Generation of chimeric chickens resistant to infection by avian leukemia virus subgroups A, B, D, E, and K through primordial germ cells

Abstract

Avian leukosis virus (ALVs), an oncogenic retrovirus, induces immunosuppression and various tumors in chickens, posing a severe global threat to poultry health and causing substantial economic losses. Natural resistance alleles, notably tva^r2 and tvb^r3, confer genetic resistance to specific ALV subgroups (ALV-A, -K, and ALV-B, -D, -E, respectively). This study aimed to exploit this resistance by creating resistant chicken lines via primordial germ cells (PGCs)-mediated chimera. We first genotyped the tva^r2 and tvb^r3 loci in Qingyuan Partridge Chickens (QYPCs) and Zhanjiang Yellow Chickens (ZJYCs). Through selective mating, we generated homozygous tva^r2/r2 and tvb^r3/r3 QYPC embryos as PGC donors, and homozygous susceptible tva^s/s and tvb^s/s ZJYC embryos as recipients. Donor PGCs harvested from QYPC embryos were successfully cultured in vitro, as confirmed by the expression of germ cell-specific markers (DDX4, c-Kit, PRDM14) and scanning electron microscopy revealing characteristic microvilli. These PGCs were microinjected into recipient embryos, producing viable chimeric chickens. Genotyping confirmed the successful integration of the resistant donor-derived PGCs. The germline transmission efficiency reached 35.7%. Our findings demonstrate that PGC-mediated germline transmission provides an efficient strategy for rapidly establishing ALV-resistant poultry flocks, offering a potential strategy for establishing ALV-resistant poultry flocks by introgressing resistance alleles.

Introduction

Germline transmission technology has become a pivotal tool in avian genetic engineering. The unique developmental pluripotency and migration traits of chicken primordial germ cells (PGCs) have led to their use as important tools in poultry biotechnology and genetic enhancement strategies (Choi, et al., 2022; Morimoto and Saito, 2025). The isolation and successful in vitro culture of chicken PGCs enabled the investigation into the molecular mechanisms governing their migration to the genital ridge during embryonic development. Furthermore, a stable in vitro culture system for these cells was established (Huss, et al., 2019). In the field of breeding for disease resistance, especially in avian leukemia virus (ALVs), some preliminary progress has been made in the study of PGCs. For example, chicken PGCs can be effectively genetically modified using the CRISPR/Cas9 system to improve disease resistance (Challagulla, et al., 2023). For example, gene editing of the ALV-J receptor Na+/H+ exchange protein 1 (NHE1) in chickens using CRISPR/Cas9 technology has successfully created commercial chicken strains resistant to ALV-J (Koslová, et al., 2020). Germline chimera technology successfully enabled the vertical transmission of foreign genes in chickens through the production of germline chimeras. The approach involved isolating PGCs from the circulating embryonic blood of Chinese Meiling chickens and transplanting them into recipient embryos (Yu, et al., 2019). Furthermore, PGCs have demonstrated great potential in the conservation of poultry genetic resources, sex control and screening, and their use as bioreactors, demonstrating their broad application prospects (He, et al., 2025; Lázár, et al., 2021; Lee, et al., 2019; Oishi, et al., 2018).

Although significant advancements have been made in chicken PGC research, the translation of these findings into practical breeding programs for resistance against economically devastating ALVs has not been fully realized. ALVs in chicken have been diversified into seven subgroups (A to E, J, and K) (J. Chen, et al., 2018; Payne and Nair, 2012). The tva and tvb genes encode the cellular receptors TVA and TVB, which mediate infection by ALV subgroups A and B, respectively (WeiGuo Chen, et al., 2017; Weiguo Chen, et al., 2015). tva and tvb receptor genes that confer host cell resistance to particular ALV subgroups have been identified in several White Leghorns inbred lines and some Chinese broiler lines (WeiGuo Chen, et al., 2017; Weiguo Chen, et al., 2015; Elleder, et al., 2004; Reinišová, et al., 2012; Reinišová, et al., 2008). For example, the resistant allele tva^r2 contains a frame-shifting 4-bp (CTCG) insertion in exon 1 of the tva receptor gene, conferring the resistance of Line 72 to ALV-A and ALV-K (Elleder, et al., 2004; Li, et al., 2023). In addition, our recent study revealed that the resistant allele tvb^r3 contains a novel c.298C>T substitution, which introduces a prematurely introduced TGA stop codon, thereby conferring the resistance of Chinese commercial broilers to infection by ALV-B, ALV-D, and ALV-E (WeiGuo Chen, et al., 2017). Thus, natural tva and tvb resistant alleles could be used for selective breeding for chicken genetically resistant to both ALV-A, -K, and ALV-B, -D, -E.

In this study, PGCs were isolated from tva^r2/r2 and tvb^r3/r3 genotypes Qingyuan Partridge chickens (QYPCs) and microinjected into the embryos of tva^s/s and tvb^s/s genotypes Zhanjiang yellow chickens (ZJYCs) to generate germline chimera chickens. This study successfully established a germline chimeric technology mediated by PGCs, providing a feasible strategy for the rapid breeding of poultry strains with ALV resistance, and also offering a strong technical reserve for the protection of poultry genetic resources and precise breeding.

Materials and methods

Ethics statement

All experiments were carried out in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The use of animals in this study was approved by the South China Agricultural University Committee of Animal Experiments (approval ID: SYXK2022-0136)

Genotyping of the tva^r2 and tvb^r3 Resistant Loci

The QYPCs and ZJYCs in this study were provided by Guangdong AiHealth Biotechnology Co., Ltd and Guangdong Minglong agriculture and animal husbandry Co., Ltd, respectively. Whole blood samples from roosters and hens of QYPCs as well as roosters and hens of ZJYCs were drawn from the wing vein, and then were used for genomic DNA isolation by using DNA extraction kit (Tiangen Biotech, Beijing, China). The genomic region of the tva gene included tva^r2 resistant locus and that of tvb gene comprised of tvb^r3 resistant locus were PCR amplified using the specific primer pairs as described previously, respectively (Weiguo Chen, et al., 2015). The PCR products were directly sequenced by Sangon Biotech Co., Ltd. (Guangzhou, China). The genotypes of the tva^r2 and tvb^r3 resistant loci in each DNA sample were analyzed and confirmed. In total, 120 roosters and 120 hens of QYPCs as well as 120 roosters and 120 hens of ZJYCs were tested for the genotypes of tva^r2 and tvb^r3 resistant loci, respectively. The roosters and hens of QYPCs with both tva^r2/r2 and tvb^r3/r3 genotypes were mated to generate the tva^r2/r2 and tvb^r3/r3 genotypes fertile eggs for donor embryos, while the roosters and hens of ZJYCs with both wild-type tva^s/s and wild-type tvb^s/s were mated to generate the wild-types tva^s/s and tvb^s/s fertile eggs for recipient embryos.

Isolation and culture of donor PGCs

The fertilized eggs of tva^r2/r2 and tvb^r3/r3 genotypes QYPCs were incubated at 37.8°C and 65% relative humidity in an incubator with daily egg rotation. The isolation and culture of PGCs were performed following previous studies with optimizations (Qiao, et al., 2024). PGCs were cultured in KO-DMEM (Invitrogen, Carlsbad, CA) supplemented with 35% BRL-conditioned medium 7.5% fetal bovine serum (HyClone, Logan, UT), 2.5% chicken serum (Gibco, Carlsbad, CA), 2 mM glutamine (Invitrogen, Carlsbad, CA), 1 mM sodium pyruvate (Gibco, Carlsbad, CA), 1 × non-essential amino acids (Gibco, Carlsbad, CA), 1 × nucleosides (Millipore, Bedford, MA), 1 × penicillin-streptomycin (Gibco, Carlsbad, CA), 0.1 mM β-mercaptoethanol (Gibco, Carlsbad, CA), 6 ng/mL SCF (R&D Systems, Minneapolis, MN), and 4 ng/mL bFGF (R&D Systems, Minneapolis, MN). PGCs were seeded at a density of 10,000 cell/mL into 12-well culture plates containing STO feeder layers (SIM mouse embryo-derived thioguanine- and ouabain-resistant fibroblast cell line). Half of the culture medium was replaced every 2 days until cell lines were established. Once established, the PGCs were passaged every 3 days. For cryopreservation of PGCs, the cells were resuspended in PGCs culture medium containing 10% DMSO. The cells were aliquoted into cryovials at a volume of 1 mL per vial and transferred to a controlled-rate freezing container (Corning, CooCell LX). The vials are frozen overnight at -80°C, with a controlled cooling rate of 1°C per minute, and then transferred to liquid nitrogen tanks for long-term storage.

Alkaline phosphatase staining of donor PGCs

PGCs were identified using the BCIP/NBT alkaline phosphatase staining kit (Beyotime, C3206). PGCs on STO feeder layers in 24-well plates were fixed with 4% paraformaldehyde (Servicebio, G1101) for 30 min, then washed three times with PBS (Servicebio, G4202). BCIP/NBT solution was added and incubated in the dark at room temperature for 2 h, with periodic checks every 30 min. The reaction was stopped with PBS washes, and cells were observed using an Olympus CKX41 inverted microscope.

Glycogen staining of donor PGCs

PGCs were stained using the PAS glycogen staining kit (Beyotime, C0142S). The procedure involved bringing all reagents to room temperature, adhering PGCs to the STO feeding layer in 6-well plates, and washing with PBS three times. Cells were fixed with 4% paraformaldehyde for 15 min, then washed with PBS. Periodic acid solution was applied and reacted in the dark for 10 min. After removing the acid, cells were soaked in distilled water and washed for 5 min. Schiff reagent was applied, and cells were stained at 37°C in the dark for 20 min. The staining solution was removed, and cells were washed with PBS. Hematoxylin dyeing solution was added and stained for 1 min, followed by PBS rinsing until the floating color was removed. Cells were observed and imaged using an inverted microscope.

RT-PCR detection of donor PGCs

Total RNA from PGCs and DF-1 were extracted using Trizol (Invitrogen, 15596026), and reverse transcription into cDNA were performed using the PrimeScript TM RT reagent Kit with gDNA Eraser (TaKaRa, RR047A). PCR amplification of the DDX4, c-Kit, PRDM14, and GAPDH genes were carried out using 2 × Taq PCR StarMix (GenStar, A012-B). The PCR conditions were as follows: initial denaturation at 94°C for 5 min, followed by 35 cycles of 94°C for 30 s (denaturation), 52°C for 30 s (annealing), and 72°C for 60 s (extension), with a final extension step at 72°C for 5 min. The PCR products were separated by 1% agarose gel electrophoresis and visualized using an imaging system (Tanon, Shanghai). The primers used for the polymerase chain reaction in this study are listed in Table 1.

Table 1.

Polymerase chain reaction primers.

Gene name	Primer sequences (5’→3’)	Tm (°C)	Product length (bp)
PRDM14	F: AGAGCCCTCCATCTGTCAGT	56.9	161
	R: AACCTTATCACCCCAATAACACCA
DDX4	F: CCTTGCAGCCTTTCTTTGTC	50.2	145
	R: GCCTCTTGATGCTACCGAAG
C-kit	F: GCGAACTTCACCTTACCCGATTA	52.0	150
	R: TGTCATTGCCGAGCATATCCA
GAPDH	F: TGCCCAGAACATCATCCCA	54.0	295
	R: GCCAGCACCCGCATCAAAG

Scanning electron microscopy detection of donor PGCs

PGCs cultured in vitro were collected and centrifuged to remove the supernatant. The cell pellet was fixed in 2.5% glutaraldehyde (Solarbio, P1126) for at least 4 h. The cells were then washed with PBS buffer and subsequently fixed with 1% osmium tetroxide for 2 h. After washing with PBS, the cells were dehydrated through a graded series of ethanol concentrations. The samples were then immersed in hexamethyldisilazane and allowed to dry. Imaging and observation were performed using an extreme-resolution analytical field emission scanning electron microscope (Tescan Mira 3XH).

Preparation of germline chimeric chickens and genotyping for ALV resistance

In a microinjection experiment, donor PGCs from tva^r2/r2 and tvb^r3/r3 genotypes QYPC embryos suspension was adjusted to 5 × 10⁵ cell/mL and mixed with Trypan Blue solution (Gibco, 15250061) at 10% (v/v). The prepared PGC suspension was transferred to a 6-well cell culture plate (Nunc, 176740). Well-developed 3-day-old homozygous tva^s/s and tvb^s/s genotypes ZJYC embryos that developed normally after treatment with 30 ug of busulfan emulsion were used as recipient chicken embryos. Recipient Zhanjiang Yellow Chicken (ZJYC) embryos were treated with busulfan to ablate endogenous PGCs. The busulfan emulsion was prepared by dissolving busulfan (Sigma-Aldrich) in N,N-dimethylformamide (DMF) to a concentration of 10 mg/mL, which was then thoroughly mixed with an equal volume of sesame oil to form a stable emulsion. At 60 hours of incubation (Stage 17-18, Hamburger-Hamilton), 6 uL of this emulsion (containing 30 ug of busulfan) was injected into the yolk of each recipient embryo. Only embryos that developed normally after treatment were selected as recipients for subsequent PGC microinjection at 72 hours of incubation.

Under a stereo microscope, a 20 mm round hole was created in the eggshell using tweezers, and the eggshell membrane was carefully opened to expose the embryo's vascular system. A microglass needle was used to inject 20 µL of PGCs suspension into the embryonic heart, with a total of 153 embryos injected. Post-injection, the fertilized egg opening was sealed with PE plastic wrap (GLAD, W300N) and wax, and the embryos were incubated. Mosaicism was assessed by genotypic analysis in testicular tissue samples from 2-week-old males and semen samples from 20-week-old males. Testicular tissue was collected from euthanized 2-week-old males, and semen was collected from mature males using abdominal massage. Genomic DNA was extracted using the Blood/Cell/Tissue Genomic DNA Extraction Kit (TIANGEN, DP304), and genotyping was performed for tva^r2 and tvb^r3 resistance loci as described above.

Results

Genotyping of the tva^r2 and tvb^r3 resistant loci in QYPCs and ZJYCs

Genotypic analysis of the tva^r2 and tvb^r3 resistance was performed via PCR amplification and sequencing in QYPCs and ZJYCs. In QYPCs, three genotypes were identified at each locus: wild-type tva^s/s, heterozygous tva^s/r2, and homozygous tva^r2/r2 genotypes for the tva gene; and wild-type tvb^s/s, heterozygous tvb^s/r3, and homozygous tvb^r3/r3 genotypes for the tvb gene. In contrast, ZJYCs only harbored the tvb^r3 resistance locus. The sequence traces are shown in Figure 1A and Figure 1B. The genotyping results for the tva^r2 and tvb^r3 resistance loci in QYPCs and ZJYCs are summarized in Table 2. In QYPCs, we identified 4 males and 6 females that carried both the tva^r2/r2 and tvb^r3/r3 genotypes. These males and females were mated to produce fertilized eggs carrying the tva^r2/r2 and tvb^r3/r3 genotypes, which were used as a source for isolating donor PGCs. Meanwhile, in ZJYCs, 18 males and 26 females carrying the wild-type tva^s/s and tvb^s/s genotypes were identified. Fertilized eggs produced by these males and females, with wild-type tva^s/s and tvb^s/s genotypes, were used as recipient embryos.

Fig. 1.

Genotype identification of the tva^r2 and tvb^r3 resistance loci in QYPCs and ZJYCs. (A) Sequence traces showing the wild-type tva^s/s, heterozygous tva^s/r2, and homozygous tva^r2/r2 genotypes at the tva^r2 resistance locus. The 4-nucleotide insertion (CTCG) at the tva^r2 resistance locus is highlighted by a black line. (B) Sequence traces showing the wild-type tvb^s/s, heterozygous tvb^s/r3, and homozygous tvb^r3/r3 genotypes at the tvb^r3 resistance locus. The single nucleotide substitution (C>T) at the tvb^r3 resistance locus is highlighted by a black line.

Table 2.

The genotypes for the tva^r2 and tvb^r3 resistant loci in QYPCs and ZJYCs.

Genotypes		QYPCs		ZJYCs
		Number of roosters (n)	Number of Hens(n)	Number of Roosters(n)	Number of Hens(n)
tvas/s	tvbs/s	10	13	18	26
tvas/s	tvbs/r3	25	18	23	28
tvas/s	tvbr3/r3	38	42	79	66
tvas/r2	tvbs/s	11	9	0	0
tvas/r2	tvbs/r3	5	7	0	0
tvas/r2	tvbr3/r3	10	7	0	0
tvar2/r2	tvbs/s	11	13	0	0
tvar2/r2	tvbs/r3	6	5	0	0
tvar2/r2	tvbr3/r3	4	6	0	0
In total		120	120	120	120

QYPCs = Qingyuan partridge chickens; ZJYCs = Zhanjiang yellow chickens

Isolation and culture of donor PGCs

Embryonic bodies were extracted from 7-day-old QYPC embryos of tva^r2/r2 and tvb^r3/r3 genotypes, and then PGCs were isolated (Fig. 2A-a, 2A-b). Subsequently, under a stereomicroscope, the kidney tissues were isolated and the sex of the embryos were determined by the size of the attached gonads. The size of gonads on both sides is close to the same, which can be considered that the chicken embryo is male (Fig. 2A-c) (Jin, et al., 2020). Next, the gonadal tissues of the male embryos were finely stripped and washed (Fig. 2A-d). After 5 hours of differential plating, the cell population separated into adherent somatic cells and suspended PGCs (Fig. 2A-e). After differential adherence, PGCs were collected and transferred to 4-well cell culture plates pre-inoculated with STO feeding layers to initiate primary culture (Fig. 2A-f). We observed the emergence of PGCs by the fourth day of the primary co-culture. At this time, we also noted a rise in the population of somatic cells in the culture well (Fig. 2B-a). PGCs were collected and cultured for passage. On co-culture day 8, the PGCs started to display their characteristic morphologies. These included single suspended forms, duplex forms, long beaded forms, and cell colonies. A significant reduction in the number of somatic cells within the culture well was also observed at this time (Fig. 2B-b). As the co-culture progressed to day 14, the PGC population had expanded significantly. At this stage, some PGCs began to aggregate into fused clumps, concomitant with the gradual disappearance of somatic cells from the culture well (Fig. 2B-c). After 21 days of co-culture, the PGCs had expanded to occupy approximately 90% of the culture well area. At this stage, the cells exhibited a more uniform morphology, predominantly existing as single suspended cells (Fig. 2B-d). The total cell count reached about 1 × 10⁶, which was indicative of the successful establishment of a stable PGC line from the QYPCs.

Fig. 2.

In vitro isolation and culture process of PGCs from QYPCs with tva^r2/r2 and tvb^r3/r3 genotypes. (A) The process of isolating and initiating primary culture of PGCs from 6-7-day-old tva^r2/r2and tvb^r3/r3 genotype QYPC embryos. (a) Fertile eggs and QYPCs with tva^r2/r2 and tvb^r3/r3 genotypes; (b) Embryos of 6-7 days old tva^r2/r2 and tvb^r3/r3 genotypes QYPCs; (c) a pair of male gonads attached to the surface of the kidney; (d) Several gonadal tissues that have been stripped clean; (e) somatic cells and PGCs after 5 h of differential adhesion; (f) Transfer the post-pasted PGCs to the cell culture plate for primary culture; (B) The Fig. shows the general process of co-culturing PGCs with STO cells for line establishment. (a) The cell morphology of PGCs-STO cells in primary co-culture for 4 days; (b) The cell morphology of PGCs-STO cells cocultured for 8 days; (c) The cell morphology of PGCs-STO cells cocultured for 14 days; (d) The cell morphology of PGCs-STO cells cocultured for 21days and successfully constructed.

Characterization of the donor PGCs

To investigate the characteristics of PGCs from tva^r2/r2 and tvb^r3/r3 genotypes QYPCs. The PGCs exhibited a dark red color upon alkaline phosphatase staining (Fig. 3A), demonstrating strong alkaline phosphatase activity. PAS glycogen staining showed that PGCs in small colonies of long bead cells were dyed purplish-red, indicating that PGCs had mucins and glycoproteins (Fig. 3B). Subsequently, RT-PCR results showed that compared with DF-1, PGCs could express DDX4, c-Kit, and PRDM14 specific genes related to germ cells, while DF-1 only expressed GAPDH (Fig. 3C). In addition, scanning electron microscopy showed that PGCs cells were spherical and covered with interlocking microvilli of different lengths (Fig. 3D, 3E). The establishment of the PGC cell line is further supported by the above biological characteristics.

Fig. 3.

Molecular characterization of PGCs of QYPCs. (A) PGCs alkaline phosphatase staining in vitro; (B) PGCs glycogen staining; (C) RT-PCR showed that germ cell related genes DDX4, c-Kit, and PRDM14 were expressed in PGCs; (D, E) Scanning electron microscopy showed that the surface of chicken PGCs was covered with microvilli.

The generation of chimeric chickens with tva^r2/r2 and tvb^r3/r3 genotypes

In the microinjection experiment, the donor PGCs suspension was adjusted to 4 × 10⁵ cell/mL, and then Trypan Blue solution was added, which accounted for 10% (v/v) of the final mixture. The mixture was then thoroughly mixed. We selected well-developed 3-day-old tva^s/s and tvb^s/s genotypes ZJYC embryos that developed normally after treatment with 30ug of busulfan emulsion to serve as recipients. Under a stereoscopic microscope, 15µL of PGCs mixed injection was aspirated with a microglass needle and injected into the ZJYC embryos' hearts. Before microinjection, the embryonic body morphology and vascular appearance are shown in Fig. 4A-a. We observed the morphology of the embryo and the color of its blood vessels after microinjection of the PGC mixture (Fig. 4A-b). After injection, the opening of the fertilized eggs was sealed with PE wrap and then closed with red wax drops for strengthening (Fig. 4B).

Fig. 4.

The donor PGCs microinjection into recipient embryos and incubation process. (A) The donor PGCs were microinjected into the recipient embryos. A-a showed the recipient chick embryos body shape and blood vessel color before microinjection. A-b showed the recipient chick embryos' body shape and blood vessel color after microinjection; (B) PE wrap to seal the recipient chick embryos opening and hatching.

The donor PGCs, 1000 cells per embryo, were injected into the recipient embryos. A total of 153 embryos were used in the injection experiments. After injection, 115 embryos survived and 38 died. The 115 injected eggs were then incubated in incubators, and 62 chicks hatched. The hatching rate of the injected embryos was 53.9% (62/115). Two chicks died during the process of being raised to two weeks of age. There are 24 cockerels among the remaining 60 chicks. Ten of 24 2-week-old cockerels were randomly euthanized. Testicular tissues were collected from them, genomic DNA was extracted, and the tva^r2 and tvb^r3 resistance sites were PCR-typed. The results showed that the tva^r2/r2 and tvb^r3/r3 genotypes were detected in the testes of all 4 cockerels, indicating that they were chimeras. The remaining 14 roosters were kept until 20 weeks of age, and semen was collected for genomic DNA extraction and genotyping. The results showed that the tva^r2/r2 and tvb^r3/r3 genotypes were detected in the semen of 5 roosters. The germline transmission efficiency reached 35.7%.

Discussion

ALV causes significant economic losses and productivity declines in chickens (Dai, et al., 2021; Zhou, et al., 2019). In this study, germline chimeric chickens were generated by transplanting PGCs from QYPC chickens, which carry the tva^r2/r2 and tvb^r3/r3 resistance genotypes, into ZJYC embryos. The PGCs were successfully established in vitro and colonized the embryos. Genotypic analysis later identified the presence of the tva^r2/r2 and tvb^r3/r3resistance alleles in the semen of mature recipient roosters.

Sex matching between donor chicken PGCs and recipient embryos is crucial for germline chimera production. Typically, male PGCs contribute via the male reproductive system, and female PGCs via the female system (Skinner, et al., 2019). Interestingly, our culture system appeared to favor the colonization and propagation of male PGCs, as evidenced by the established cultures predominantly exhibiting the characteristic morphology of single suspended cells (Molnár, et al., 2019), which is typical of male germ cells. This bias could possibly be due to a higher innate adaptability of male PGCs to the in vitro conditions provided in our system (Fig. 2B-d). Thus, this study focused on male recipient chicken chimeras, prioritizing male embryonic gonadal tissue. Some male recipients failed to form chimeras, possibly due to insufficient endogenous PGCs ablation (Kagami, 2016; Kim, et al., 2021), hindering donor PGCs colonization. In chimera production, embryonic survival correlates with the microinjection site. Commonly, the dorsal aorta or venous vessels are used, producing chimeras but requiring advanced equipment and skilled operators, with high embryonic mortality (Mitsiadis, et al., 2003; Park, et al., 2014). Intracardiac injection was employed as the delivery method to facilitate the rapid systemic distribution of donor PGCs via the circulatory system, thereby promoting their colonization of the gonads. Irradiation efficiently inhibits endogenous germ cells activity, promoting donor PGCs colonization and integration into normal germ cells development, enhancing germline chimeras generation efficiency (Jorgensen, 2013). Besides irradiated rooster testes, recipient chicken embryos are used for donor cell transplantation to create germline chimeras by transferring PGCs or embryonic germ cells (Antonova, et al., 2018; Blitz, et al., 2016; Kim, et al., 2021).

Historically, the introgression of beneficial traits between divergent avian species has been hindered by severe biological barriers. Early hybridization experiments between chickens and turkeys, as documented by Olsen (1962) and (Poole, 1963), demonstrated that while fertilization could occur, the resulting hybrids frequently suffered from high embryonic mortality and chromosomal abnormalities. These challenges limit the feasibility of traditional cross-breeding for germplasm enhancement across distinct species. In contrast, our findings reinforce that PGC-mediated germline chimerism can effectively bypass these reproductive incompatibilities. By successfully transplanting donor PGCs into recipient embryos, this technology provides a viable biological conduit for introgressing valuable genetic traits, such as disease resistance, even potentially between species where natural mating is non-viable. Our results demonstrate the feasibility of intraspecies PGC transplantation, with donor tva^r2/r2 and tvb^r3/r3 genotypes from QYPCs successfully colonizing ZJYC recipient embryos. The detection of these resistance alleles in the semen of mature chimeric roosters validates effective germline transmission. This confirms that PGC-based chimera technology is a viable strategy for the rapid introgression of natural disease-resistance genes into susceptible poultry populations, providing a strong foundation for hereditary disease control.

This study demonstrates the feasibility of transmitting disease-resistant chicken genetic material via surrogate hosts. Furthermore, pioneering work by other research groups has demonstrated that precise CRISPR/Cas9-mediated deletion of tryptophan 38 (W38) in the chicken Na+/H+ exchanger type 1 (chNHE1) receptor within PGCs can successfully generate gene-edited chickens resistant to ALV-J (Koslová, et al., 2020). The genotypes resistant chicken of tva^r2/r2 and tvb^r3/r3 used in this study developed effective resistance to ALV-A, B, D, E, and K. If we use PGCs from resistant chickens combined with precision gene editing technology to develop a new disease resistance breeding program targeting ALV-J, it will fill the gap in the research field of avian leukemia disease resistance breeding.

This study confirms that the PGCs of tva^r2/r2 and tvb^r3/r3 disease-resistant genotypes QYPCs were successfully implanted into the wild-type tva^s/s and tvb^s/s genotypes ZJYC embryos, resulting in the formation of tva^r2/r2 and tvb^r3/r3 genotypes chimeras. Genotyping of the chimeric rooster semen further validated the germline transmission of the tva^r2/r2 and tvb^r3/r3 resistance genotypes. In conclusion, the PGC-based germline chimera technology holds significant promise for advancing disease-resistant poultry breeding. When integrated with precision genome editing tools such as CRISPR/Cas9, this synergistic strategy paves the way for groundbreaking developments in the rapid generation of poultry lines with robust, heritable resistance to pathogens like ALV.

CRediT authorship contribution statement

Gengsheng Xiao: Writing – review & editing, Writing – original draft, Methodology, Data curation. Weiguo Chen: Writing – review & editing, Writing – original draft, Methodology, Data curation. Xiaoling Chen: Software, Data curation. Ying Huang: Software, Conceptualization. Tingxi Pan: Investigation. Sheng Chen: Resources. Yongsen Wen: Investigation. Hongxin Li: Visualization. Xinheng Zhang: Project administration. Qingmei Xie: Supervision, Methodology, Funding acquisition, Conceptualization.

Disclosures

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.