Abstract
Background:
As a leading cause of global morbidity, myocardial infarction (MI) is a primary focus of medical research. The isoproterenol (ISO)-induced model of cardiac injury is a cornerstone of this work, providing a validated experimental system that simulates the human condition. This study investigated the cardioprotective potential of dapagliflozin (DAPA), a sodium-glucose cotransporter-2 (SGLT2) inhibitor, against ISO-induced myocardial injury in adult male rats.
Materials and Methods:
Thirty-two rats were divided into four groups; Control group, DAPA-only group: DAPA (1 mg/kg/day, orally, 14 days) + saline, ISO-only: Saline (orally, 14 days) + ISO (100 mg/kg/day, days 13–14) and fourth group, DAPA + ISO: pretreated with DAPA 1 mg/kg/day orally) for 14 days, followed by ISO 100 mg/kg, subcutaneously days 13–14. DAPA’s protective effects against ISO-induced MI were evaluated by assessing cardiac damage by measuring serum biomarkers of heart injury while simultaneously evaluating oxidative stress through lipid peroxidation levels and antioxidant activity in cardiac tissue. Histopathological examination revealed structural changes in myocardial tissue, complemented by molecular analysis quantifying the expression of key apoptotic regulators.
Results:
Biochemical analysis revealed that DAPA significantly reduced ISO-induced elevations in cardiac troponin-I, creatine kinase-MB, lactate dehydrogenase, and oxidative stress markers; malondialdehyde, superoxide dismutase, and reduced glutathione. DAPA also attenuated inflammatory cytokines: tumor necrosis factor-alpha and interleukin-6 (IL-6). Histopathological examination of heart tissues demonstrated that DAPA mitigated ISO-induced myocardial necrosis and inflammatory infiltration, preserving cardiac architecture. Moreover, DAPA downregulated the pro-apoptotic protein (Bax) expression and upregulated the anti-apoptotic protein (Bcl2) levels in the heart.
Conclusions:
These findings suggest that DAPA exerts multimodal cardio-protection beyond its antidiabetic action, positioning it as a promising adjunct therapy for ischemic heart disease. Further clinical studies are warranted to validate its translational potential.
Keywords: Antioxidants, Bax, Bcl2 expression, dapagliflozin, myocardial injury
Introduction
The World Health Organization’s 2023 report confirms that cardiovascular diseases, with myocardial infarction (MI) being a predominant concern, are still a major driver of global morbidity and mortality. Despite advances in therapeutic interventions, the search for novel cardioprotective agents continues due to the limitations of existing treatments, including adverse side effects and incomplete efficacy.[1] Isoproterenol (ISO), a synthetic β-adrenergic agonist, is widely used in experimental models to induce MI in rodents, mimicking key pathological features such as oxidative stress, inflammation, and myocardial necrosis.[2] This model provides a reliable platform for evaluating potential cardioprotective drugs.
Emerging research has revealed that sodium-glucose cotransporter-2 (SGLT2) inhibitors, drugs first approved for type 2 diabetes, offer unexpected efficacy in improving cardiovascular outcomes.[3] Among these, dapagliflozin (DAPA) has shown promise in reducing heart failure hospitalizations and improving cardiac outcomes in clinical trials.[4] However, its mechanisms of cardioprotection, particularly in nondiabetic models of MI remain incompletely understood. Originally designed to lower blood glucose by inhibiting renal glucose reabsorption, SGLT2 inhibitors like DAPA have demonstrated pleiotropic cardiovascular benefits independent of diabetes.[5] The DAPA-heart failure trial demonstrated that DAPA significantly reduces the risk of worsening heart failure or cardiovascular death in patients with a reduced ejection fraction, an effect that was consistent irrespective of diabetes status, suggesting direct cardiac effects. Preclinical studies indicate that DAPA reduces oxidative stress by enhancing nuclear factor erythroid 2-related factor (Nrf2)/heme oxygenase-1 signaling,[6] suppresses NLRP3 inflammasome activation (the nucleotide-binding domain, the leucine-rich repeat domain, and pyrin domain-containing protein 3), attenuating inflammation,[7] improves mitochondrial function by promoting ketone metabolism,[8] and inhibits cardiac fibrosis via transforming growth factor beta-1 (TGF-β1) downregulation.[9] Despite these advances, most mechanistic studies have focused on heart failure models rather than acute MI. Furthermore, whether DAPA’s benefits extend to non-diabetic, ISO-induced cardiac injury remains underexplored.
While a previous study by Wang et al. and others has demonstrated that DAPA improves cardiac function and reduces fibrosis in a rat model of ISO-induced cardiomyopathy,[9,10] the precise mechanisms underlying its cardioprotective effects, particularly concerning apoptosis, inflammation, and ultrastructural preservation, remain less explored. Building upon this foundation, the present study was designed to provide deeper mechanistic insights. We specifically investigate the novel aspects of DAPA’s action, including its modulation of the pro-apoptotic protein (Bax)/anti-apoptotic protein (Bcl2) balance at the mRNA level, its effect on specific cardiac inflammatory cytokines; tumor necrosis factor-alpha (TNF-α) and interleukin-6 (IL-6), and crucially, its ability to preserve myocardial ultrastructure as evidenced by transmission electron microscopy (TEM), which offers a level of structural detail not previously reported in this context. Therefore, this study aims to comprehensively evaluate the cardioprotective potential of DAPA against ISO-induced injury by integrating biochemical, molecular, histopathological, and ultrastructural analyses.
Materials and Methods
Experimental animals
The study utilized adult male Sprague–Dawley rats weighing 200–250 g, which were maintained under controlled environmental conditions. The rats were maintained in a controlled environment with temperatures kept at 25°C ± 2°C, relative humidity between 50% and 60%, and a consistent 12-h light/dark schedule. They were provided unrestricted access to food and water during the entire experiment. All protocols strictly followed the ethical standards established in the Guide for the Care and Use of Laboratory Animals (NIH, 2011) and received formal approval from the Institutional Animal Ethics Committee of Tanta University’s Faculty of Medicine (Protocol No. 36264PR1270/6/25).
Drugs and chemicals
Study design
Thirty-two rats were randomly divided into four groups (n = 8/group):
Control: 0.5% CMC (orally, 14 days) + saline (subcutaneously, days 13–14)
DAPA-only: DAPA (1 mg/kg/day, orally, 14 days)
ISO-only: Saline (orally, 14 days) + ISO (100 mg/kg/day, days 13–14)
DAPA + ISO: DAPA pretreatment (days 1 14) + ISO (days 13–14).
The high-dose ISO regimen administered over 2 consecutive days was selected based on established protocols to reliably induce significant myocardial necrosis and oxidative stress, providing a robust model to evaluate the cardioprotective efficacy of DAPA pretreatment.[12]
On the morning of the 15th day, the rats were anesthetized using pentobarbital sodium[13] and then euthanized. Upon sacrifice, blood specimens were obtained, and cardiac tissue was promptly excised. The tissue was washed with chilled saline solution, blotted dry using filter paper, and immediately snap-frozen in liquid nitrogen. These samples were subsequently maintained at −80°C until further biochemical assessment of the target markers could be performed.
Determination of heart function indexes
Following blood collection, samples were centrifuged at 3000 rpm for 10 min at 4°C to separate serum. The resulting serum was then analyzed for key cardiac injury biomarkers using commercially available enzyme-linked immunosorbent assay (ELISA) kits. Specifically, we measured lactate dehydrogenase (LDH) activity along with cardiac troponin-I (cTn-I) and creatine kinase-MB (CK-MB) concentrations, following the manufacturer’s standardized protocols.
Assessment of oxidative stress markers and antioxidant defenses
To evaluate myocardial oxidative stress, we measured malondialdehyde (MDA) levels as an indicator of lipid peroxidation in heart tissue homogenates. We simultaneously assessed the activity of key antioxidant enzymes, including superoxide dismutase (SOD) and reduced glutathione (GSH). All measurements were performed using validated colorimetric assay kits (Cayman Chemical, USA). Heart tissues were homogenized in ice-cold phosphate-buffered saline or an appropriate assay buffer to prepare a uniform suspension. The homogenates were then centrifuged to remove debris, and the resulting supernatant was used for analysis.
MDA levels were determined by reacting the samples with thiobarbituric acid, forming a pink-colored complex measured at 532 nm
SOD activity was assessed based on its ability to inhibit the superoxide radical-mediated reduction of a tetrazolium dye, with absorbance read at 440-460 nm
GSH content was quantified using an enzymatic recycling method involving 5,5′-dithiobis (2-nitrobenzoic acid) (DTNB), which produces a yellow product measured at 412 nm.[14]
Determination of inflammatory cytokines
To assess myocardial inflammation, we measured the concentrations of TNF-α and IL-6 in heart tissue homogenates using commercially available ELISA kits (R and D Systems, USA). The assays were conducted according to the manufacturer’s protocol, with minor adjustments based on established methods.[15] For sample preparation, heart tissues were homogenized in ice-cold lysis buffer supplemented with protease inhibitors to maintain protein integrity. The homogenates were then centrifuged to remove cellular debris, and the resulting supernatant was collected for analysis. Total protein content was determined using a standardized assay (Bradford or BCA method) to ensure accurate normalization of cytokine levels.
Histopathological examination of heart
Samples from the left ventricle were carefully collected and fixed in 10% neutral-buffered formalin to preserve tissue architecture. After fixation, the tissues underwent graded alcohol dehydration, were cleared in xylene, and finally embedded in paraffin wax for sectioning. Using a microtome, 5 μm thick sections were obtained and mounted on glass slides. For microscopic evaluation, the sections were stained with hematoxylin and eosin (H and E) to visualize cellular morphology and assess pathological changes. The stained slides were examined under an optical microscope, and representative images were captured using a high-resolution digital microscope camera.[16]
To prepare the specimens for electron microscopy, we fixed them in phosphate-buffered 1% glutaraldehyde (pH 7.2–7.4) and then post-fixed them in a fresh 1% osmium tetroxide phosphate buffer solution for 1–2 h at 4°C. After creating ultra-thin sections, we applied contrasting stains; first 4% uranyl acetate and then lead citrate. The samples were then examined and photographed using a Jeol (Japan) transmission electron microscope at Tanta University’s Electron Microscopy Unit (John, 2014).[17]
Quantitative reverse transcriptase polymerase chain reaction
Total RNA was isolated from rat heart tissue with QIAzol reagent (Qiagen, Germany) according to the manufacturer’s instructions. The concentration and purity of the extracted RNA were then verified using a NanoDrop spectrophotometer. Subsequently, 1 μg of this total RNA was reverse-transcribed into complementary DNA using the QuantiTect Reverse Transcription Kit (Qiagen, Germany). We then performed quantitative real-time polymerase chain reaction (PCR) using SYBR Green I Premix ExTaq on either an Applied Biosystems 7500 or Bio-Rad CFX96 system (Bio-Rad Laboratories) to analyze the expression of apoptosis-related genes (Bax and Bcl-2). The PCR protocol began with an initial denaturation at 95°C for 10 min, followed by 40 cycles of denaturation (95°C, 15 s), annealing (62°C, 30 s), and extension (72°C, 45 s). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as the endogenous control for normalization.[18]
The gene-specific primers were used as follows:
Bax (117 bp), forward: 5’–GGAGACACCT GAGCT GACCT–3’, reverse: 5’–ATCCTCTGCAGCTCC ATGTT–3’.
Bcl2 (120 bp), forward: 5’–AGGATTGTGGCCTTCTTT GA–3’, reverse: 5’–CAGATGCCGGTTCAGGTACT–3’, P53 (119 bp).
Control gene GAPDH Forward: 5′-CTC TCT GCT CCT CCC TGT TC-3′, reverse: 5′-CGA CAT ACT CAG CAC CAG CA-3′.
The target genes’ expression was conducted using the comparative Ct method 2−ΔΔCt formula (the amount of target, normalized to the endogenous control gene [GAPDH]).
Statistical analysis
All values are reported as the mean ± standard error of the mean. Using Statistical Package for the Social Sciences (SPSS) version 19.0 (SPSS Inc., Chicago, Illinois, USA), statistical comparisons were carried out as follows: Student’s t-test for two-group analyses and one-way ANOVA with Tukey’s post hoc test for multi-group analyses. The threshold for statistical significance was established at P < 0.05.
Results
Dapagliflozin attenuated isoproterenol-induced cardiac injury biomarkers
As detailed in Figure 1, analysis of serum markers revealed a marked increase in the levels of CTn-I, CK-MB, and LDH in group G3 relative to group G1. This indicated significant cardiac injury. However, treatment with DAPA (G4) effectively attenuated this damage, showing a protective effect against the cardiotoxic impact of ISO when compared to the control group.
Figure 1.

Assessment of cardiac injury biomarkers. Control group, isoproterenol (ISO)-group, dapagliflozin (DAPA) group, and ISO + DAPA. Each point is the mean ± standard deviation (n = 8). According to the Student’s t-test: a is nonsignificant compared to the control; b is significant compared to the control, P < 0.05; c is significant compared to the ISO-treated group, P < 0.05. Values of cTn-I are in pg/mL; values of CK-MB and LDH are in IU/L. cTn-I is troponin I; CK-MB is Creatine kinase; LDH is lactate dehydrogenase. DAPA: Dapagliflozin; ISO: Isoproterenol; SD: Standard deviation
Dapagliflozin reduced oxidative stress
Based on Table 1, the ISO-treated group showed a notable reduction in SOD activity and GSH levels in heart tissue compared to the control group, along with a marked rise in MDA content. However, treatment with DAPA significantly reduced oxidative cardiac damage, as evidenced by lower MDA levels. In addition, DAPA administration led to a significant increase in both SOD activity and GSH content in heart tissue compared to the control group.
Table 1.
Effect of dapagliflozin on oxidative stress biomarkers and inflammatory cytokines in rat heart tissue
| Measurable factor | Control | DAPA | ISO | ISO-treated with DAPA |
|---|---|---|---|---|
| MDA level (nmol/g tissue protein) | 43.21±3.76 | 45.36±3.98a | 90.54±5.76b | 50.76±5.76a,c |
| GSH level (μmol/g tissue protein) | 12.76±1.76 | 11.25±1.09a | 4.59±0.72b | 10.33±1.21a,c |
| SOD level (μmol/g tissue protein) | 220.34±16.24 | 210.56±18.45a | 120.56±12.74b | 195.35±17.34a,c |
| TNF-α (pg/mL) | 30.76±2.34 | 32.23±2.67a | 120.82±9.67b | 41.52±3.23a,c |
| IL-6 (pg/mL) | 20.12±1.78 | 24.45±2.34a | 85.93±8.41b | 31.23±2.65a,c |
aP>0.05 compared to the control; bP<0.05 compared to the control; cP<0.05 compared to the ISO- treated group. The P value indicates the probability of chance, with P<0.05 considered statistically significant according to the Student’s t-test. Data are presented as mean±SD. MDA: Malondialdehyde; GSH: Glutathione; SOD: Superoxide dismutase; TNF: Tumor necrosis factor-alpha; IL-6: Interleukin-6; DAPA: Dapagliflozin; SD: Standard deviation; ISO: Isoproterenol
Dapagliflozin suppressed inflammation
Rats treated with ISO showed significantly increased levels of TNF-α and IL-6 in the heart tissues compared to control animals. However, co-administration of DAPA with ISO effectively attenuated these elevated levels [Table 1].
Histopathological results
Light microscopic examination of H- and E-stained sections from control animals revealed characteristic myocardial architecture. Cardiac myocytes exhibited their typical striated appearance, with elongated fibers arranged in parallel arrays that branched in an organized pattern. These cells displayed eosinophilic cytoplasm and centrally positioned oval nuclei in longitudinal sections. The interstitial spaces contained delicate connective tissue with clearly visible myocardial capillaries [Figure 2a].
Figure 2.

(a) A section of cardiac muscle of the control group showing branched, striated cardiac muscle fibers cut longitudinally with acidophilic sarcoplasm and centrally located nuclei (→). (b-d) Sections of cardiac muscle of subgroup B showing fibrillolysis (►), widening between myofiber (*) and peripheral pyknotic nuclei (curved arrow), localized area of inflammatory cellular infiltrate (bifid arrow) and showing congested and dilated blood vessels. (e) The cardiac muscle fibers appear more or less similar to control in the section of dapagliflozin and isoproterenol-treated group (H and E, Mic. Mag. ×200, Bar: 10 µm)
In contrast, ISO-treated animals demonstrated significant pathological alterations. The myocardial fibers appeared disorganized and fragmented, showing characteristic features of cellular damage, including peripheral nuclear displacement, pyknotic nuclei, cytoplasmic vacuolization, and myofibril disintegration. Vascular changes included marked capillary congestion and dilation, accompanied by mononuclear cell infiltration in the interstitium [Figure 2b-d]. Notably, DAPA co-treatment with ISO ameliorated these pathological changes. The myocardial vasculature showed reduced congestion and dilation, with the absence of inflammatory cell infiltration [Figure 2e].
Electron micrographic analysis of the control group myocardium revealed a well-preserved ultrastructural organization, characterized by sarcoplasm filled with longitudinal, parallel arrays of cylindrical myofibrils demarcated by distinct Z lines, and densely populated with mitochondria situated in the intermyofibrillar spaces, all enclosed by an intact sarcolemma [Figure 3a]. In contrast, the ISO treated group exhibited significant pathological alterations, including the destruction and degeneration of myofibrils, focal areas of myofibrillar lysis, and pronounced disruption of critical structures such as the Z lines and intercalated discs [Figure 3b-c]. However, when DAPA was given, not all areas were uniformly affected, as some focal regions of the sarcoplasm appeared more or less similar to the normal architecture observed in the control specimens [Figure 3d].
Figure 3.

Electron micrographs of the myocardium of the control group showing: (a) Sarcoplasm is composed of longitudinal arrays of cylindrical myofibrils (f) between Z lines passing and rich in mitochondria (m) located between the myofibrils with a normal cell membrane of the cardiac myocytes. (b) Destruction and degeneration of some myofibrils (mf), disruption of Z line and intercalated disc. (c) Focal areas of myofibrils (mf) lysis. (d) The sarcoplasm appears more or less similar to the control (Bar: 500 nm)
Gene expression results
Rats treated with ISO showed significantly increased expression of pro-apoptotic Bax gene compared to control animals. However, co-administration of DAPA with ISO effectively attenuated these elevated expression levels.
Regarding the anti-apoptotic Bcl-2 gene, ISO treatment resulted in markedly reduced expression relative to controls. This suppression was significantly reversed when DAPA was administered alongside ISO, with Bcl-2 expression returning toward normal levels [Figure 4].
Figure 4.

The effects of dapagliflozin (DAPA) on the mRNA expression of the apoptosis-associated genes in rat hearts. Control group, isoproterenol (ISO)-group, DAPA group and ISO + DAPA. Each point is the mean ± standard deviation (n = 8). According to the Student’s t-test: a is nonsignificant compared to the control; b is significant compared to the control, P < 0.05; c is significant compared to the ISO-treated group, P < 0.05. DAPA: Dapagliflozin; ISO: Isoproterenol; SD: Standard deviation
Discussion
The present study demonstrates that DAPA pretreatment significantly attenuates ISO-induced cardiac injury. Our findings align with emerging evidence that SGLT2 inhibitors exert cardioprotective effects.[10] This study builds directly upon this foundation by delving into the underlying cellular and molecular mechanisms, providing a more granular understanding of DAPA’s cardioprotective effects. We confirm that DAPA pretreatment significantly attenuates ISO-induced cardiac injury, as evidenced by the reduction in serum biomarkers of necrosis (cTnI, CK-MB, LDH). Crucially, our work moves beyond this confirmation to reveal that DAPA’s protection is mediated through a multifaceted defense against oxidative stress, a targeted suppression of the inflammatory cytokine cascade, and a direct normalization of the apoptotic balance.
ISO administration led to severe myocardial damage, as evidenced by elevated serum cardiac injury biomarkers (cTnI, CK-MB, LDH), consistent with prior reports of ISO-induced necrosis and membrane destabilization.[19] DAPA pretreatment reduced these markers, suggesting stabilization of cardiomyocyte integrity. This aligns with clinical data showing SGLT2 inhibitors reduce cardiovascular events in diabetic and nondiabetic patients.[4] The reduction in cTnI, a highly specific marker of myocardial injury, underscores DAPA’s potential in mitigating acute cardiac stress.[20,21]
ISO-induced cardiotoxicity is mediated partly by reactive oxygen species (ROS) overproduction.[22] The results of the present study revealed that DAPA: Reduced lipid peroxidation and restored antioxidant defenses (SOD, GSH near baseline). This suggests DAPA may directly scavenge ROS or enhance endogenous antioxidant capacity. This is strongly supported by a recent study showing that the SGLT2 inhibitor empagliflozin promoting diabetic wound healing in the rat model by targeting signal transducer and activator of transcription 3/protein kinase B/nuclear factor erythroid-derived 2-like axis (STAT3/Akt/Nrf2 axis),[23] a key pathway for cellular defense against oxidative stress.
The present study revealed that ISO administration triggered a pronounced inflammatory response, marked by significant elevations in cardiac TNF-α levels. This pro-inflammatory cascade was accompanied by dysregulation of apoptotic pathways, evidenced by upregulated Bax expression (a pro-apoptotic mediator), and downregulated Bcl-2 (an anti-apoptotic regulator). These findings are in alignment with established mechanisms whereby ISO induces cardiomyocyte apoptosis through oxidative stress-mediated activation of mitochondrial death pathways[24,25] and promotes nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB)-driven inflammation.[7] The observed Bax/Bcl-2 imbalance further exacerbates cellular susceptibility to apoptosis.[26]
Notably, DAPA co-treatment attenuated these effects, suppressing ISO-induced inflammatory markers and restoring apoptotic homeostasis. This protective effect is consistent with emerging evidence that SGLT2 inhibitors, including DAPA, modulate NF-κB signaling[27] and enhance mitochondrial integrity. The concurrent reduction in inflammatory cytokines and normalization of apoptotic regulators suggest DAPA exerts cardioprotection through inhibiting pro-inflammatory transcriptional pathways and stabilizing the mitochondrial apoptotic threshold.
Co-treatment with DAPA normalizing Bax overexpression while restoring Bcl-2 levels. This cardioprotective action may be attributed to DAPA’s ability to modulate adenosine monophosphate-activated protein kinase (AMPK)/sirtuin 1 (SIRT1) pathways signaling, which suppresses oxidative stress and inflammation.[28] The restoration of Bcl-2 expression suggests DAPA promotes cell survival by stabilizing mitochondrial integrity, consistent with its reported anti-apoptotic effects in diabetic cardiomyopathy.[29]
DAPA significantly reduced ISO-induced necrosis, edema, and leukocyte infiltration, supporting DAPA’s role in attenuating maladaptive remodeling, possibly via inhibition of pro-fibrotic TGF-β pathways.[30] These structural benefits mirror those seen in heart failure models,[8] reinforcing DAPA’s potential in preventing adverse ventricular remodeling. Furthermore, the observed DAPA-mediated suppression of the pro-inflammatory cytokines TNF-α and IL-6 provides a specific molecular correlate to the attenuated inflammatory infiltration seen in our histopathological analysis and in prior studies.[10] This suggests that the beneficial effects of DAPA extend beyond general anti-inflammatory activity to include the modulation of specific, key drivers of the myocardial inflammatory response. This targeted immunomodulation, coupled with the restoration of redox homeostasis, creates a cellular environment that is profoundly resistant to ISO-induced damage.
While this study highlights DAPA’s cardioprotection, limitations include a lack of mechanistic data (e.g., AMPK/SIRT1 signaling), use of a pretreatment model; post-injury efficacy remains unexplored, and animal-based findings requiring clinical validation.
Conclusions
These preclinical findings significantly expand the therapeutic rationale for SGLT2 inhibitors beyond their antidiabetic effects and established heart failure indications.[19,20] The robust cardioprotection observed against acute ISO-induced injury, mediated by attenuated oxidative stress, inflammation, and apoptosis, supports further investigation into their potential application in acute coronary syndromes and other forms of ischemic heart injury.
Conflicts of interest
There are no conflicts of interest.
Funding Statement
Nil.
References
- 1.Benedikt M, Kolesnik E, Sourij H, von Lewinski D. SGLT2 inhibition in acute myocardial infarction-a comprehensive review. Rev Cardiovasc Med. 2023;24:32. doi: 10.31083/j.rcm2402032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Hu J, Wang X, Cui X, Kuang W, Li D, Wang J. Quercetin prevents isoprenaline-induced myocardial fibrosis by promoting autophagy via regulating miR-223-3p/FOXO3. Cell Cycle. 2021;20:1253–69. doi: 10.1080/15384101.2021.1932029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Zinman B, Wanner C, Lachin JM, Fitchett D, Bluhmki E, Hantel S, et al. Empagliflozin, cardiovascular outcomes, and mortality in type 2 diabetes. N Engl J Med. 2015;373:2117–28. doi: 10.1056/NEJMoa1504720. [DOI] [PubMed] [Google Scholar]
- 4.McMurray JJ, Solomon SD, Inzucchi SE, Køber L, Kosiborod MN, Martinez FA, et al. Dapagliflozin in patients with heart failure and reduced ejection fraction. N Engl J Med. 2019;381:1995–2008. doi: 10.1056/NEJMoa1911303. [DOI] [PubMed] [Google Scholar]
- 5.Packer M, Anker SD, Butler J, Filippatos G, Pocock SJ, Carson P, et al. Cardiovascular and renal outcomes with empagliflozin in heart failure. N Engl J Med. 2020;383:1413–24. doi: 10.1056/NEJMoa2022190. [DOI] [PubMed] [Google Scholar]
- 6.Ye Y, Bajaj M, Yang HC, Perez-Polo JR, Birnbaum Y. SGLT-2 inhibition with dapagliflozin reduces the activation of the Nlrp3/ASC inflammasome and attenuates the development of diabetic cardiomyopathy in mice with type 2 diabetes. Further augmentation of the effects with saxagliptin, a DPP4 inhibitor. Cardiovasc Drugs Ther. 2017;31:119–32. doi: 10.1007/s10557-017-6725-2. [DOI] [PubMed] [Google Scholar]
- 7.Li M, Tan H, Gao T, Han L, Teng X, Wang F, et al. Gypensapogenin I ameliorates isoproterenol (ISO)-induced myocardial damage through regulating the TLR4/NF-κB/NLRP3 pathway. Molecules. 2022;27:5298. doi: 10.3390/molecules27165298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Santos-Gallego CG, Requena-Ibanez JA, San Antonio R, Ishikawa K, Watanabe S, Picatoste B, et al. Empagliflozin ameliorates adverse left ventricular remodeling in nondiabetic heart failure by enhancing myocardial energetics. J Am Coll Cardiol. 2019;73:1931–44. doi: 10.1016/j.jacc.2019.01.056. [DOI] [PubMed] [Google Scholar]
- 9.Lee TM, Chang NC, Lin SZ. Dapagliflozin, a selective SGLT2 inhibitor, attenuated cardiac fibrosis by regulating the macrophage polarization via STAT3 signaling in infarcted rat hearts. Free Radic Biol Med. 2017;104:298–310. doi: 10.1016/j.freeradbiomed.2017.01.035. [DOI] [PubMed] [Google Scholar]
- 10.Wang FZ, Wei WB, Li X, Huo JY, Jiang WY, Wang HY, et al. The cardioprotective effect of the sodium-glucose cotransporter 2 inhibitor dapagliflozin in rats with isoproterenol-induced cardiomyopathy. Am J Transl Res. 2021;13:10950–61. [PMC free article] [PubMed] [Google Scholar]
- 11.Sweed E, Sweed D, Galal N, Abd-Elhafiz HI. Dapagliflozin protection against myocardial ischemia by modulating sodium-glucose transporter 2 inhibitor, silent information regulator 1, and fatty acid synthase expressions. Open Access Maced J Med Sci. 2022;10:1544–5. Available from: https://oamjms.eu/index.php/mjms/article/view/10861 . [Last accessed on 2025 Nov 21]. [Google Scholar]
- 12.Pullaiah CP, Nelson VK, Rayapu S, Narasimha Kumar GV, Kedam T. Exploring cardioprotective potential of esculetin against isoproterenol induced myocardial toxicity in rats: In vivo and in vitro evidence. BMC Pharmacol Toxicol. 2021;22:43. doi: 10.1186/s40360-021-00510-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Gaertner DJ, Hallman TM, Hankenson FC, Batchelder MA. Anesthesia and analgesia for laboratory rodents. In: Fish RE, Danneman PJ, Brown M, Karas AZ, editors. Anesthesia and Analgesia in Laboratory Animals. 2nd. London (UK): Academic Press; 2008. pp. 239–97. [Google Scholar]
- 14.Jîtcă G, Fogarasi E, Ősz BE, Vari CE, Fülöp I, Croitoru MD, et al. Profiling the concentration of reduced and oxidized glutathione in rat brain using HPLC/DAD chromatographic system. Molecules. 2021;26:6590. doi: 10.3390/molecules26216590. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Zhang B, Wang H, Yang Z, Cao M, Wang K, Wang G, et al. Protective effect of alpha-pinene against isoproterenol-induced myocardial infarction through NF-κB signaling pathway. Hum Exp Toxicol. 2020;39:1596–606. doi: 10.1177/0960327120934537. [DOI] [PubMed] [Google Scholar]
- 16.Bancroft JD, Layton CX. The hematoxylins and eosin. In: Suvarna SK, Layton C, Bancroft JD, editors. Theory and Practice of Histological Techniques. Livingstone, London: Churchil; 2018. pp. 173–86. [Google Scholar]
- 17.John K. Methods in Molecular Biology. 3rd. New York: Springer; 2014. Electron microscopy methods and protocols. [Google Scholar]
- 18.Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55:611–22. doi: 10.1373/clinchem.2008.112797. [DOI] [PubMed] [Google Scholar]
- 19.Yang Y, Xia Z, Xu C, Zhai C, Yu X, Li S. Ciprofol attenuates the isoproterenol-induced oxidative damage, inflammatory response and cardiomyocyte apoptosis. Front Pharmacol. 2022;13:1037151. doi: 10.3389/fphar.2022.1037151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Anker SD, Butler J, Filippatos G, Ferreira JP, Bocchi E, Böhm M, et al. Empagliflozin in heart failure with a preserved ejection fraction. N Engl J Med. 2021;385:1451–61. doi: 10.1056/NEJMoa2107038. [DOI] [PubMed] [Google Scholar]
- 21.Heerspink HJ, Cherney D, Postmus D, Stefánsson BV, Chertow GM, Dwyer JP, et al. A pre-specified analysis of the Dapagliflozin and prevention of adverse outcomes in Chronic Kidney Disease (DAPA-CKD) randomized controlled trial on the incidence of abrupt declines in kidney function. Kidney Int. 2022;101:174–84. doi: 10.1016/j.kint.2021.09.005. [DOI] [PubMed] [Google Scholar]
- 22.Magadmi R, Alfawaz D, Bakhshwin A, Binzomah Alghamdi F, Alfawaz SA, Bakhshwin DM, et al. Empagliflozin targeting STAT3/Akt/Nrf2 axis promoting diabetic wound healing in rat model. Front Pharmacol. 2025;16:1678552. doi: 10.3389/fphar.2025.1678552. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Gupta K, Bagang N, Singh G, Laddi L. Rat model of isoproterenol-induced myocardial injury. Methods Mol Biol. 2024;2803:123–36. doi: 10.1007/978-1-0716-3846-0_9. [DOI] [PubMed] [Google Scholar]
- 24.Obeidat HM, Althunibat OY, Alfwuaires MA, Aladaileh SH, Algefare AI, Almuqati AF, et al. Cardioprotective effect of taxifolin against isoproterenol-induced cardiac injury through decreasing oxidative stress, inflammation, and cell death, and activating Nrf2/HO-1 in mice. Biomolecules. 2022;12:1546. doi: 10.3390/biom12111546. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Bader Eddin L, Nagoor Meeran MF, Kumar Jha N, Goyal SN, Ojha S. Isoproterenol mechanisms in inducing myocardial fibrosis and its application as an experimental model for the evaluation of therapeutic potential of phytochemicals and pharmaceuticals. Animal Model Exp Med. 2025;8:67–91. doi: 10.1002/ame2.12496. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Khalifa AA, Rashad RM, El-Hadidy WF. Thymoquinone protects against cardiac mitochondrial DNA loss, oxidative stress, inflammation and apoptosis in isoproterenol-induced myocardial infarction in rats. Heliyon. 2021;7:e07561. doi: 10.1016/j.heliyon.2021.e07561. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Yang Z, Li T, Xian J, Chen J, Huang Y, Zhang Q, et al. SGLT2 inhibitor dapagliflozin attenuates cardiac fibrosis and inflammation by reverting the HIF-2α signaling pathway in arrhythmogenic cardiomyopathy. FASEB J. 2022;36:e22410. doi: 10.1096/fj.202200243R. [DOI] [PubMed] [Google Scholar]
- 28.Tsai KL, Hsieh PL, Chou WC, Cheng HC, Huang YT, Chan SH. Dapagliflozin attenuates hypoxia/reoxygenation-caused cardiac dysfunction and oxidative damage through modulation of AMPK. Cell Biosci. 2021;11:44. doi: 10.1186/s13578-021-00547-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Xiong SX, Huang LJ, Liu HS, Zhang XX, Li M, Cui YB, et al. Dapagliflozin exerts anti-apoptotic effects by mitigating macrophage polarization via modulation of the phosphoinositide 3-kinase/protein kinase B signaling pathway. World J Diabetes. 2025;16:97287. doi: 10.4239/wjd.v16.i2.97287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Packer M. Role of deranged energy deprivation signaling in the pathogenesis of cardiac and renal disease in states of perceived nutrient overabundance. Circulation. 2020;141:2095–105. doi: 10.1161/CIRCULATIONAHA.119.045561. [DOI] [PubMed] [Google Scholar]
