxidant expression and activity [13]. Another study examined mono-(2-ethylhexyl) phthalate (MEHP), an active metabolite of DEHP, and found that in vitro exposure to MEHP also induces oxidative stress by altering antioxidant enzyme expression and activity in mouse antral follicles [46]. The mixture of phthalates evaluated in our study contained DEHP. However, the results of our study likely vary from previous in vitro studies due to differences in concentration of DEHP, the route of exposure, and the tissue type evaluated (whole ovaries from in vivo studies versus isolate antral follicles from in vitro studies). It is important to note that phthalate exposure could potentially impact antioxidant enzyme activity and protein levels, promoting oxidative stress in ovarian tissues, but we did not evaluate enzyme activity or protein levels in the current study.

In conclusion, this study found that prenatal exposure to an environmentally relevant phthalate mixture alters long-term ovarian health and function in F1 females, but that the specific mixture-induced alterations differ between the PND60, 3 month, and 6 month time points. Overall, the mixture altered ovarian gene expression of steroidogenic regulators and pro-apoptotic factors across all timepoints, and it borderline decreased the levels of testosterone in F1 females at 6 months. However, prenatal exposure to an environmentally relevant phthalate mixture caused minimal changes in ovarian gene expression of antioxidant enzymes and cell cycle regulators, and did not significantly alter Ki67 proliferation in F1 ovarian tissue. Furthermore, because this study did not examine protein levels or enzyme activity of key factors in oxidative stress, apoptosis, cell cycle regulation, and steroidogenesis, future studies should evaluate these factors and examine other potential mechanisms of phthalate induced toxicity from prenatal exposure to the phthalate mixture on F1 females.