Skip to main content
Regenerative Therapy logoLink to Regenerative Therapy
. 2026 Mar 2;31:101085. doi: 10.1016/j.reth.2026.101085

Sustained release of quercetin through homogeneous poly (lactic-co-glycolic acid) microspheres to enhance MSCs biofunctions for regenerative therapy

Xianghui Mei a, Dongchao Li a, Li Sun a,b, Zhen Wang b, Houjian Ren a, Hui Zhang e, Min Ge a,b,e,, Defeng Wang c,⁎⁎, Qizhi Shuai d,⁎⁎⁎
PMCID: PMC12969462  PMID: 41809617

Abstract

Introduction

Mesenchymal stem cells (MSCs) hold significant potential for tissue repair and cell therapy. A primary obstacle in their application is the loss of stemness and onset of senescence during in vitro expansion, which compromises therapeutic efficacy. Plant-derived bioactive compounds like quercetin (Que) offer promise for enhancing MSC-based therapies; however, its poor aqueous solubility due to high lipophilicity and phenolic hydroxyl groups limits pharmaceutical utility.

Methods

To address this, we engineered homogeneous poly(lactic-co-glycolic acid) (PLGA) microspheres (hPLGA-Ms) using microfluidic technology to encapsulate hydrophobic Que, enabling its sustained release in physiological aqueous environments.

Results

The results showed the hPLGA-Ms loaded Que (Que/hPLGA-Ms) were uniform, well dispersed. The size of the hPLGA-Ms can be precisely controlled by adjusting the flow rates of two phases. Gene expression analysis demonstrated the hPLGA-Ms delivery of Que enhanced MSCs cellular viability, stemness, anti-senescence, secretion and migration abilities of cells.

Conclusions

In summary, the scalable and reproducible Que/hPLGA-Ms provide controlled release kinetics and significantly potentiate MSCs bioactivities. This delivery system represents a promising strategy for tissue engineering and regenerative therapies.

Keywords: Microfluidics, Poly (lactic-co-glycolic acid), Quercetin, Mesenchymal stem cells

1. Introduction

Cell-based therapy shows great potential for tissue regeneration and disease treatment. This approach primarily involves implanting therapeutic cells into the affected area to replace damaged cells, thereby promoting the restoration of the tissue or organ to its original function [1,2]. Mesenchymal stem cells (MSCs) are primary candidates in cell treatment and tissue repair because of their extensive source and great potential to treat various diseases [[3], [4], [5], [6], [7], [8], [9]]. To obtain a sufficient number of cells for therapeutic application, MSCs must be expanded in long-term culture [10]. It was reported that MSCs have been successfully applied in various medical applications, including acute myocardial infarction, bone defects, and skin wounds [[11], [12], [13], [14]]. However, the application of MSCs in tissue engineering is hindered by the loss of stemness characteristics and the development of senescence during serial passaging, ultimately reducing their therapeutic efficacy [10]. Evidence indicates that stimulation with bioactive components during in vitro culture enhances the biofunctions of MSCs [[15], [16], [17], [18], [19], [20]]. Currently, the main bioactive factors used in MSCs culture include bFGF, PDGF, EGF and IL-6, among others [[21], [22], [23], [24]]. These molecules play key roles in enhancing MSCs proliferation and migration, modulating immune properties, and directing differentiation. Despite their significant benefits in regulating MSCs biological functions, their use is limited by challenges such as high cost, susceptibility to inactivation, batch-to-batch variability, and potential safety concerns [[25], [26], [27]].

Quercetin (Que) is a natural flavonoid small molecule compound found in many fruits, vegetables, Chinese herbs, and coffee, it has various effects such as free radical scavenging, antioxidation, and anti-aging [28,29]. It can inhibit oxidative stress and aging in the pancreas [30]. Recent work by Qian Zhao group indicated that stimulation with Que can significantly improve the hair follicle microenvironment, activate hair follicle stem cells to delay aging, and effectively promote hair regeneration [31]. Moreover, Yi Zhu et al. showed that Que can significantly inhibit the aging-related phenotypes of MSCs and oxidative stress-induced apoptosis, maximizing the tissue repair capability of MSCs [32]. However, the deliverability of Que by oral route is limited due to its poor aqueous solubility and extensive first pass metabolism [33]. Due to this limitation, Que exhibits low oral bioavailability—approximately 17% in rats and about 2% in humans—which results in subtherapeutic levels and necessitates the administration of higher doses [34]. Therefore, to achieve significant therapeutic effects, it is essential to develop a nanoformulation that incorporates Que within a single carrier system [35,36]. Employing biodegradable microspheres for sustained Que release presents a promising strategy to enhance its solubility, thereby improving dispersion and absorption in aqueous environments and ultimately increasing bioavailability.

Poly (lactic-co-glycolic acid) (PLGA) microspheres is a typical biodegradable biomimetic material, has been used in hydrophobic drugs delivery and tissue engineering since certified by the American Food and Drug Administration (FDA) for biosafety [[37], [38], [39], [40]]. The traditional methods for PLGA microspheres encounter issues such as the challenge of achieving consistent uniformity of microspheres and significant variations between batches [41]. Differential release kinetics arising from varied surface area-to-volume ratios, where smaller particles accelerate burst release while larger ones exhibit diffusion-limited incomplete release. Moreover, irregular cellular uptake due to size-dependent endocytosis pathways, reducing target cell internalization efficiency. Notably, microfluidic droplet technology not only can efficiently prepare highly homogeneous microspheres without requiring secondary purification, but can prepare different structure microspheres by adjusting the devices [29,42,43].

In this work, the microfluidic droplet technology was used to fabricate hPLGA-Ms and load Que for sustained released. First, the flow rate of the continuous and dispersed phases was regulated to fabricate the hPLGA-Ms. Second, the basic physical and chemical properties, degradation properties, releasing ability were investigated. Furthermore, the homogenized PLGA microspheres loaded with Que (Que/hPLGA-Ms) were used for in vitro MSCs culture. The cells survival, stemness, anti-senescence, migration and secretion were validated to determine the effects of the Que/hPLGA-Ms on the biological functions of MSCs. All of this indicated that the Que/hPLGA-Ms system incorporated into MSCs culture system provide a new approach to regenerative medicine and other clinical applications.

2. Materials and methods

2.1. Preparation and characterization of Que/hPLGA-Ms

The hPLGA-Ms were fabricated according to our previously established protocol [44]. In brief, 40 mg of PLGA (molecular weight = 17,000, lactide:glycolide = 50:50, Daigang Biomaterial, Jinan, China) was dissolved in 1 mL of Ethyl acetate (EA, OBOKAI, Tianjing, China) to form the dispersed phase. A 2% (w/v) polyvinyl alcohol (PVA; Aladdin, Shanghai, China) solution served as the continuous phase. Both phases were infused into a microfluidic device using syringe pumps (Langer Pump, Baoding, China). Prior to injection, the microchannels were pretreated with 1 M HCl and 1 M NaOH for 30 min to achieve hydrophilization. The generated hPLGA droplets were collected in 2 wt% PVA solution and stirred at 300 rpm for 4 h to allow complete evaporation of EA. The hPLGA-Ms were centrifuged at 1000 rpm for 1 min and lyophilized using a freeze dryer (Biocoll, Beijing, China). The preparation of Que/hPLGA-Ms followed a similar procedure, with the modification that varying concentrations of Que (Aladdin, Shanghai, China) were incorporated into the PLGA/EA dispersed phase for subsequent analysis of drug loading and encapsulation efficiency (Fig. 1 A).

Fig. 1.

Fig. 1

(A) Schematic illustration of the preparation of Que/hPLGA-Ms and evaluation of their effects on hMSCs. (B) Optimization of microsphere size by adjusting the flow rate of the continuous phase. (C) Optimization of microsphere size by adjusting the flow rate of the dispersed phase. (D) Particle size distribution of hPLGA-Ms.

The morphology of Que/hPLGA-Ms was characterized using a JMS-7500F scanning electron microscope (SEM, JEOL, Japan). The particle size distribution was determined by measuring the diameters of over 100 randomly selected microspheres in microscopic images using Nano Measurer software (version 1.2). The chemical composition of Que/hPLGA-Ms was analyzed by Fourier transform infrared spectroscopy(FTIR) (TENSOR2, Bruker, Germany), and the thermal stability was evaluated using a thermogravimetric analyzer (TGA8000, PerkinElmer, USA).

2.2. The load and release of Que

The release kinetics of Que were evaluated by suspending 20 mg of microspheres in 1.5 mL of PBS (containing 0.02% (w/v) Tween 20 and 10 mg/mL BSA). The system was incubated at 37 °C under constant agitation for 14 days. At 48-h intervals, 150 μL of supernatant was collected and replaced with an equal volume of fresh PBS. The cumulative release of Que was quantified by measuring the absorbance of the supernatant at 375 nm using a multi-mode microplate reader [45].

2.3. Hemocompatibility evaluation of Que/hPLGA-Ms

After immersing the microsphere degradation solution in PBS for 14 days, the supernatant was collected by centrifugation. 200 μL of red blood cells from ICR mice were washed three times and then mixed with 800 μL of the supernatant for analysis. In parallel, 800 μL of ultrapure water and 800 μL of PBS were used as the positive and negative controls for the hemolysis assay, respectively. After incubation at 37 °C for 4 h, the mixtures were centrifuged at 10,000 rpm for 5 min. Then, 100 μL of supernatant from each group was transferred to a 96-well plate, and the absorbance was measured at 577 nm using a multi-mode microplate reader.

2.4. Cell culture

The culture of MSCs followed our established protocol [44]. Briefly, MSCs used in this study were isolated from human umbilical cord tissue (hMSCs, HUXUC-01001, Cyagen Biosciences, Guangzhou, China) Cell surface markers were characterized by flow cytometry, confirming positive expression (>70%) of CD29, CD44, and CD105, and negative expression (<5%) of CD14 and CD45. hMSCs were seeded at a density of 1 × 106 cells per dish in 100 mm tissue culture dishes (Corning, New York, USA) and cultured in DMEM/F12 medium (HyClone, Logan, Utah, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, California, USA) at 37 °C in a humidified atmosphere with 5% CO2. The medium was changed every 3 days. When cells reached 80%–90% confluence, they were passaged using 0.25% trypsin-EDTA solution (Sigma-Aldrich, St. Louis, USA), and cells at passage 5 were used for all subsequent experiments.

2.5. Transwell and direct culture method

The transwell culture assay was performed according to the previously established protocol [46]. Que/hPLGA-Ms were added to the polycarbonate transwell inserts (8 μm pore size) of 6-well plates (NEST, 723321, Wuxi, China), while hMSCs were cultured in the lower chamber of the plates. For the direct treatment, fresh free Que (Que/Free, dissolved in base medium containing 0.1% Dimethyl sulfoxide (DMSO, AmBeed, A1458605, Shanghai, China) was directly added to the culture medium.

2.6. Evaluation of the effects of Que/hPLGA-Ms on oxidative stress-exposed hMSCs

This study evaluated the effects of Que/hPLGA-Ms on hMSCs under two conditions: standard culture conditions (non-TBHP pre-treatment) and tert-butyl hydroperoxide (TBHP, Macklin, B802372, Shanghai, China) pre-treatment (After a 6-h starvation of the adherent cells, they were treated with a specific concentration of TBHP for 1 h). Under standard conditions, CCK-8 assays, PCR, scratch assays, and transwell assays were used to evaluate the effects of different interventions on hMSCs viability, paracrine function, and migratory capacity. Under TBHP pre-treatment conditions, in addition to evaluating changes in cell viability and paracrine function, the cell's response to oxidative stress was assessed through ROS scavenging, anti-aging effects, and the maintenance of stem cell activity.

2.7. CCK-8 assay

Cell viability was quantified using a CCK-8 assay kit (AmBeed, A1867351, Shanghai, China). Following the completion of the intervention, 100 μL of complete culture medium containing 10% (v/v) CCK-8 solution was added to each well, and the cells were further incubated for 1 h. The absorbance at 450 nm was then measured to evaluate cell viability.

2.8. qRT-PCR

Total RNA was isolated from the cells using TRIzol reagent. cDNA synthesis was performed using random primers and Moloney Murine Leukemia Virus reverse transcriptase. PCR amplification of cDNA samples was performed using rTaq polymerase on the QuantStudio system (Thermo Fisher Scientific, Massachusetts, USA). The PCR products were separated by electrophoresis on a 1% agarose gel and visualized with ethidium bromide staining (10 mg/mL). Gene expression levels were normalized to β-actin as an internal control. The specific primer pairs used for amplification are listed in Table 1.

Table 1.

Primer sequences for PCR.

Genes Forward primer (5′-3′) Reverse primer (5′-3′) Tm (°C)
BAX TCAGGATGCGTCCACCAAGAAG TGTGTCCACGGCGGCAATCATC 60
BCL-2 ATCGCCCTGTGGATGACTGAGT GCCAGGAGAAATCAAACAGAGGC 60
NANOG CTCCAACATCCTGAACCTCAGC CGTCACACCATTGCTATTCTTCG 58
SOX-2 GCTACAGCATGATGCAGGACCA TCTGCGAGCTGGTCATGGAGTT 60
CAT GTGCGGAGATTCAACACTGCCA CGGCAATGTTCTCACACAGACG 60
SOD2 CTGGACAAACCTCAGCCCTAAC TGAGCCTTGGACACCAAC 59
TP53 CCTCAGCATCTTATCCGAGTGG TGGATGGTGGTACAGTCAGAGC 58
CDKN1A AGGTGGACCTGGAGACTCTCAG TCCTCTTGGAGAAGATCAGCCG 59
CDKN2A CTCGTGCTGATGCTACTGAGGA GGTCGGCGCAGTTGGGCTCC 60
IGF-1 CTCTTCAGTTCGTGTGTGGAGAC CAGCCTCCTTAGATCACAGCTC 57
EGF TGCGATGCCAAGCAGTCTGTGA GCATAGCCCAATCTGAGAACCAC 60
HGF GAGAGTTGGGTTCTTACTGCACG CTCATCTCCTCTTCCGTGGACA 58
VEGF CCTTGCTGCTCTACCTCCACCAT CGTGATGATTCTGCCCTCCTCCT 61

2.9. Cell migration

The scratch assay and transwell assay were used to assess the horizontal migration and chemotactic migration abilities of hMSCs, respectively. When the confluence of hMSCs exceeded 90%, a uniform scratch was created in the center of the culture plate using a sterile 200 μL pipette tip. Detached cell debris was removed by gently washing twice with PBS, followed by treatment according to the predetermined intervention protocols. A 8 μm polycarbonate membrane 24-well transwell plate (NEST, 725321, Wuxi, China) was used for the experiment. The upper chamber, containing 100 μL of a 1 × 105 cells/mL cell suspension, and the lower chamber, containing 600 μL of complete culture medium with or without specific interventions, were cultured for 48 h. Subsequently, non-migrated cells on the inner side of the polycarbonate membrane were gently removed with a cotton swab. The migrated cells on the outer side were fixed with 4% paraformaldehyde for 15 min and then stained with 0.1% crystal violet for 20 min. All Images were captured at 0 h and 48 h post-scratch using an inverted microscope (Leica, Wetzlar, Germany) at randomly selected fields and quantitatively analyzed using ImageJ software.

2.10. ROS staining

Reactive oxygen species (ROS) staining was performed using the ROS detection kit (Beyotime Biotechnology, S0033S, Shanghai, China) according to the manufacturer's instructions, and imaging was conducted under a fluorescence microscope.

2.11. Flow cytometry

We conducted quantitative analysis of cellular ROS levels using flow cytometry according to the manufacturer's instructions for the ROS detection kit. The data were visualized using FlowJo software (version 10.8.1).

2.12. β-Galactosidase staining

β-galactosidase staining kit (Beyotime Biotechnology, C0602, Shanghai, China) was used according to the manufacturer's instructions. Senescent cells were identified by the presence of distinct blue precipitates in the cytoplasm.

2.13. Statistical analysis

All statistical analyses were performed using GraphPad Prism software (version 5.0). One-way analysis of variance (ANOVA) was employed for data analysis. The threshold for statistical significance was set at ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001.

3. Results and discussion

3.1. Preparation and characterization of the hPLGA-Ms

Currently, various methods, such as spray drying, phase separation, and double emulsion solvent extraction/evaporation, are employed to prepare biodegradable sustained-release microspheres [40]. Microfluidic droplet technology offers an economical, efficient, and easily controllable platform, enabling the high-throughput production of highly uniform microspheres [40,47].

The particle size plays a crucial role in both the biochemical effects and biofunctional performance of drug-loaded microspheres. To maximize the therapeutic potential of hMSCs, it is essential to precisely control and optimize the flow rates, thereby avoiding excessively large or small particle sizes due to inappropriate flow conditions that could alter drug release profiles [48]. By adjusting the flow rates of both phases, we achieved precise control over the average particle size of hPLGA-Ms (Fig. 1A). As shown in Fig. 1B and C, when the dispersed phase was fixed at 0.4 mL/h and the continuous phase at 1.2 mL/h, a finely tunable size range was achieved by varying the continuous phase flow rate between 0.6 and 1.8 mL/h, and the dispersed phase between 0.3 and 0.8 mL/h. Beyond these thresholds, either flow interruption or laminar flow occurred, preventing droplet formation. Microspheres with an average diameter of approximately 22.03 ± 0.29 μm were selected for Que loading and subsequent experiments (Fig. 1D). Ultimately, it was determined that setting the dispersed phase and continuous phase flow rates to 0.4 ml/h and 1.2 ml/h, respectively, yielded optimal biochemical effects and biofunctional outcomes, Under these conditions, the obtained microparticles exhibited an average diameter of 22.03 ± 0.29 μm (Fig. 1D, Supplementary Figs. 1 and 2).

3.2. The load and release properties of Que by hPLGA-Ms

The uniformity of the particle size of biodegradable drug-loaded microspheres is crucial for drug encapsulation and release behavior [49]. By effectively controlling volume heterogeneity and batch-to-batch variation, the degradation rate of microspheres and the stability of the encapsulated drug can be improved [50]. Optical microscopy revealed monodisperse droplets with high size uniformity (Fig. 2A), and SEM confirmed the smooth surface morphology of the microspheres (Fig. 2B). To determine the optimal drug loading concentration, an initial gradient of 0.1 to 0.8 mg/mL Que was tested. The absorbance were measured at a wavelength of 375 nm using a microplate reader. As illustrated in Fig. 2E, the drug loading content increased steadily with higher feeding concentrations, while the encapsulation efficiency gradually decreased until a distinct inflection point appeared at 0.5 mg/mL. This suggests that the loading capacity of the polymer approached saturation at this concentration. When the Que concentration was increased to 0.8 mg/mL, visible drug precipitation was observed in the receiving solution.

Fig. 2.

Fig. 2

(A) Que/hPLGA microdroplets under optical microscopy. (B) Que/hPLGA-Ms under SEM. (C) FTIR analysis of Que/hPLGA-Ms. (D) Thermogravimetric analysis of Que/hPLGA-Ms. (E) Que loading characteristics of Que/hPLGA-Ms. (F) Que release characteristics of Que/hPLGA-Ms. Scale bar = 20 μm.

FTIR spectroscopy (Fig. 2C) revealed that in the hydroxyl region (∼3300 cm−1), pure PLGA showed no significant absorption, whereas Que exhibited a broad and intense peak due to its phenolic hydroxyl groups. A characteristic peak of PLGA appeared in the carbonyl region (∼1750 cm−1). The spectrum of Que/hPLGA-Ms displayed distinct characteristic peaks of both Que and PLGA, confirming the successful conjugation of Que and PLGA. Thermal stability (Fig. 2D) provided further insights: PLGA (blue curve) displayed a single sharp decomposition step, with onset around 250 °C. Rapid and thorough chain scission and depolymerization occurred between 250 °C and 350 °C, resulting in volatile products and a sharp weight loss. Que (green curve) demonstrated higher thermal stability, with major weight loss between 300 °C and 450 °C. A high residual char yield (∼42%) indicated carbonization into thermally stable aromatic structures. Que/hPLGA-Ms (black curve) exhibited a TGA profile distinct from both components, with the onset of decomposition shifted to higher temperatures, indicating enhanced thermal stability of the composite. The weight loss occurred over a broader temperature range, suggesting a more complex degradation process rather than rapid depolymerization. Molecular-level interactions between Que and PLGA likely restricted chain mobility, delaying decomposition and altering its mechanism. The final char yield (∼3%) was higher than that of PLGA (∼0%) but lower than Que (∼42%), consistent with the composition mostly of PLGA with a small amount of Que contributing to char formation.

Compared to traditional drug delivery methods, microspheres prepared using microfluidic technology exhibit excellent drug encapsulation and release properties. This ideal sustained-release system can significantly enhance drug utilization and reduce side effects to achieve optimal biological effects, particularly for drugs like Que, which have poor water solubility and low permeability [33,41]. In the present study, Fig. 2F illustrates the cumulative release profile of Que from Que/hPLGA-Ms. The results indicate that Que was released in a slow and continuous manner over a 14-day period, ultimately reaching a cumulative release of 77.2 ± 0.43%, the uniform microspheres provided a sufficient and sustained supply of Que through gradual degradation, thereby eliminating the need for frequent replenishment [51].

3.3. Cytompatibility evaluation of the Que/hPLGA-Ms

Good cytompatibility is a fundamental prerequisite for the application of drug-loaded microspheres in direct contact with human systems [52]. As shown in Fig. 3A, the supernatants of both hPLGA-Ms and Que/hPLGA-Ms remained clear and transparent, with hemolysis rates well below 5%. Additionally, the CCK-8 results (Fig. 3B) indicate that, after 7 days of treatment, the sustained-release Que/hPLGA-Ms significantly promoted cell proliferation compared to the Control and Que/Free. PCR analysis (Fig. 3C) revealed a significant downregulation of BAX expression relative to both the Control group and the Que/Free group and BCL-2 expression was significantly upregulated in the Que/hPLGA-Ms group compared with Control and Que/Free. These findings indicate that the microsphere materials possess excellent cytompatibility, thereby providing a solid foundation for their safe and long-term application.

Fig. 3.

Fig. 3

(A) Hemolysis assay of the degradation products. (B) CCK-8 assay on day 7 of two culture methods on hMSCs sviability. (C) Expression of BAX and BCL-2 in hMSCs cultured under two distinct conditions by PCR on day 7. (D) Expression of EGF, HGF, IGF-1 and VEGF in hMSCs cultured under two distinct conditions by PCR on day 7. All data were normalized to β-actin as the internal reference, and the results are presented as the mean ± SD, n = 3. ∗∗∗significant difference, P < 0.001; ∗∗significant difference, P < 0.01; ∗significant difference, P < 0.05.

3.4. Effect of the Que/hPLGA-Ms on hMSCs

The maintenance of paracrine activity are considered critical indicators of hMSCs functionality [53]. To further evaluate hMSCs bioactivity, we measured the mRNA levels of HGF, EGF, IGF-1, and VEGF, which are key regulators of angiogenesis, cell migration, apoptosis, proliferation, and differentiation [54]. As shown in Fig. 3D, hMSCs treated with Que/hPLGA-Ms exhibited significantly higher secretion capacity for these paracrine factors compared with other groups.

For effective tissue repair and wound healing, hMSCs must first migrate to the injured sites [55]. Scratch wound assay (Fig. 4A) demonstrated that Que/hPLGA-Ms treatment significantly accelerated hMSCs migration compared with the control group and the Que/Free group (Fig. 4C), thereby reducing the time required for scratch closure. Consistently, transwell assays (Fig. 4B) further confirmed that Que/hPLGA-Ms markedly enhanced the chemotactic migration capacity of hMSCs relative to both the control group and the Que/Free group (Fig. 4D).

Fig. 4.

Fig. 4

Optical microscopy images of the scratch assay for hMSCs cultured under two different conditions. (A) Scratch wound healing assay of hMSCs under two different conditions. (B) Crystal violet staining images from the Transwell assay of hMSCs cultured under two different conditions. Scale bar = 100 μm. (C) Quantitative analysis of the scratch assay. (D) Quantitative analysis of the Transwell assay. Data are presented as mean ± SD, n = 3. ∗∗∗P < 0.001, ∗∗∗significant difference, P < 0.001; ∗∗significant difference, P < 0.01; ∗significant difference, P < 0.05. Scale bar = 100 μm.

3.5. Effects of Que/hPLGA-Ms on hMSCs under oxidative stress conditions

In clinical applications, hMSCs encounter various microenvironmental challenges, such as ischemia, oxidative stress, and inflammatory responses, all of which limit their therapeutic efficacy [56]. Therefore, evaluating hMSCs functional activity, anti-senescence capacity, and resistance to ROS under oxidative stress conditions is crucial for developing novel culture strategies and future clinical applications. As shown in Fig. 5A, CCK-8 assays revealed a significant dose-dependent decline in cell viability: compared with untreated controls (0 μM), viability decreased by 31.00% after 1 h treatment with 100 μM TBHP, by 41.00% at 300 μM, and by 44.58% at 500 μM. A concentration of 100 μM TBHP was selected for subsequent experiments to retain sufficient cell viability.

Fig. 5.

Fig. 5

hMSCs pretreated with TBHP for 1 h. (A) CCK-8 assay of the effect of different concentrations of TBHP on cell viability. (B) CCK-8 assay on day 7 of two culture methods on cell viability (100 μmol TBHP). (C) Expression of BAX and BCL-2 in hMSCs cultured under two distinct conditions by PCR on day 7. (D) ROS staining images of hMSCs cultured under two different conditions. (E) ROS flow cytometry analysis and statistical analysis of hMSCs cultured under two different conditions. (F) Expression of CAT and SOD2 in hMSCs cultured under two distinct conditions by PCR on day 7. All PCR data were normalized to β-actin as the internal reference, and the results are presented as the mean ± SD, n = 3. ∗∗∗significant difference, P < 0.001; ∗∗significant difference, P < 0.01; ∗significant difference, P < 0.05. Scale bar = 100 μm.

After 7 days of intervention, Que/hPLGA-Ms treatment markedly improved hMSCs viability under oxidative stress compared with both the TBHP group and the Que/Free group (Fig. 5B). At the molecular level (Fig. 5C), PCR analysis demonstrated significant downregulation of the pro-apoptotic gene BAX and upregulation of the anti-apoptotic gene BCL-2. Notably, the Que/Free group failed to significantly improve cell viability, and even showed a slight increase in BAX expression. This phenomenon may be attributed to the reduced tolerance of cells to Que under injury conditions [57]. This adverse effect was effectively circumvented by the sustained-release formulation.

ROS detection further confirmed the protective effects of Que/hPLGA-Ms. Fluorescence microscopy revealed a marked reduction in green fluorescent ROS-positive cells (Fig. 5D), while flow cytometry analysis (Fig. 5E) showed significantly lower ROS levels compared with the TBHP group and Que/Free group. Moreover, mRNA expression of antioxidant enzymes SOD2 and CAT was significantly upregulated in the Que/hPLGA-Ms group (Fig. 5F).

Elevated ROS levels can lead to replicative senescence, which is a significant challenge for the expansion of hMSCs, greatly limiting the biomedical applications of MSCs [58]. To assess anti-senescence effects, SA-β-Gal staining was performed. hMSCs in the TBHP group exhibited typical senescent phenotypes, including enlarged, flattened, and irregular morphology with abundant blue-stained granules. These features were alleviated following treatment, with the most pronounced improvements observed in the Que/hPLGA-Ms group (Fig. 6A). Quantitative analysis (Fig. 6B) revealed significantly reduced percentages of SA-β-Gal-positive cells. Consistently, PCR results demonstrated that the expression of key cell cycle arrest regulators (CDKN2A/p16, CDKN1A/p21, and TP53/p53) was significantly downregulated in the Que/hPLGA-Ms group (Fig. 6B), indicating effective prevention of hMSCs senescence at the transcriptional level. Finally, analysis of stemness markers and paracrine factors under oxidative stress demonstrated that Que/hPLGA-Ms significantly restored the expression of NANOG, SOX-2, HGF, EGF, IGF-1, and VEGF, thereby preserving the paracrine function of hMSCs and maintaining their stemness (Fig. 6D and E).

Fig. 6.

Fig. 6

hMSCs pretreated with TBHP for 1 h and then intervened for 7 days. (A) SA-β-Gal staining images of hMSCs cultured under two different conditions. (B) Quantitative analysis of SA-β-Gal staining. (C) Expression of CDKN2A/p16, CDKN2A/p21, and TP53/p53 in hMSCs cultured under two distinct conditions by PCR. (D) PCR gel electrophoresis and quantitative analysis of NANOG and SOX-2 in hMSCs cultured under two distinct conditions. (E) Expression of EGF, HGF, IGF-1 and VEGF in hMSCs cultured under two distinct conditions by PCR. All PCR data were normalized to β-actin as the internal reference, and the results are presented as the mean ± SD, n = 3. ∗∗∗significant difference, P < 0.001; ∗∗significant difference, P < 0.01; ∗significant difference, P < 0.05. Scale bar = 100 μm.

4. Conclusion

In conclusion, the Que/hPLGA-Ms created using droplet microfluidic technology are highly uniform and monodisperse, with customizable properties through precise control of particle size. They effectively improve the survival of hMSCs in vitro by promoting proliferation and stemness, while enhancing the paracrine activity and migration of hMSCs. Additionally, Que/hPLGA-Ms effectively address the significant challenges of oxidative stress in hMSCs culture by offering superior ROS scavenging and anti-aging capabilities. These microspheres continuously release Que, making them suitable for in vitro culture systems or implantation with hMSCs to promote tissue repair or regeneration.

CRediT authorship contribution statement

Xinaghui Mei: Writing original draft and editing, Investigation.

Dongchao Li: Investigation, Visualization.

Li Sun: Data curation, Investigation, Validation.

Zhen Wang: Formal analysis, Investigation, Visualization.

Houjian Ren: Formal analysis, Writing review & editing.

Hui Zhang: Validation, Formal analysis.

Min Ge: Data curation, Investigation, Validation, Writing review & and editing.

Defeng Wang: Formal analysis, Investigation, Visualization.

Qizhi Shuai: Supervision, Formal analysis, Writing review and editing.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgement

The authors gratefully acknowledge financial support from the Clinical Medicine Excellent Talents of Hebei Provincial Department (No. [2020] No.23), Natural Science Foundation Youth Fund of Hebei Province (Grant No. C2022402032), Medical Science Research Project of Hebei (20260710), Handan Science and Technology Research and Development Plan (23422304037), National Nature Science Foundation of China (82203221), Natural Science Foundation of Shanxi Province (202103021223227), the Sanjin Talent Innovation Team Project of Shanxi Province (SJYC2024495), Handan Clinical Key Specialty (Medical Imaging Department).

Footnotes

Peer review under responsibility of the Japanese Society for Regenerative Medicine.

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.reth.2026.101085.

Contributor Information

Min Ge, Email: gemin@hebeu.edu.cn.

Defeng Wang, Email: wdf991217@126.com.

Qizhi Shuai, Email: shuaiqizhi@sxmu.edu.cn.

Glossary

MSCs

Mesenchymal stem cells

Que

Quercetin

PLGA

Poly (lactic-co-glycolic acid)

hPLGA-Ms

Homogenized PLGA microspheres

Que/hPLGA-Ms

Homogenized PLGA microspheres loaded with Que

hMSCs

Human umbilical cord tissue

FBS

Fetal bovine serum

DMSO

Dimethyl sulfoxide

TBHP

Tert-butyl hydroperoxide

ROS

Reactive oxygen species

BAX

BCL2 associated X, apoptosis regulator

BCL-2

BCL2 apoptosis regulator

NANOG

Nanog homeobox

SOX-2

SRY-Box Transcription Factor 2

CAT

Catalase

SOD2

Superoxide Dismutase 2

TP53

Tumor Protein P53

CDKN1A

Cyclin Dependent Kinase Inhibitor 1A

CDKN2A

Cyclin Dependent Kinase Inhibitor 2A

IGF-1

Insulin Like Growth Factor 1

EGF

Epidermal Growth Factor

HGF

Hepatocyte Growth Factor

VEGF

Vascular Endothelial Growth Factor

Appendix A. Supplementary data

The following is the Supplementary data to this article.

Multimedia component 1
mmc1.docx (3MB, docx)

Data availability

Data will be made available on request.

References

  • 1.De Pieri A., Rochev Y., Zeugolis D.I. Scaffold-free cell-based tissue engineering therapies: advances, shortfalls and forecast. NPJ Regen Med. 2021;6:18. doi: 10.1038/s41536-021-00133-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Kwon S.G., Kwon Y.W., Lee T.W., et al. Recent advances in stem cell therapeutics and tissue engineering strategies. Biomater Res. 2018;22:36. doi: 10.1186/s40824-018-0148-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.R. Mei, Z. Wan, C. Yang, et al. Advances and clinical challenges of mesenchymal stem cell therapy, Front Immunol, 15 1421854. 10.3389/fimmu.2024.1421854. [DOI] [PMC free article] [PubMed]
  • 4.Shuai Q., Liang Y., Xu X., et al. Sodium alginate hydrogel integrated with type III collagen and mesenchymal stem cell to promote endometrium regeneration and fertility restoration. Int J Biol Macromol. 2023;253 doi: 10.1016/j.ijbiomac.2023.127314. [DOI] [PubMed] [Google Scholar]
  • 5.Huang T., Nie L., Diao H., et al. Bone mesenchymal stem cells attenuate hepatic stellate cell activation and liver fibrosis through REDD1/autophagy pathway. Stem Cells Transl Med. 2025;14 doi: 10.1093/stcltm/szaf023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ren J.J., Li Z.X., Shi X.R., et al. Exploring the efficacy of BMSC transplantation via various pathways for treating cholestatic liver fibrosis in mice. Biomed Environ Sci. 2025;38:447–458. doi: 10.3967/bes2024.180. [DOI] [PubMed] [Google Scholar]
  • 7.Qian M., Ge M., Liu S., et al. Biomimetic priming of hMSC aggregates with cadherin-IL-1β synergistic microparticles enhances immune homeostasis in inflammatory bowel disease. Chem Eng J. 2025 [Google Scholar]
  • 8.Shuai Q., Cheng J., Wang X., et al. Adipose-derived EVs loaded resolvins biopotentiated decellularized extracellular matrix hydrogels accelerate muscle regeneration. Chem Eng J. 2025 [Google Scholar]
  • 9.Huang T., Zhang C., Shang Z., et al. Bone mesenchymal stem cells improve cholestatic liver fibrosis by targeting ULK1 to regulate autophagy through PI3K/AKT/mTOR pathway. Stem Cells Transl Med. 2024;13:648–660. doi: 10.1093/stcltm/szae028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.T. Zhou, Z. Yuan, J. Weng, et al. Challenges and advances in clinical applications of mesenchymal stroma l cells, J Hematol Oncol, 14 24. 10.1186/s13045-021-01037-x. [DOI] [PMC free article] [PubMed]
  • 11.Zhong X., Luo L., Wu J., et al. Adhesion-assisted antioxidant-engineered mesenchymal stromal cells for enhanced cardiac repair in myocardial infarction. ACS Nano. 2025;19:11412–11426. doi: 10.1021/acsnano.5c00820. [DOI] [PubMed] [Google Scholar]
  • 12.Yuan K., Yang Y., Lin Y., et al. Targeting bacteria-induced ferroptosis of bone marrow mesenchymal stem cells to promote the repair of infected bone defects. Adv Sci (Weinh) 2024;11 doi: 10.1002/advs.202404453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.He L., Zhang H., Zhao N., et al. A novel approach in biomedical engineering: the use of polyvinyl alcohol hydrogel encapsulating human umbilical cord mesenchymal stem cell-derived exosomes for enhanced osteogenic differentiation and angiogenesis in bone regeneration. Int J Biol Macromol. 2024;270 doi: 10.1016/j.ijbiomac.2024.132116. [DOI] [PubMed] [Google Scholar]
  • 14.Alizadeh S., Mahboobi L., Nasiri M., et al. Decellularized placental sponge seeded with human mesenchymal stem cells improves deep skin wound healing in the animal model. ACS Appl Bio Mater. 2024;7:2140–2152. doi: 10.1021/acsabm.3c00747. [DOI] [PubMed] [Google Scholar]
  • 15.Al-Azab M., Idiiatullina E., Safi M., et al. Enhancers of mesenchymal stem cell stemness and therapeutic potency. Biomed Pharmacother. 2023;162 doi: 10.1016/j.biopha.2023.114356. [DOI] [PubMed] [Google Scholar]
  • 16.Brennan M., Layrolle P., Mooney D.J. Biomaterials functionalized with MSC secreted extracellular vesicles and soluble factors for tissue regeneration. Adv Funct Mater. 2020;30 doi: 10.1002/adfm.201909125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Perez R.A., El-Fiqi A., Park J.H., et al. Therapeutic bioactive microcarriers: co-delivery of growth factors and stem cells for bone tissue engineering. Acta Biomater. 2014;10:520–530. doi: 10.1016/j.actbio.2013.09.042. [DOI] [PubMed] [Google Scholar]
  • 18.Bunpetch V., Zhang Z.Y., Zhang X., et al. Strategies for MSC expansion and MSC-Based microtissue for bone regeneration. Biomaterials. 2019;196:67–79. doi: 10.1016/j.biomaterials.2017.11.023. [DOI] [PubMed] [Google Scholar]
  • 19.Kim D.S., Lee J.K., Kim J.H., et al. Advanced PLGA hybrid scaffold with a bioactive PDRN/BMP2 nanocomplex for angiogenesis and bone regeneration using human fetal MSCs. Sci Adv. 2021;7 doi: 10.1126/sciadv.abj1083. eabj1083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Chen Z., Zhang Z., Feng J., et al. Influence of mussel-derived bioactive BMP-2-Decorated PLA on MSC behavior in vitro and verification with osteogenicity at ectopic sites in vivo. ACS Appl Mater Interfaces. 2018;10:11961–11971. doi: 10.1021/acsami.8b01547. [DOI] [PubMed] [Google Scholar]
  • 21.Tesarova L., Jaresova K., Simara P., et al. Umbilical cord-derived mesenchymal stem cells are able to use bFGF treatment and represent a superb tool for immunosuppressive clinical applications. Int J Mol Sci. 2020;21 doi: 10.3390/ijms21155366. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Baldassarro V.A., Perut F., Cescatti M., et al. Intra-individual variability in the neuroprotective and promyelinating properties of conditioned culture medium obtained from human adipose mesenchymal stromal cells. Stem Cell Res Ther. 2023;14:128. doi: 10.1186/s13287-023-03344-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Mohanty C., Pradhan J. A human epidermal growth factor-curcumin bandage bioconjugate loaded with mesenchymal stem cell for in vivo diabetic wound healing. Mater Sci Eng C. 2020;111 doi: 10.1016/j.msec.2020.110751. [DOI] [PubMed] [Google Scholar]
  • 24.Kerkis I., da Silva Á P., Araldi R.P. The impact of interleukin-6 (IL-6) and mesenchymal stem cell-derived IL-6 on neurological conditions. Front Immunol. 2024;15 doi: 10.3389/fimmu.2024.1400533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Huang F., Gao T., Feng Y., et al. Bioinspired collagen scaffold loaded with bFGF-Overexpressing human mesenchymal stromal cells accelerating diabetic skin wound healing via HIF-1 signal pathway regulated neovascularization. ACS Appl Mater Interfaces. 2024;16:45989–46004. doi: 10.1021/acsami.4c08174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Zhang N., Lo C.W., Utsunomiya T., et al. PDGF-BB and IL-4 co-overexpression is a potential strategy to enhance mesenchymal stem cell-based bone regeneration. Stem Cell Res Ther. 2021;12:40. doi: 10.1186/s13287-020-02086-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lee J.H., Chellasamy G., Yun K., et al. EGF-expressed human mesenchymal stem cells inhibit collagenase1 expression in keratinocytes. Cell Signal. 2023;110 doi: 10.1016/j.cellsig.2023.110827. [DOI] [PubMed] [Google Scholar]
  • 28.Chen P., Rao X., He P., et al. The role of Quercetin in the treatment of kidney diseases: a comprehensive review. Biomed Pharmacother. 2025;190 doi: 10.1016/j.biopha.2025.118358. [DOI] [PubMed] [Google Scholar]
  • 29.Zou H., Ye H., Kamaraj R., et al. A review on pharmacological activities and synergistic effect of quercetin with small molecule agents. Phytomedicine. 2021;92 doi: 10.1016/j.phymed.2021.153736. [DOI] [PubMed] [Google Scholar]
  • 30.Li D., Jiang C., Mei G., et al. Quercetin Alleviates Ferroptosis of Pancreatic beta Cells in Type 2 diabetes. Nutrients. 2020;12 doi: 10.3390/nu12102954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zhao Q., Zheng Y., Zhao D., et al. Single-cell profiling reveals a potent role of quercetin in promoting hair regeneration. Protein Cell. 2023;14:398–415. doi: 10.1093/procel/pwac062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Zhu Y., Tchkonia T., Pirtskhalava T., et al. The Achilles' heel of senescent cells: from transcriptome to senolytic drugs. Aging Cell. 2015;14:644–658. doi: 10.1111/acel.12344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Alizadeh S.R., Ebrahimzadeh M.A. Quercetin derivatives: drug design, development, and biological activities, a review. Eur J Med Chem. 2022;229 doi: 10.1016/j.ejmech.2021.114068. [DOI] [PubMed] [Google Scholar]
  • 34.Frenț O.D., Stefan L., Morgovan C.M., et al. A systematic review: Quercetin-Secondary metabolite of the flavonol class, with multiple health benefits and low bioavailability. Int J Mol Sci. 2024;25 doi: 10.3390/ijms252212091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sun D., Li N., Zhang W., et al. Design of PLGA-functionalized quercetin nanoparticles for potential use in Alzheimer's disease. Colloids Surf B Biointerfaces. 2016;148:116–129. doi: 10.1016/j.colsurfb.2016.08.052. [DOI] [PubMed] [Google Scholar]
  • 36.Attar E.S., Chaudhari V.H., Deokar C.G., et al. Nano drug delivery strategies for an oral bioenhanced quercetin formulation. Eur J Drug Metab Pharmacokinet. 2023;48:495–514. doi: 10.1007/s13318-023-00843-7. [DOI] [PubMed] [Google Scholar]
  • 37.Luciani A., Coccoli V., Orsi S., et al. PCL microspheres based functional scaffolds by bottom-up approach with predefined microstructural properties and release profiles. Biomaterials. 2008;29:4800–4807. doi: 10.1016/j.biomaterials.2008.09.007. [DOI] [PubMed] [Google Scholar]
  • 38.Mir M., Ahmed N., Rehman A.U. Recent applications of PLGA based nanostructures in drug delivery. Colloids Surf B Biointerfaces. 2017;159:217–231. doi: 10.1016/j.colsurfb.2017.07.038. [DOI] [PubMed] [Google Scholar]
  • 39.Martins C., Sousa F., Araújo F., et al. Functionalizing PLGA and PLGA derivatives for drug delivery and tissue regeneration applications. Adv Healthc Mater. 2018;7 doi: 10.1002/adhm.201701035. [DOI] [PubMed] [Google Scholar]
  • 40.Su Y., Zhang B., Sun R., et al. PLGA-based biodegradable microspheres in drug delivery: recent advances in research and application. Drug Deliv. 2021;28:1397–1418. doi: 10.1080/10717544.2021.1938756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Essa D., Choonara Y.E., Kondiah P.P.D., et al. Comparative nanofabrication of PLGA-Chitosan-PEG systems employing microfluidics and emulsification solvent evaporation techniques. Polymers. 2020;12 doi: 10.3390/polym12091882. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Liu H.T., Wang H., Wei W.B., et al. A microfluidic strategy for controllable generation of water-in-water droplets as biocompatible microcarriers. Small. 2018;14 doi: 10.1002/smll.201801095. [DOI] [PubMed] [Google Scholar]
  • 43.Liu Y., Guo Y., Liu S., et al. Preparation of flame-retardant HNS/DAAF energetic composite microspheres using droplet microfluidic technology. Mater Today Commun. 2024;38 [Google Scholar]
  • 44.Ge M., Sheng Y., Qi S., et al. PLGA/chitosan-heparin composite microparticles prepared with microfluidics for the construction of hMSC aggregates. J Mater Chem B. 2020;8:9921–9932. doi: 10.1039/d0tb01593h. [DOI] [PubMed] [Google Scholar]
  • 45.Tronina T., Luzny M., Dymarska M., et al. Glycosylation of quercetin by selected entomopathogenic filamentous fungi and prediction of its products' bioactivity. Int J Mol Sci. 2023;24 doi: 10.3390/ijms241411857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Ge M., Sun L., Wang D., et al. Enhancement of therapeutic potential of mesenchymal stem cell by IGF-1 delivery in PLGA microspheres for tissue regeneration. Regen Ther. 2024;27:112–119. doi: 10.1016/j.reth.2024.03.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Maged A., Abdelbaset R., Mahmoud A.A., et al. Merits and advances of microfluidics in the pharmaceutical field: design technologies and future prospects. Drug Deliv. 2022;29:1549–1570. doi: 10.1080/10717544.2022.2069878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Battat S., Weitz D.A., Whitesides G.M. Nonlinear phenomena in microfluidics. Chem Rev. 2022;122:6921–6937. doi: 10.1021/acs.chemrev.1c00985. [DOI] [PubMed] [Google Scholar]
  • 49.Ji Y.B., Lee S., Ju H.J., et al. Preparation and evaluation of injectable microsphere formulation for longer sustained release of donepezil. J Control Release. 2023;356:43–58. doi: 10.1016/j.jconrel.2023.02.024. [DOI] [PubMed] [Google Scholar]
  • 50.Kamanzi A., Gu Y., Tahvildari R., et al. Simultaneous, single-particle measurements of size and loading give insights into the structure of drug-delivery nanoparticles. ACS Nano. 2021;15:19244–19255. doi: 10.1021/acsnano.1c04862. [DOI] [PubMed] [Google Scholar]
  • 51.Tibbitt M.W., Dahlman J.E., Langer R. Emerging frontiers in drug delivery. J Am Chem Soc. 2016;138:704–717. doi: 10.1021/jacs.5b09974. [DOI] [PubMed] [Google Scholar]
  • 52.Saebo I.P., Bjoras M., Franzyk H., et al. Optimization of the hemolysis assay for the assessment of cytotoxicity. Int J Mol Sci. 2023;24 doi: 10.3390/ijms24032914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Vilar A., Hodgson-Garms M., Kusuma G.D., et al. Substrate mechanical properties bias MSC paracrine activity and therapeutic potential. Acta Biomater. 2023;168:144–158. doi: 10.1016/j.actbio.2023.06.041. [DOI] [PubMed] [Google Scholar]
  • 54.Yang Y., Chen Q.H., Liu A.R., et al. Synergism of MSC-secreted HGF and VEGF in stabilising endothelial barrier function upon lipopolysaccharide stimulation via the Rac1 pathway. Stem Cell Res Ther. 2015;6:250. doi: 10.1186/s13287-015-0257-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Meng S.S., Xu X.P., Chang W., et al. LincRNA-p21 promotes mesenchymal stem cell migration capacity and survival through hypoxic preconditioning. Stem Cell Res Ther. 2018;9:280. doi: 10.1186/s13287-018-1031-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Sylakowski K., Bradshaw A., Wells A. Mesenchymal stem Cell/Multipotent stromal cell augmentation of wound healing: lessons from the physiology of matrix and hypoxia support. Am J Pathol. 2020;190:1370–1381. doi: 10.1016/j.ajpath.2020.03.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Ivan A., Lukinich-Gruia A.T., Cristea I.M., et al. Quercetin and mesenchymal stem cell metabolism: a comparative analysis of young and senescent States. Molecules. 2024;29 doi: 10.3390/molecules29235755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Zhou Y., Picchio M.L., Nie Y., et al. Antioxidant and anti-senescence polyvinyl alcohol-gallic acid supramolecular hydrogels for stem cell culture. Adv Healthc Mater. 2025;14 doi: 10.1002/adhm.202402882. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.docx (3MB, docx)

Data Availability Statement

Data will be made available on request.


Articles from Regenerative Therapy are provided here courtesy of Japanese Society for Regenerative Medicine

RESOURCES