HIV-1 Vpr is targeted for degradation by autophagy

Yuexuan Chen; Susanne Klute; Anju Bansal; Konstantin Maria Johannes Sparrer; Ruth Serra-Moreno

doi:10.1371/journal.ppat.1014020

. 2026 Mar 2;22(3):e1014020. doi: 10.1371/journal.ppat.1014020

HIV-1 Vpr is targeted for degradation by autophagy

Yuexuan Chen ¹, Susanne Klute ², Anju Bansal ³, Konstantin Maria Johannes Sparrer ^2,⁴, Ruth Serra-Moreno ^1,^*

Editor: Edward M Campbell⁵

PMCID: PMC12970978 PMID: 41770818

Abstract

Autophagy is part of the innate immune arsenal to fight viruses, including HIV-1. We previously reported that HIV-1 Gag is targeted for autophagy-mediated degradation. Here, we identify HIV-1 Vpr, an important virulence factor, as an autophagy target in HIV-1 NL4–3, a lab adapted molecular clone. Notably, Vpr proteins from a collection of transmitted/founder viruses (TFVs) were resistant to autophagy. Based on this observation, we identified residues at positions 37, 45, 77, 83–86, 93–94 in NL4–3 Vpr as responsible for its susceptibility to autophagy. Importantly, differences between NL4–3 and TFV Vpr proteins at these positions impact their interaction with the autophagy receptors NDP52, SQSTM1/p62 and TAX1BP1. By engineering NL4–3 molecular clones harboring either autophagy-sensitive or -resistant vpr, we found that in 2D and 3D in vitro systems virus spread was significantly reduced for the virus carrying autophagy-sensitive Vpr. In conclusion, our study identifies Vpr as a novel autophagy target and suggests that Vpr susceptibility to autophagy impacts HIV-1 spread.

Author summary

Autophagy is a cellular process essential for homeostasis, but also serves as a potent defense mechanism against intracellular pathogens, including viruses. We previously reported that the HIV-1 structural protein Gag (precursor of the virus capsid) is targeted by autophagy for elimination. However, the virus has evolved the accessory protein Nef to antagonize autophagy. In this study, we identify the HIV-1 accessory protein Vpr as another autophagy target and uncovered the autophagy receptors SQSTM1, TAX1BP1 and NDP52 as responsible for targeting Vpr to autophagosomes. Remarkably, we found that Vpr proteins of transmitted/founder viruses are resistant to autophagy, suggesting that autophagy resistance of Vpr might promote virus spread.

Introduction

Macroautophagy (hereafter autophagy) is a highly conserved cellular process that mediates the elimination of malfunctioning organelles and misfolded proteins for quality control [1–5]. In addition to this role, autophagy is activated in response to stress, such as starvation, which results in the concerted degradation of cellular components to provide an alternative source of energy and nutrients [6,7]. During autophagy, specific cargo is targeted to double membrane vesicles called autophagosomes [8], and is subsequently degraded after fusion between autophagosomes and lysosomes [1,2,8–14].

Successful completion of autophagy requires the progression through three stages: initiation, elongation and maturation. In the initiation stage, several triggers like stress, the presence of compounds that inactivate the mammalian target of Rapamycin (mTOR), or a deficit in amino acids, initiate a phosphorylation cascade that culminates in the activation of the class III phosphatidylinositol 3 kinase (PtdIns3K) complex I, a multimolecular kinase that generates phosphatidylinositol 3 phosphate (PtdIns3P) [10,13,15–19]. PtdIns3P is essential for the nucleation and isolation of a membranous structure called phagophore, which will later become the autophagosome. PtdIns3P on the phagophore membrane facilitates this process by recruiting other autophagy elements, including an E3-like complex that mediates the lipidation of MAP1LC3B/LC3B (hereafter LC3) [1,8,9,11,13,19]. Non-lipidated LC3, or LC3-I, is a cytosolic protein. However, upon autophagy activation, LC3-I is lipidated through the attachment of phosphatidylethanolamine (PE), which converts LC3-I into LC3-II. Due to its lipidation, LC3-II inserts into both the internal and external membrane of the phagophore, which aides in its elongation and closure. The elongation stage of autophagy culminates with the formation of a double membrane vesicle: the autophagosome [1,2,8,9,20,21]. In addition to its role in autophagosome elongation, LC3-II serves as a hub for autophagy receptors carrying cargo (i.e., NDP52, SQSTM1/p62, TAX1BP1 among others). Specifically, autophagy receptors harbor an LC3-interacting region (LIR) that facilitates their direct interaction with LC3-II, allowing for their cargo to be engulfed into autophagosomes [12,14,22,23]. Finally, in the maturation step the autophagosome fuses with a lysosome, creating the so-called autolysosome. Here, the class III PtdIns3K complex II plays an essential role. Like class III PtdIns3K complex I, class III PtdIns3K complex II produces PtdIns3P. However, complex II differs from complex I in its subunit composition, so its function is specific for autophagy maturation rather than phagophore isolation. In the maturation step, PtdIns3P allows the recruitment of autophagy factors that facilitate the fusion between the autophagosome and the lysosome [1,2,8,24–26]. Due to the acidic pH and the action of specialized lysosomal proteases, cargo, autophagy receptors and LC3-II on the internal membrane of the autolysosome are degraded. Since the steady-state levels of these autophagy proteins (SQSTM1, LC3-I and LC3-II) fluctuate as autophagy progresses, measuring their relative abundance is a widely used method to assess autophagy status or flux [27].

In addition to its role in quality control and cellular homeostasis, autophagy has emerged as an important mechanism of defense against intracellular pathogens like viruses [28–30]. Both virions and viral components needed for replication can be targeted for autophagic elimination, attenuating in turn virus propagation. In consequence, many viruses have evolved sophisticated strategies to counteract the autophagic process [31,32]. Other viruses, however, have evolved to evade or even exploit elements of this pathway to support their propagation [29–31,33,34]. In fact, for some viruses like Human Immunodeficiency Virus (HIV), opposing reports indicate that autophagy exerts both antiviral and proviral actions [35–42]. As an example, HIV-1 has been reported to induce autophagy to facilitate uncoating, and the HIV-mediated activation of autophagy in macrophages has been associated with increased viral yields [35,36]. By contrast, we and others have shown that autophagy restricts HIV-1 replication [39,43,44] and that the virus has evolved mechanisms to downregulate this pathway [35,37,38,40,44,45]. Although several virus proteins have been found to inhibit autophagy, there seems to be consensus that HIV-1 Nef is the key autophagy antagonist acting via at least three different mechanisms [35,38,44]. First, Nef blocks autophagy initiation by promoting the sequestration of BECN1/Beclin1 away from the class III PtdIns3K complex I, inhibiting phagophore nucleation [44]. Second, Nef inhibits autophagy maturation by targeting BECN1 associated with class III PtdIns3K complex II [35,46], via mimicking the inhibitory actions of RUBCN/Rubicon to disable this kinase [40]. Third, Nef reduces the levels of autophagy proteins by impeding the nuclear translocation of TFEB (transcription factor EB), a transcription factor that regulates several autophagy-related genes [38]. Collectively, these studies suggest that suppressing autophagy is important for HIV-1 replication. However, the underlying molecular reasons why autophagy is detrimental for the virus are not completely understood. While HIV-1 Tat, a transcriptional transactivator, has been reported to be an autophagy target [47], and we previously reported that HIV-1 Gag is susceptible to autophagy-mediated degradation [43,44], the impact of autophagy on other viral elements remains unclear. In the current study, we sought to investigate whether other HIV-1 proteins were also sensitive to autophagy. Here, we found that mTOR inhibition reduces the levels of the HIV-1 NL4–3 accessory proteins Vif and Vpr, particularly in nef-deleted viruses, which are unable to counteract autophagy. We further showed that while the mTOR-dependent downregulation of Vif is caused by increased proteasomal function, Vpr is a bona fide autophagy target. However, when we examined the susceptibility of Vpr proteins from a collection of transmitted/founder viruses (TFVs), we found them to be resistant to autophagy, suggesting that Vpr resistance to autophagy might provide a fitness advantage. In fact, by engineering NL4–3-based recombinant viruses harboring either autophagy-sensitive or autophagy-resistant vpr, we uncovered that, when using 2D and 3D in vitro models, HIV-1 infection and spread were significantly reduced for viruses harboring autophagy-sensitive Vpr. Therefore, our findings identify Vpr as a novel autophagy target and reveal that transmitted/founder viruses encode autophagy resistant Vpr, which might promote virus spread.

Results

mTOR inhibition causes a reduction in HIV-1 NL4–3 Gag, Vif, and Vpr

Our previous study showed that treatment with Rapamycin, an mTOR inhibitor commonly used to induce autophagy, caused a significant defect in HIV-1 NL4–3 replication and virion production in many cell types, including primary CD4⁺ T cells, but the virus uses its accessory protein Nef to counteract this restriction [44]. These findings indicate that autophagy acts as an important barrier for HIV-1 replication. In a follow-up study, we revealed that this defect in virion production is caused by the autophagy-dependent clearance of HIV-1 Gag [43]. Gag is the major structural protein of the virus, it drives virion assembly, and it is also the precursor of the virus capsid protein, so degradation of Gag causes major defects in HIV-1 replication [48–52]. These observations prompted us to analyze the effect of autophagy on other HIV-1 proteins. For this, we infected Jurkat CD4⁺ T cells with lab adapted HIV-1 NL4–3 or NL4–3 Δnef in the presence of increasing amounts of Rapamycin, using a range of concentrations that we have already validated triggers autophagy without impacting cell viability (1.3-13 μM) [43,44]. Eighteen hours later, the levels of HIV-1 proteins were measured by western blot and quantified by densitometry analyses. Their expression was normalized to ACTB/β-actin and their levels relative to the DMSO treatment (D on the x axis) were calculated. Whereas Rapamycin had no major impact on HIV-1 proteins for the nef-competent virus, Gag, Vpr and Vif were reduced in a dose-dependent manner in the absence of Nef (Fig 1A-1C, red arrows). Consistent with our previous study showing that Nef inhibits LC3-I-to-LC3-II conversion [43,44], autophagy progression was impaired in cells infected with the nef-competent virus. Rather than the expected decrease in LC3-I with its corresponding increase in LC3-II (hallmark for autophagy activation), an accumulation of LC3-I was detected, despite increasing amounts of Rapamycin, which reflects an impairment in the lipidation of LC3 (Fig 1C, left blots). However, in cells infected with the nef-defective virus, autophagy proceeded as expected: with a dose-dependent accumulation of LC3-II and an associated reduction in LC3-I (Fig 1C, right blots). Similar observations were obtained in primary CD4⁺ T cells. However, unlike in the Jurkat cells, Nef’s ability to inhibit autophagy was more limited. This is in line with previous reports showing that upon cellular activation, primary CD4⁺ T cells exhibit greater autophagy flux at steady state than T cell lines like Jurkat cells [43,44,53–56]. Thus, additional autophagy induction by Rapamycin overwhelms Nef’s ability to counteract autophagy (Fig 1C and 1F, compare LC3 blots). Also, because of their inherently high autophagy activation at steady state, Rapamycin treatment of primary cells often does not lead to a striking increase in LC3-I-to-LC3-II conversion, yet its effect on autophagy targets remains apparent [54]. In fact, Rapamycin caused a dose-dependent reduction in Gag, Vif and Vpr, which was more prominent in cells infected with NL4–3 Δnef (Fig 1D-1F). Overall, these results suggest that besides Gag, the HIV-1 accessory proteins Vif and Vpr are also downregulated when mTOR is inhibited by Rapamycin, but Nef rescues their levels.

Fig 1 — The effect of mTOR inhibition by Rapamycin on HIV-1 was examined in Jurkat CD4⁺ T cells (**A-C**) and primary CD4⁺ T cells (**D-F**) for NL4-3 and NL4-3 Δ*nef*. The levels of HIV-1 proteins were measured by densitometry assays for NL4-3 (A and D) and NL4-3 Δ*nef* (B and E) infected cells. Protein levels were normalized to ACTB/β-actin, and their expression relative to the DMSO treatment (D on the x axis) was calculated. Data correspond to the mean and the SEM of 3 independent experiments. Dotted lines represent 2-fold threshold. Representative western blots from infections in Jurkat CD4⁺ T (C) and primary CD4⁺ T cells (F). Membranes were probed for gp120, Gag/p55, Vif, Nef, Vpr, Vpu and LC3. ACTB was used as a loading control. Red arrows indicate defects in HIV-1 proteins.

HIV-1 NL4–3 Vif downregulation by mTOR-mediated inhibition is due to increased proteasomal function

To understand the interplay between Vif and autophagy, we first examined whether Vif expression impacts autophagy flux. For this, and to eliminate any potential confounding effects caused by interactions of other HIV-1 genes with autophagy (i.e., nef), we used a plasmid encoding for Vif (Flag-Vif) to transfect HEK293T cells, a cell line that we previously demonstrated recapitulates the antagonistic phenotype of autophagy in HIV-1 infection observed in primary CD4⁺ T cells [43,44]. HEK293T cells were transfected with either an empty vector or the Flag-Vif construct. Forty-four hours later, cells were treated with increasing concentrations of Torin2, another mTOR inhibitor [57], in the presence or absence of BafilomycinA1 (BafA1) for 4 hours. BafA1 is a lysosomal inhibitor commonly used to measure autophagy flux [8,58], which was quantified by the LC3-II/I and SQSTM1 levels relative to the vector-transfected and DMSO-treated cells. No differences in the LC3-II/I and SQSTM1 ratios were observed between Vif-expressing and vector-transfected cells, even under conditions of BafA1 treatment, confirming that Vif does not impact autophagy turnover (Fig 2A).

Fig 2 — **(A)** HEK293T cells were transfected with 2,000 ng of an empty vector (V) or a NL4-3 Flag-Vif construct. 44 h later, cells were treated with Torin2 (5-10 nM) with or without BafA1 (500 nM) for 4 h. Next, cells were harvested, analyzed by western blot, and autophagy flux was measured by determining the LC3-II/I ratios and SQSTM1 levels relative to the vector-transfected and DMSO-treated cells. Data correspond to the mean and the SEM of 4 independent experiments. Blots are representative of 3 independent experiments. **(B)** Parental (wild type; WT) and *ATG5*KO HEK293T cells were transfected with 2,000 ng of a NL4-3 Flag-Vif construct. 44 h later, cells were treated with DMSO or increasing concentrations of Rapamycin (1.3-6 μM) or Torin2 (2.5-10 nM) at two-fold increments. 4 h later, cells were harvested for their analysis by western blotting. Blots are representative of 3 independent experiments confirming ATG5 depletion and its effects on SQSTM1 levels, the lipidation of LC3 as well as on Flag-Vif. ACTB was included as a loading control. **(C)** The LC3-II/I ratios, the SQSTM1 and Vif levels across the Rapamycin treatment range relative to DMSO were determined by densitometry analyses of western blots from 3 independent assays. SQSTM1 and Vif levels were normalized over ACTB prior to normalization to DMSO. Data represent the mean and the SEM of 3 independent experiments. Dotted lines represent 2-fold threshold. **(D)** The LC3-II/LC3-I ratios, the SQSTM1 and Vif levels across the Torin2 treatment range relative to DMSO were determined by densitometry analyses of western blots from 3 independent assays. Data represent the mean and the SEM of 3 independent experiments. Dotted lines represent 2-fold threshold. **(E)** *ATG5*KO HEK293T cells were transfected with NL4-3 Flag-Vif. 44 h later, cells were treated with DMSO, Torin2 (2.5 nM), Torin2 (2.5 nM) with Chloroquine (60 μM), or Torin2 (2.5 nM) with MG132 (20 μM) for 4 h. Cells were then harvested for their analysis by western blot for Flag-Vif, LC3, ATG5 and SQSTM1. ACTB was included as a loading control. Blots are representative of 3 independent experiments.

Next, to examine whether Vif is a genuine autophagy target, the implication of other pathways modulated by mTOR needed to be ruled out. This is relevant as mTOR inhibition not only induces autophagy but also proteasomal and lysosomal function [59–62]. Therefore, we generated ATG5 knockout cells. ATG5 was selected because it is a critical factor for autophagy progression, particularly important for the transition of LC3-I into LC3-II and is necessary for autophagosome biogenesis [63,64]. ATG5 knockout was verified by western blot from pooled cells, showing low or undetectable levels of the protein, a defect in the emergence of LC3-II, and, despite the presence of mTOR inhibitors, the accumulation of the autophagy cargo receptor SQSTM1 (Fig 2B-2D), which are all a consequence of deleting ATG5 and impairing autophagy [65,66]. Besides Rapamycin, we also included Torin2 to validate our findings. Next, parental (wild type; WT) and ATG5KO HEK293T cells were transfected with the Flag-Vif construct. Forty-four hours later, cells were treated with either DMSO, Rapamycin or Torin2 for 4 hours before harvesting them for analysis. As expected, both Rapamycin and Torin2 caused the transition from LC3-I to LC3-II in WT cells. However, at their highest concentrations we frequently observed a reduction in LC3-II, which was often accompanied by a decrease in SQSTM1, indicating that at these concentrations, autophagy culminated in maturation, which causes degradation of LC3-II and autophagy receptors (i.e., SQSTM1) (Fig 2B-2D). By contrast, these effects of Rapamycin and Torin2 were not observed in ATG5KO cells, as LC3-II/I ratios and SQSTM1 levels did not fluctuate across the assay (Fig 2B-2D), confirming that autophagy is impaired in ATG5KO cells. Remarkably, Rapamycin and Torin2 treatments caused a dose-dependent reduction of Vif regardless of ATG5 expression (Fig 2B-2D), indicating that Vif downregulation is autophagy-independent. To elucidate how mTOR inhibition causes a reduction in Vif levels, subsequent experiments were performed in Torin2-treated and autophagy-deficient (ATG5KO) HEK293T cells in the presence of lysosomal (Chloroquine) or proteasomal (MG132) inhibitors. This assay revealed that proteasomal inhibition rescues Vif levels when mTOR is repressed (Fig 2E). Hence, these results confirm that Vif is not an autophagy target and that its proteasomal turnover is likely enhanced under conditions of mTOR repression.

HIV-1 NL4–3 Vpr is a bona fide autophagy target

Next, we studied the interplay between Vpr and autophagy by assessing the impact of Vpr on autophagy flux. HEK293T cells were transfected with an empty vector or a NL4–3 Vpr-myc construct. Forty-four hours later, cells were treated with increasing concentrations of Torin2 in the presence or absence of BafA1 for 4 hours. No significant differences were observed between vector and Vpr-expressing cells, particularly under BafA1 treatment, reflecting no major impact on autophagy flux. However, in cells expressing Vpr and treated only with Torin2 we noticed a trend (yet insignificant) towards increased flux, which is reflected in the turnover of LC3-II and SQSTM1 (Fig 3A), suggesting that Vpr might induce autophagy. Importantly, Vpr levels were restored in cells treated with BafA1, indicating that either autophagy or lysosomal activity drive the degradation of Vpr (Fig 3A, blots). To assess whether autophagy mediates its degradation, we transfected WT and ATG5KO HEK293T cells with the Vpr-myc construct and treated them with increasing concentrations of Rapamycin or Torin2. The effects of these mTOR inhibitors on LC3-II/I and SQSTM1 were quantified as in the Vif experiments for both WT and ATG5KO cells (Fig 3B-3D). Both Rapamycin and Torin2 treatments caused a dose-dependent downregulation of Vpr in WT cells. In contrast, Vpr levels were restored in the ATG5KO cells (Fig 3B-3D), supporting the notion that Vpr is an autophagy target.

Fig 3 — **(A)** HEK293T cells were transfected with 2,000 ng of an empty vector (V) or a NL4-3 Vpr-myc construct. 44 h later, cells were treated with Torin2 (5-10 nM) with or without BafA1 (500 nM) for 4 h. Next, cells were harvested, analyzed by western blot, and autophagy flux was measured by determining the LC3-II/I ratios and SQSTM1 levels relative to the vector-transfected and DMSO-treated cells. Data represent the mean and the SEM of 3 independent experiments. Blots are representative of 3 independent experiments. **(B)** Parental (WT) and *ATG5*KO HEK293T cells were transfected with 2,000 ng of a NL4-3 Vpr-myc construct. 44 h later, cells were treated with DMSO or increasing concentrations of Rapamycin (1.3-6 μM) or Torin2 (2.5-10 nM) at two-fold increments. 4 h later, cells were harvested for their analysis by western blotting. Blots are representative of 3 independent experiments from parental and *ATG5*KO cells confirming ATG5 depletion and its effects on SQSTM1 levels and the lipidation of LC3 as well as its impact on Vpr-myc. ACTB was included as a loading control. **(C, D)** Vpr and SQSTM1 levels were normalized to ACTB and their expression relative to DMSO (D on the x axis) was calculated. LC3-II and LC3-I levels were determined and provided as the LC3-II/I ratio relative to DMSO. Data represent the mean and the SEM of 3 independent experiments. Dotted lines represent 2-fold threshold.

The role of autophagy in the degradation of Vpr was corroborated in primary CD4⁺ T cells infected with NL4–3 Δnef and treated with increasing amounts of Torin2 in the presence of either DMSO or VPS34IN, an autophagy inhibitor that targets the VPS34 subunit in both class III PtdIns3K complex I (autophagy initiation) and class III PtdIns3K complex II (autophagy maturation) [67]. The effect of VPS34IN on autophagy flux was confirmed by western blot, where a delay in LC3-I-to-LC3-II transition was observed as well as an accumulation of LC3-II and SQSTM1 (Fig 4A and 4B). In line with the effect of Rapamycin on Vpr in primary cells (Fig 1E), Torin2 also caused the downregulation of Vpr in DMSO-treated primary CD4⁺ T cells. However, Vpr levels were rescued in the presence of VPS34IN (Fig 4A and 4B). To confirm that Vpr is targeted to autophagosomes, its subcellular distribution was examined by fluorescence microscopy in HEK293T cells constitutively expressing EGFP-LC3B and treated with Torin2 to induce autophagy. As endogenous LC3-I, EGFP-LC3-I also displays a dispersed cytosolic distribution. However, when converted into EGFP-LC3-II, its association with autophagosomes forms a characteristic puncta distribution in the cytosol [8,43,44,68] (Fig 5A). Consistent with a role for autophagy in targeting Vpr for elimination, extensive overlap between Vpr and LC3 puncta was observed (Fig 5A), indicating that Vpr is present in autophagosomes. Since we and others have previously reported that Nef blocks autophagy [35,38,40,44], we assessed whether providing Nef in trans could rescue Vpr levels. For this, we co-transfected HEK293T cells with the NL4–3 Vpr-myc construct and increasing concentrations of a plasmid encoding for NL4–3 Nef-HA in the presence of incremental doses of Torin2. In line with its role as an autophagy antagonist, Nef rescued Vpr expression in a dose-dependent manner (Fig 5B and 5C). Accordingly, Nef displaced Vpr from LC3 puncta, causing a significant reduction in the Pearson’s correlation coefficient (R) for the co-localization of Vpr with LC3 (Fig 5D). Overall, these findings confirm that Vpr is an autophagy target.

Fig 4 — **(A)** Primary CD4⁺ T cells were infected with NL4-3 Δ*nef* in the presence of DMSO or 10 μM VPS34IN. 18 h later, cells were treated with increasing amounts of Torin2 (2.5-20 nM) for 4 h. Cells were then harvested and analyzed by western blot for LC3, SQSTM1 and Vpr. ACTB was added as a loading control. Blots are representative of 3 independent experiments. **(B)** Vpr and SQSTM1 levels were normalized to ACTB and their expression relative to DMSO (D on the x axis) was calculated. LC3-II and LC3-I levels were determined and provided as the LC3-II/I ratio relative to DMSO. Data represent the mean and the SEM of 3 independent experiments. Dotted lines represent 2-fold threshold.

Fig 5 — **(A)** The subcellular distribution of Vpr relative to autophagosomes (LC3) was examined by fluorescence microscopy in HEK293T cells constitutively expressing EGFP-LC3B and treated with Torin2 (10 nM) 4 h before staining. Images are representative of 3 independent experiments. White scale bar: 10 μm. **(B)** HEK293T cells were co-transfected with 2,000 ng NL4-3 Vpr-myc and increasing amounts of a plasmid encoding NL4-3 Nef-HA (0-2,000 ng). 44 h later, DMSO or increasing concentrations of Torin2 (5-10 nM) were added. 4 h later, cells were harvested and analyzed by western blot. Membranes were probed for Vpr, Nef, LC3, and SQSTM1. ACTB was included as a loading control. Blots are representative of 3 independent experiments. **(C)** Vpr protein levels were measured by densitometry, normalized to ACTB and their expression relative to the DMSO and no Nef treatment was calculated. Data correspond to the mean and the SEM of 3 independent experiments. Dotted lines represent 2-fold threshold. **(D)** The degree of co-localization between Vpr and LC3 puncta was examined by fluorescence microscopy in HEK293T cells constitutively expressing EGFP-LC3B in the presence of Nef and treated with Torin2 (10 nM) 4 h before staining. Images are representative of 3 independent experiments. White scale bar: 10 μm. Graph: The Pearson’s correlation coefficient (R) for the co-localization of Vpr and EGFP-LC3B in the presence and absence of Nef was calculated from 17 randomly selected fields. Data correspond to the raw values, the mean and SEM. *: p < 0.05; **: p < 0.01; ****: p < 0.0001. ns: not significant.

Vpr proteins from ten HIV-1 group M transmitted/founder viruses are resistant to autophagy

Despite the high degree of variability within the pool of HIV-1 variants in an individual, only specific clones can establish an infection in a new person. These clones are referred to as transmitted/founder viruses (TFVs) [69]. Unlike other virus variants, TFVs can circumvent the transmission bottleneck due to their high resistance to innate immune barriers [69]. Since autophagy is considered an innate defense response, we investigated the susceptibility of Vpr proteins from different TFVs to autophagy. The following 10 HIV-1 group M TFV clones were tested: CH077, Z3567, CH106, Z1123, 3137M, N31F, CH042, CH198, A190184, and CH470 (Table 1). These clones were selected because their vpr sequences are fully annotated, allowing us to individually assess their sensitivity to autophagy. Their vpr genes were cloned into pcDNA5 harboring either a Myc, Flag or a 6xHis tag in their C-terminus. As for Fig 3, these constructs were transfected into HEK293T cells in the presence of increasing concentrations of Torin2, and the effect of autophagy on their expression levels was examined by western blot. Unlike NL4–3 Vpr, the Vpr proteins from all 10 HIV-1 TFVs were not impacted by autophagy induction, even at the highest concentration of Torin2 (Fig 6A and 6B). These observations were confirmed by fluorescence microscopy, showing poor co-localization between one of the TFV Vpr proteins (CH077) and LC3 puncta (Fig 6C). Collectively, these findings indicate that the Vpr proteins of these ten group M HIV-1 TFVs are resistant to autophagy.

Table 1. Group M HIV-1 transmitted/founder viruses used in this study.

TFV Clone	Subtype
A191084	A
CH042	C
CH077	B
CH106	B
CH198	C
CH470	B
N31F	C
Z1123M	C
Z3576F	C
3137M	C

Open in a new tab

Fig 6 — **(A)** HEK293T cells were transfected with 2,000 ng of constructs coding for the indicated Vpr proteins. 44 h later, either DMSO or Torin2 (at 5 and 10 nM) were added. 4 h later, cells were harvested and analyzed by western blotting. Membranes were probed for Vpr, LC3 and ACTB (as a loading control). Blots are representative of 3 independent experiments. **(B)** The levels of Vpr relative to the DMSO treatment (D on the x axis) were calculated by densitometry analyses after normalizing with ACTB. Data correspond to the mean and the SEM of 3 independent experiments. Dotted line represents 2-fold threshold. **(C)** The degree of co-localization between one of the TFV Vpr proteins (CH077) and LC3 puncta was examined by fluorescence microscopy in HEK293T cells constitutively expressing EGFP-LC3B and treated with Torin2 (10 nM) 4 h before staining. Images are representative of 3 independent experiments. White scale bar: 10 μm. Graph: The Pearson’s correlation coefficient (R) for the co-localization of CH077 Vpr and EGFP-LC3B was calculated from 25 randomly selected fields. Data correspond to the raw values, the mean and SEM.

Residues responsible for Vpr’s sensitivity to autophagy map to the second alpha-helix and the unstructured C-terminal tail

Vpr is conserved across HIV-1, HIV-2 and SIV (Simian Immunodeficiency Virus) [70–72]. However, the fact that the TFV Vpr proteins we tested here were resistant to autophagy suggests that any amino acid differences between TFV Vprs and NL4–3 Vpr account for their distinct susceptibility to autophagy. To identify the residue(s) in NL4–3 Vpr that are responsible for its autophagy sensitivity, we generated chimeras between NL4–3 Vpr and one of the TFV Vpr: CH077, as they both belong to subtype B (Table 1). By aligning both Vpr proteins, we noticed that most of their differences clustered either in the first half of the protein or in the last twenty amino acids (Fig 7A). Therefore, the two chimeras we generated consisted of NL4–3 Vpr with either the N-terminal half of CH077 (residues 1–45) or the last twenty amino acids of CH077 Vpr (residues 77–96). Because there is still one amino acid difference between NL4–3 and CH077 Vpr at position 61, which is not found at these N-terminal or C-terminal regions, an additional NL4–3 Vpr mutant was engineered in which the residue present in CH077 was introduced into NL4–3 Vpr (I₆₁T) (Fig 7B, left panel, red dots). These chimeras, the point mutant and wild type NL4–3 Vpr were engineered to harbor a Myc tag in their C-terminus. These constructs were transfected into HEK293T cells in the presence of increasing concentrations of Torin2. While the substitution introduced at position 61 did not render NL4–3 Vpr resistant to autophagy, Vpr proteins harboring either the N-terminus or C-terminus of CH077 Vpr became resistant to autophagy (Fig 7B, blots), indicating that determinants for autophagy susceptibility reside within the N-terminus and C-terminus of the protein, and that changes at either of these domains are sufficient to render the protein immune to autophagy. To narrow down the specific amino acids, we constructed additional mutants. Here, differences between NL4–3 and CH077 Vpr were clustered in smaller groups, and these amino acid group differences were individually introduced into NL4–3 Vpr (Fig 7C, left panel, red dots). Despite some variability in their susceptibility to Torin2, none of these mutants became fully resistant to autophagy (Figs 7C and S1 Fig), suggesting that resistance to autophagy is conferred by several clustered mutations. In view of these results, we generated new NL4–3 Vpr mutants in which these groups of amino acids were introduced in combination. We found that substitution of residues I₃₇ and H₄₅ by the corresponding amino acids in CH077 Vpr (P₃₇ and Y₄₅) rendered NL4–3 Vpr fully resistant to autophagy (Fig 7D), revealing these two residues in CH077 Vpr are sufficient to bypass autophagy restriction. A similar strategy was carried out to identify the amino acids within positions 77–96 in the C-terminal region of CH077 Vpr that confer resistance to autophagy. After generating multiple Vpr mutants with different combinations of amino acids within that region (S1 Fig), we found that all the residues that differ between NL4–3 and CH077 Vpr in their C-terminus are required to confer resistance to autophagy. Therefore, our results indicate that Q₇₇I₈₃I₈₄Q₈₅T₈₆S₉₃R₉₄ in CH077 Vpr are responsible for the resistance to autophagy of chimera II (Fig 7D). Next, we located positions 37, 45, 77, 83–86, 93 and 94 onto the NL4–3 Vpr NMR structure and found that residues 37 and 45 locate within the second alpha-helix while the rest cluster at the unstructured C-terminal tail (Fig 7E), potentially creating a pocket that might facilitate recognition by autophagy factors. Finally, we examined the subcellular distribution of a NL4–3 Vpr protein harboring mutations that render it resistant to autophagy (P₃₇Y₄₅) and found that the co-localization between this Vpr protein and LC3 puncta was drastically reduced (Fig 7F, white arrowhead shows area of co-localization), confirming that mutations P₃₇Y₄₅ are sufficient to render NL4–3 Vpr immune to autophagy.

Fig 7 — **(A)** Protein alignment of the Vpr proteins of the lab-adapted clone NL4-3 and the TFV clone CH077. Consensus sequence is shown underneath. Red squares indicate the residues that account for their different susceptibility to autophagy. **(B)** Left panel. Design of chimeras I and II and the I₆₁T point mutant. Red dots are representative of amino acids that differ between NL4-3 (green background) and CH077 (orange background). Right panel: HEK293T cells were transfected with the chimeras and point mutant. As a control, cells were transfected with NL4-3 Vpr-myc. The susceptibility of these Vpr proteins to increasing amounts of Torin2 (5-10 nM) was examined by western blot. DMSO was added as a control. Membranes were probed for Myc, LC3 and ACTB. Data are representative of 3 independent experiments. The Vpr levels were normalized to ACTB and their expression relative to DMSO was calculated. The mean values from the 3 replicates are provided underneath the blots. **(C-D)** Design of the subsequent Vpr mutants is shown in the left panels. The right panels show the susceptibility of these Vpr mutants to autophagy. The levels of Vpr-myc over ACTB relative to the DMSO treatment is shown underneath the blots. Data are representative of 3 independent experiments. **(E)** Different views of the NL4-3 Vpr NMR structure where positions 37, 45, 77, 83-86 and 93-94 are highlighted in red. NTD: N-terminal domain. CTD: C-terminal domain. **(F)** The degree of co-localization between the autophagy-resistant Vpr_P37Y45 mutant and LC3 puncta was examined by fluorescence microscopy in HEK293T cells constitutively expressing EGFP-LC3B and treated with Torin2 (10 nM) 4 h before staining. Images are representative of 3 independent experiments. White scale bar: 10 μm. White arrowhead shows area of co-localization. Graph: The Pearson’s correlation coefficient (R) for the co-localization of Vpr and EGFP-LC3B was calculated from 25 randomly selected fields. Data correspond to the raw values, the mean and SEM.

As mentioned earlier, Vpr is present in all primate lentiviruses with a high degree of conservation [70–72]. Hence, we were curious to know whether the substitutions at positions 37, 45, 77, 83–86, 93 and 94 in NL4–3 Vpr emerged as a result of lab adaptation. To assess this, we compared the Vpr sequences of other commonly used lab adapted HIV-1 molecular clones, namely HBX2, BaL and JR-FL, with that of NL4–3 Vpr. Although Vpr in BaL is shorter, for the most part, the sequences of these Vpr proteins preserved the residues present in NL4–3 Vpr at positions 37, 45, 77, 83–86, 93–94 (S2A Fig). There was only one exception, though, in JR-FL. Here, JR-FL Vpr harbored Y₄₅, Q₇₇ and I₈₃ (S2A Fig, red boxes), which are three of the substitutions present in CH077 Vpr that contribute to its resistance to autophagy – although on their own they are not sufficient to render NL4–3 Vpr insensitive to autophagy. In view of these data, we decided to examine the sequence variation at positions 37, 45, 77, 83–86, 93–94 in Vpr of primary HIV-1 isolates. For this, we analyzed 212 group M HIV-1 sequences of the HIV Sequence Database from the Los Alamos National Laboratory (LANL) [73] and found that the majority of these isolates share the CH077 residues at positions 37, 45, 77 and 83 in Vpr. However, most of these primary isolates share the NL4–3 residues at positions 93 and 94. Interestingly, a high percentage of these strains harbor amino acids that differ from CH077 and NL4–3 at positions 85 and 86 (S2B Fig). Because our mapping data indicates that P₃₇Y₄₅ are sufficient to render NL4–3 Vpr resistant to autophagy, it is tempting to speculate that, similar to most TFV Vprs tested here (S2C Fig), the majority of primary group M HIV-1 isolates harbor Vpr proteins with amino acid changes that would confer resistance to autophagy (i.e., P₃₇Y₄₅), while most lab adapted Vprs harbor residues at those sites that would render the protein susceptible to autophagy.

Amino acid changes between autophagy-sensitive and -resistant Vpr account for their differential binding to autophagy receptors

As indicated earlier, residues 37, 45, 77, 83–86, and 93–94 map to the second alpha-helix and the unstructured C-terminal tail of the NL4–3 Vpr NMR structure (Fig 7E). We hypothesize that changes at these locations might affect the overall protein conformation and its interactions with autophagy receptors. This idea was tested by investigating NL4–3 Vpr (hereafter Lab-Vpr) and CH077 Vpr (hereafter TFV-Vpr) for their ability to interact with different autophagy receptors, such as NBR1, NDP52, OPNT, SQSTM1, and TAX1BP1, [74–77]. BNIP3L was used as a negative control, since this is a mitophagy receptor that targets malfunctioning mitochondria for degradation and as such, it is not expected to interact with Vpr [78]. For this, HEK293T cells were transfected with constructs coding for either Lab-Vpr or TFV-Vpr. Forty-eight hours later, cells were harvested. A small aliquot of the lysates was set aside to assess input levels of these proteins. Of note, the migration pattern of Lab-Vpr and TFV-Vpr is slightly different likely due to harboring different tags in their C-terminus. The rest of the lysates were used to immunoprecipitate the above-mentioned autophagy receptors using specific antibodies (Table 2) and their pulldown fraction was analyzed by western blot using antibodies for each of these receptors plus Vpr. As controls, lysates for each of these transfections were incubated with Protein G magnetic beads (but no antibody) to rule out any unspecific binding of Vpr and/or autophagy factors with the beads. Additionally, the IgG antibodies used in the immunoprecipitations were incubated with Protein G magnetic beads but no cell extract to account for any bands corresponding to the heavy or light chains of the antibodies.

Table 2. Antibody sources and conditions.

Protein	Primary antibody	Dilution	Source
ACTB/β-actin	Mouse monoclonal (8H10D10C4) to ACTB/β-actin	1:1000	Cell Signaling, #3700S
ATG5	Rabbit polyclonal to ATG5	1:1000	Cell Signaling, #2630S
BNIP3L	Rabbit monoclonal (D4R4B) to BNIP3L	1:1000	Cell signaling, #12396
Flag	Rabbit monoclonal (D6W5B) to DYKDDDDK Mouse monoclonal (9A3) to DYKDDDDK	1:1000	Cell signaling, #14793 Cell signaling, #8146
HA	Rabbit monoclonal (C29F4) to HA-Tag	1:1000	Cell signaling, #3724
His	Mouse monoclonal (4D11) to His tag	1:1000 for WB, 1:200 for microscopy	Abcam, #ab5000
HIV gp120	Goat polyclonal to HIV-1 gp120	1:1000	Abcam, #ab21179
HIV Nef	Mouse monoclonal to HIV-1 Nef	1:1000	ThermoFisher Sci, #MA1–71505
HIV p24	Mouse monoclonal (183-H12-5C) to HIV-1 p24	1:1000	NIH-ARP, #ARP-3537
HIV Vif	Mouse monoclonal (319) to HIV-1 Vif	1:1000	Abcam, #ab66643
HIV Vpr	Rabbit polyclonal to HIV-1 Vpr	1:1000	ThermoFisher Sci, #51143–1-AP
HIV Vpu	Rabbit polyclonal to HIV-1 Vpu	1:1000	NIH-ARP, #ARP-969
LC3B	Rabbit polyclonal to LC3B	1:1000	Cell Signaling, #2775S
mCherry	Rabbit monoclonal (E5D8F) to mCherry	1:1000	Cell Signaling, #43590
Mouse IgG	Goat anti-mouse (H + L) secondary HRP	1:2000	ThermoFisher Sci, #31430
Mouse IgG ₁	Goat polyclonal (Alexa-568 conjugated)	1:500	ThermoFisher Sci, #A-21124
Mouse IgG ₁	Goat polyclonal (Alexa-488 conjugated)	1:500	ThermoFisher Sci, #A-21121
Mouse IgG _2a	Goat polyclonal (Alexa-488 conjugated)	1:500	ThermoFisher Sci, #A-21131
Mouse IgG _2a	Goat polyclonal (Alexa-568 conjugated)	1:500	ThermoFisher Sci, #A-21134
Myc	Mouse monoclonal (9B11) to Myc tag	1:1000 for WB, 1:100 for microscopy	Cell signaling, #2276
NBR1	Rabbit monoclonal (E6Q3F) to NBR1	1:1000	Cell signaling, #20145S
NDP52	Rabbit polyclonal to NDP52	1:1000 for WB, 1:100 for microscopy	Abcam, #ab68588
Optineurin (OPNT)	Rabbit monoclonal (E4P8C) to Optineurin	1:1000	Cell signaling, #70928
Rabbit IgG	Goat polyclonal (Alexa-488 conjugated)	1:500	ThermoFisher Sci, #A-11008
Rabbit IgG	Goat polyclonal (Alexa-568 conjugated)	1:500	ThermoFisher Sci, #A-11011
SQSTM1/p62	Mouse monoclonal (2C11) to SQSTM1/p62 Rabbit monoclonal (D1Q5S) to SQSTM1/p62	1:1000 for WB, 1:100 for microscopy	Abcam, #ab56416 Cell signaling, #39749
TAX1BP1	Rabbit monoclonal (D1D5) to TAX1 BP1	1:1000 for WB, 1:100 for microscopy	Cell signaling, #5105
Ubiquitin	Rabbit monoclonal (4B10B2) to Ubiquitin	1:1000	Cell signaling, #43124S

Open in a new tab

As expected, neither Lab-Vpr nor TFV-Vpr were found in the pulldown fraction of BNIP3L (Fig 8A). Additionally, no binding between these Vpr proteins and the receptors OPNT and NBR1 was detected either (Fig 8B and 8C). By contrast, Lab-Vpr but not TFV-Vpr was found in association with SQSTM1 and TAX1BP1 (Fig 8D and 8E). Mixed results were obtained, however, with the NDP52 receptor, where Lab-Vpr was detected in its pulldown fraction ~50% of the time (Fig 8F, representative blots for positive and negative interaction). To confirm the relevance of these autophagy receptors in recruiting Lab-Vpr to autophagosomes, SQSTM1 + TAX1BP1 double knockout as well as SQSTM1 + TAX1BP1+NDP52 triple knockout HEK293T cells were engineered by CRISPR/Cas9. While Lab-Vpr levels were noticeably rescued in the SQSTM1^KO+TAX1BP1^KO cells, its expression levels were fully restored in the SQSTM1^KO+TAX1BP1^KO+NDP52^KO cells (Fig 8G), supporting that these three autophagy receptors participate in the degradation of Vpr. These observations were corroborated by immunofluorescence microscopy, with noticeably more overlap between Lab-Vpr and these autophagy receptors than TFV-Vpr, which was confirmed by determining the Pearson’s correlation coefficient (R) for the co-localization between each Vpr protein and these autophagy factors (Fig 9, white arrowheads indicate areas of co-localization). These findings suggest that Vpr recognition by NDP52, SQSTM1 and TAX1BP1 contributes to its susceptibility to autophagy elimination, and that amino acid differences between Lab-Vpr and TFV-Vpr account for their differential interactions with these autophagy receptors.

Fig 9 — HEK293T cells were transfected with 2,000 ng of either Lab-Vpr (A) or TFV-Vpr **(B)**. 44 h later, cells were treated with Torin2 (10 nM) for 4 h. Next, cells were analyzed by immunofluorescence for the subcellular distribution of Vpr (green) relative to SQSTM1, TAX1BP1 and NDP52 (red). Hoechst was used to stain the nuclei (blue). White scale bar: 10 μm. White arrowheads indicate co-localization between Vpr and the selected autophagy markers. Images are representative of 3 independent experiments. Graphs: The Pearson’s correlation coefficient (R) for the co-localization of Vpr and these receptors was calculated from 8 randomly selected fields. Data correspond to the raw values, their mean and SEM.

Role of ubiquitination in targeting Vpr to autophagosomes

In mammals, the most prevalent autophagy-targeting signal for cargo is the presence of ubiquitin chains [79]. Many autophagy receptors bind to ubiquitin on their cargo by means of a ubiquitin-binding domain, so their dual interaction with cargo and LC3 allows to recruit molecules to autophagosomes. Classic examples of this are NDP52, SQSTM1 and TAX1BP1 [74,75,77]. Because these three receptors bind and co-localize with Lab-Vpr, but not TFV-Vpr, we reasoned that ubiquitination of Lab-Vpr might be an important signal for its recruitment to autophagosomes. To test this, we used TAK-243, a small molecule inhibitor of ubiquitination [80]. Specifically, TAK-243 acts by blocking the E1 ubiquitin-activating enzymes by binding to free ubiquitin to form a TAK-243-ubiquitin adduct, thereby, restricting the amount of ubiquitin available for ubiquitination [80]. HEK293T cells were transfected with Lab-Vpr. Twenty-four hours later, cells were treated with either DMSO, as a negative control, or TAK-243. One day later, cells were incubated with increasing amounts of Torin2 for 4 hours before cells were harvested. Compared to the DMSO-treated cells, TAK-243 restored Lab-Vpr levels, even at the highest concentration of Torin2 (Fig 10A), which suggests that Vpr ubiquitination is necessary to target it for autophagy degradation. However, when we analyzed the lysates for autophagy status – by looking at the relative abundance of LC3-II over LC3-I – we realized that TAK-243 affected LC3 lipidation, since there was a strong accumulation of LC3-I, which in turn affected the LC3-II/I ratios (Fig 10A). Therefore, to better assess if Vpr ubiquitination causes its autophagy-mediated degradation, we introduced an amino acid substitution at the single Lysine residue in Vpr – which has remained conserved across primate lentiviruses [81] – as Lysine amino acids are common targets for ubiquitination [82]. Introduction of Alanine or Arginine substitutions at this location were not tolerated, as Vpr levels were undetectable for these mutants. Hence, we replaced this Lysine by a Methionine, which does not affect Vpr expression, as reported by others [81]. However, this mutant was still susceptible to autophagy elimination upon Torin2 treatment (Fig 10B). We then performed a ubiquitination assay where we compared the ubiquitin levels between Lab-Vpr and TFV-Vpr immunoprecipitated from HEK293T cells, as we have done in the past for other ubiquitinated substrates [43,83]. As expected for ubiquitinated proteins, a smear spanning from the top of the membrane was detected for Lab-Vpr. However, a similarly intense smear was also observed for TFV-Vpr (Fig 10C), indicating that the ubiquitination patterns of these two proteins are similar. Importantly, the ubiquitin smear for both Lab-Vpr and TFV-Vpr was only minimally above the background smear detected in the IgG control, suggesting that Vpr may not be ubiquitinated or, even if it is, its ubiquitination levels are very low.

Fig 10 — **(A)** HEK293T cells were transfected with 2,000 ng of Lab-Vpr. 24 h later, DMSO or TAK-243 (200 nM) was added. 44 h later, cells were treated with increasing amounts of Torin2 (5-10 nM). 4 h later, cells were harvested and analyzed by western blot. Membranes were probed for Myc, LC3 and ACTB. The LC3-II/I ratio as well as the Vpr levels relative to DMSO (D on the x axis) are provided over the Torin2 treatment range for both DMSO- and TAK-243-treated cells. Dotted line represents 2-fold threshold. Data correspond to the mean and the SEM of 3 independent experiments. **(B)** HEK293T cells were transfected with Lab-Vpr or the Lab-Vpr K₂₇M mutant. 44 h later, cells were treated with DMSO or Torin2 (10 nM). 4 h later, cells were processed for western blot analyses as in panel A. Blots are representative of 3 independent experiments. **(C)** HEK293T cells were transfected with either Lab-Vpr or TFV-Vpr. 48 h later, cells were harvested, and lysates were immunoprecipitated (IP) for Vpr. The IP samples were analyzed by western blot by probing membranes for ubiquitin and Vpr. The whole cell lysates were analyzed for Vpr and ACTB. Blots are representative of 3 independent experiments. **(D)** Diagram of SQSTM1 and truncation mutants. **(E)** HEK293T cells were co-transfected with Lab-Vpr and the mCherry-SQSTM1 constructs. 48 h later, cells were harvested, and lysates were immunoprecipitated (IP) for Vpr. The IP samples were analyzed by western blot by probing membranes for mCherry and Myc. The whole cell lysates were analyzed for mCherry, Vpr-myc and ACTB. Blots are representative of 3 independent experiments. **(F)** HEK293T cells were co-transfected with Lab-Vpr and the SQSTM1 constructs shown in panel D. 44 h later, cells were treated with Torin2 (10 nM) for 4 h and were subsequently stained for the SQSTM1 constructs (mCherry, red), Vpr (green), and the nuclei (blue). White scale bar: 10 μm. Images are representative of 3 independent experiments.

We next used an indirect approach to examine whether ubiquitination of Lab-Vpr is necessary to route the protein to autophagosomes. For this, we performed co-immunoprecipitations with SQSTM1 mutants where motifs important for ubiquitin binding were truncated. Specifically, we co-transfected HEK293T cells with Lab-Vpr and either wild type (WT) SQSTM1, a SQSTM1 construct lacking the N-terminal PB1 domain (ΔPB1) that allows SQSTM1 oligomerization – which enhances its association with ubiquitinated substrates [84] – and a SQSTM1 mutant lacking the C-terminal ubiquitin-binding domain (ΔUBA) necessary to interact with ubiquitinated cargo [85,86] (Fig 10D). Remarkably, all SQSTM1 constructs were still detected in the Lab-Vpr pulldown fraction (Fig 10E), and Vpr was found co-localizing with all these SQSTM1 mutants (Fig 10F). Collectively, our assays indicate that the Vpr-SQSTM1 binding is ubiquitin-independent, but the role of ubiquitination in targeting Lab-Vpr to autophagosomes still remains unclear.

Autophagy-resistant Vpr proteins confer an advantage in virus spread in an in vitro setting

Because the Vpr proteins of the ten different group M TFVs were resistant to autophagy, we theorize that resistance to autophagy by Vpr might provide an advantage in HIV-1 infection and/or spread. To investigate this, we assessed cell-free as well as total (cell-free plus cell-to-cell) infection using three HIV-1 NL4–3-based clones: the wild type, encoding for NL4–3 Vpr (autophagy-susceptible, or Vpr_Lab), a NL4–3 clone harboring the Vpr mutations P₃₇Y₄₅, which render Lab-Vpr resistant to autophagy (Vpr_mut), and another NL4–3 clone encoding for the TFV CH077 Vpr (autophagy-resistant, or Vpr_TFV). We also generated variants of these three viruses carrying mutations in Nef at residues 48–49, which render the protein unable to counteract autophagy (Nef_mut) [43]. All viral clones were engineered to harbor mCherry-furin-P2A-T2A in the nef reading frame, so we could track infection, while allowing the expression of all the NL4–3 genes at comparable levels (S3 Fig). This is important, as Nef in the original CH077 molecular clone is barely detected (S3 Fig, white arrowhead). This low Nef signal in the CH077 virus is likely due to using an antibody raised against NL4–3 Nef, as CH077 and NL4–3 Nef only share 20% similarity. Additionally, CH077 harbors substitutions in other genes, which could also impact viral infectivity and spread. Therefore, comparing the impact of Vpr susceptibility to autophagy on infection by using the original molecular clones NL4–3 and CH077 would have complicated data interpretation due to all these differences.

For these in vitro infection assays, Jurkat LTR-GFP CCR5⁺ cells were used as recipient cells. These cells encode GFP under the HIV-1 LTR promoter, so in the presence of HIV-1 infection, or HIV-1 Tat, GFP is produced, which serves as an indicator of a successful infection event. Importantly, besides being GFP⁺, these cells are also expected to be mCherry⁺ upon infection with our NL4–3 mCherry reporter viruses, so any background level of GFP from a leaky LTR or due to non-productive infection of the mCherry clones can be compensated. As donor cells, we used MT4 cells because, unlike other CD4⁺ T cell lines, MT4 are more permissive and reach higher levels of infection [87]. MT4 cells were infected with 100 ng of p24 equivalents of each recombinant virus by spinoculation for 2 hours at 37 ºC. Cells were washed, resuspended with fresh media and kept for 2 days at 37 ºC. After this 2-day period, an aliquot of MT4 cells was analyzed by flow cytometry to measure the percentage of infected cells. Infectivity usually ranged between 85% and 90%. The rest of the MT4-infected cells were washed again to eliminate any virions from the supernatant and 10⁶ MT4-infected cells were seeded onto 24-well plates. For the 2D cell-free infection assay, 10⁶ Jurkat LTR-GFP CCR5⁺ cells were co-cultured on top of the MT4-infected cells using a transwell to physically separate them. For the 2D total infection assay, a similar procedure was performed, but here the transwells were omitted (Fig 11A). The co-cultures were treated with either DMSO or Torin2 at 10 nM for 18 hours and were subsequently analyzed by flow cytometry to identify the double GFP and mCherry population. Next, the infection efficacy was calculated by determining the percentage of GFP⁺ and mCherry⁺ cells in the presence of Torin2 over DMSO. This was measured for each individual virus, rather than one virus (i.e., Vpr_TFV) relative to another (i.e., Vpr_Lab) to account for potential differences in their replication kinetics. Remarkably, the Vpr_Lab virus achieved a ~ 77% infection efficacy in the total infection assay while the Vpr_mut and Vpr_TFV viruses achieved 85% and 96%, respectively, which was significantly higher. However, when these viruses harbored a Nef protein unable to counteract autophagy (Nef_mut), infection rates were between 52–65% (Fig 11B, left panel). By contrast, the susceptibility of Vpr to autophagy was irrelevant during infection in a 2D cell-free system, while the presence of autophagy-competent Nef proteins still provided a significant advantage during infection (Fig 11B, right panel).

Fig 11 — **(A)** Experimental design for the 2D total (cell-to-cell plus cell-free) and cell-free infection assays. **(B)** Left panel: 2D total infection was examined by co-culturing infected MT4 cells with Jurkat LTR-GFP CCR5⁺ reporter cells in the presence of DMSO or Torin2 (10 nM). Right panel: 2D cell-free infection was measured in a similar manner. However, here donor (infected MT4) and recipient (Jurkat LTR-GFP) cells were separated by transwells. **(C)** Experimental design to measure 3D infection using the cervicovaginal epithelium model. **(D)** Left panel: 3D total infection was measured by infiltrating infected MT4 cells and recipient Jurkat LTR-GFP CCR5⁺ cells into the 3D epithelium. Right panel: 3D cell-free infection was determined by infiltrating Jurkat LTR-GFP CCR5⁺ into the epithelium and inoculating mCherry recombinant viruses onto the apical part of the cervicovaginal epithelium. %Infection efficacy was measured by determining the amount of mCherry⁺ and GFP⁺ cells in the Torin2 condition over the DMSO condition for each recombinant virus. Data correspond to the mean and the SEM of 3 biological replicates. *: p < 0.05; **: p < 0.01; ****: p < 0.0001; ns: not significant by One-way ANOVA. Experimental pipelines were created in *BioRender* (License: *Serra-moreno,* R. *(2026)* https://BioRender.com/fp56lo4).

We next used a 3D cervicovaginal epithelial model to assess how susceptibility to autophagy by Vpr impacts infection and spread in a more physiologically relevant system. For this, we used the model developed by Edwards and collaborators [88] (Fig S4) and we infiltrated the tissue with 10⁵ Jurkat LTR-GFP CCR5⁺ cells by making a wound in the epithelium (Fig 11C). For total infection, 2.5 x 10⁵ MT4 cells infected with each recombinant virus (donor cells) were juxtaposed to the Jurkat cells 2 hours after their infiltration, and cells were analyzed by flow cytometry 4 days later (Fig 11C, top). For cell-free infection, the different recombinant viruses were inoculated to the apical part of the 3D culture and cells were analyzed 4 days post-infection (Fig 11C, bottom). Regardless of the type of setup (total vs. cell-free), infection efficacy was significantly lower for viruses harboring autophagy-susceptible Vpr proteins and, once again, the ability of Nef to counteract autophagy was an important determinant for infection for all viruses (Fig 11D). In summary, these results indicate that Vpr proteins resistant to autophagy provide a fitness advantage in the context of autophagy-competent Nef proteins, at least in our 2D and 3D in vitro settings.

Discussion

In the present study, we have identified, for the first time, that the HIV-1 accessory protein Vpr is a novel autophagy target. This was corroborated through different orthogonal assays: by using autophagy-defective cells engineered by CRISPR-Cas9 (i.e., ATG5KO), by using specific autophagy inhibitors (BafA1 and VPS34IN), by detecting an association and co-localization between Vpr and the autophagy receptors SQSTM1, TAX1BP1 and NDP52, and by immunofluorescence assays showing co-localization of Vpr with the autophagosome marker LC3, suggesting the presence of Vpr in autophagosomes (although we did not assess whether Vpr interacts with LC3). Furthermore, co-expression of the autophagy antagonist HIV-1 Nef redistributed Vpr away from LC3 puncta and rescued Vpr levels, which is consistent with our previous studies showing that Nef’s ability to intersect with autophagy rescues HIV-1 proteins from autophagy-mediated elimination [43,44]. However, it is important to note that while in Torin2-treated cells Nef enhanced Vpr expression, Nef did not restore Vpr to levels afforded by DMSO-treated cells co-expressing Nef, which indicates that Nef inhibits basal autophagy, and that its ability to counteract this pathway can be saturated under conditions of additional activation through mTOR inhibitors.

Our previous work demonstrated that the interplay between autophagy and NL4–3, particularly with Gag and Nef, is preserved in multiple cell types, including primary CD4⁺ T cells [44]. However, this may not be the case for the interplay between autophagy and Vpr. Our data shows that treatment of primary CD4⁺ T cells with VPS34IN, a highly selective autophagy inhibitor [67], rescues Vpr levels under conditions of mTOR inhibition, which is in line with our conclusions in HEK293T cells. However, while selective for autophagy, VPS34IN may also disrupt vesicular trafficking [89]. Therefore, genetic approaches are necessary to fully validate that Vpr is targeted for autophagy elimination in HIV-1 target cells. To address this, we attempted to genetically engineer primary CD4⁺ T cells as autophagy-deficient (ATG5KO) via nucleofection of gRNAs and Cas9 protein. Unfortunately, this approach was unsuccessful as either the knockout efficiency was very low, or cell viability was significantly impacted. In future studies, we will target other key autophagy genes (i.e., ATG7, ATG12 as well as the autophagy receptors SQSTM1/TAX1BP1/NDP52) to validate that Vpr is also an autophagy target in primary cells.

Vpr is conserved among human (HIV-1 and HIV-2) and Simian Immunodeficiency Viruses (SIV). Lentiviruses defective of Vpr are severely attenuated, indicating that Vpr is a virulence factor. While many of its biological functions still need validation in primary cells, Vpr has been reported to promote the nuclear import of the proviral DNA, facilitate the integration of the provirus into the host genome, enhance HIV gene expression, and cause cell cycle arrest [90–93], which is important to facilitate the infection of non-dividing cells. More recently, Vpr has been shown to induce transcriptional re-programming of resting CD4⁺ T cells to a program more typical of resident T memory cells, with implications in viral replication and persistence [94]. Hence, the autophagy-mediated degradation of Vpr is perceived as antiviral, as it would reduce HIV-1 infectivity, persistence and virulence. Of note, Vpr has previously been reported to inhibit autophagy by blocking FOXO-3-mediated transcription of autophagy genes and by impairing lysosomal acidification [45,95–97]. However, in the present study no major impact on autophagy flux by Vpr was observed. Because that previous report investigated the interplay between Vpr and autophagy at early events post-entry, while here we focused on later stages post-infection, it is tempting to speculate that Vpr might have differential impacts on autophagy depending on the step of the virus life cycle. Furthermore, in our mechanistic studies in HEK293T cells, Vpr was expressed alone without any other viral components (proteins, RNA). Hence, a role for Vpr in inhibiting autophagy when in complex with other viral elements might have been missed.

Similar to Vpr, Vif was susceptible to mTOR inhibitors. However, follow up assays revealed that this is due to increased proteasomal activity, which is also modulated by mTOR [59–62]. Nevertheless, to undeniably conclude that increased proteasomal function caused by mTOR inhibition leads to Vif degradation, more specific analyses (like using proteasomal reporters) are needed. Importantly, the fact that in our initial infections HIV-1 Nef rescued Vif levels in the presence of mTOR inhibitors indicates that Nef may play additional roles in the modulation of the mTOR axis, and this will be investigated in future studies.

Contrary to the lab adapted NL4–3 clone, the ten group M TFVs we tested here had Vpr proteins highly resistant to autophagy, suggesting that, similar to our previous findings with their Gag proteins [43], the susceptibility of Vpr to autophagy may influence the success of infection. Our Vpr mapping assays revealed residues 37 and 45 in the second alpha helix of the protein and amino acids 77, 83–86 and 93–94 in the C-terminal unstructured domain as responsible for the susceptibility of NL4–3 Vpr to autophagy. Remarkably, replacing either residues 37 and 45 or 77 + 83–86 + 93–94 by those of a TFV (CH077) Vpr renders the protein resistant to autophagy, suggesting that protein conformation rather than detection of specific amino acids contribute to the susceptibility/resistance of Vpr to autophagy. This hypothesis is supported by the fact that, while highly resistant to autophagy, few of the TFV Vpr proteins analyzed here did not harbor residues at positions 37 and 45 nor 77, 83–86 and 93–94 that we identified as sufficient to confer resistance to autophagy. Instead, these Vpr proteins harbored other amino acid changes at these locations and/or at surrounding areas (S3C Fig), which might impact protein structure and Vpr’s ability to interact with autophagy receptors. Hence, these findings suggest some mechanistic diversity on how TFV Vpr proteins resist autophagy. To assess whether mutations at those protein regions impact Vpr’s association with autophagy factors, we examined NL4–3 (Lab) and CH077 (TFV) Vpr for their ability to interact with numerous autophagy receptors. In fact, in our experimental system Lab-Vpr but not TFV-Vpr was found in association with SQSTM1 and TAX1BP1. While Lab-Vpr, but not TFV-Vpr, was also found to interact with NDP52, there was variability in the strength of their association by co-IP, as the presence of Lab-Vpr in the NDP52 pulldown fraction was observed ~50% of the times. This led us to hypothesize that either recruitment through NDP52 is weak or is mediated by co-factors, and/or that extensive washes post co-IP affect our ability to detect Lab-Vpr in complex with NDP52. However, we functionally confirmed the importance of NDP52 in targeting Vpr for autophagy degradation by immunofluorescence microscopy, showing significant co-localization between Lab-Vpr and NDP52, but most importantly in SQSTM1/TAX1BP1/NDP52 triple knockout cells, where, unlike in the SQSTM1/TAX1BP1 double knockout cells, Vpr levels were fully restored. Nevertheless, while the role of these autophagy receptors in targeting NL4–3 Vpr to autophagosomes is confirmed here, whether TFV Vpr proteins other than CH077 Vpr are immune to the recognition by these receptors needs to be addressed experimentally.

Our survey of Vpr sequences in lab adapted and primary HIV-1 isolates revealed that, for the most part, lab adapted HIV-1 clones retain the residues present in NL4–3 Vpr at positions critical for autophagy susceptibility while most primary isolates retain the TFV CH077 amino acids at positions 37 and 45, which are sufficient to render Lab-Vpr resistant to autophagy. Hence, we hypothesize that primary isolates are inherently resistant to autophagy. One could speculate that harboring determinants for autophagy resistance in Vpr represents an advantage in the context of HIV infection and transmission in vivo. In contrast, we theorize that Vpr proteins from lab adapted clones are sensitive to autophagy as a result of lab adaptation. Specifically, we speculate that extensive passage in lab settings might have favored the accumulation of mutations that confer a fitness advantage when replicating in cell culture at the cost of rendering Vpr sensitive to autophagy. Usually, these viruses are propagated in cell lines that are kept in highly rich nutrient media – and, thus, autophagy is expected to be low at steady state. Hence, this “cost” would not have a dramatic impact in vitro, as the virus would still be equipped with Nef proteins capable of counteracting autophagy at baseline [43,44]. Following this reasoning, our findings would suggest that Vpr susceptibility to autophagy likely represents an exception of the rule rather than a common trait. This statement is speculative at this moment, as we have not experimentally tested all lab-adapted HIV-1 molecular clones for the susceptibility of their Vpr proteins to autophagy, and we have only tested few TFV Vpr proteins. However, if our hypothesis is correct, this would be relevant, as we and many other laboratories use NL4–3 as a model molecular clone to study HIV-1 biology, which highlights the importance of corroborating findings with other clones and, most importantly, with primary isolates.

As mentioned above, NDP52, SQSTM1, and TAX1BP1 were found in association with Lab-Vpr in our experimental system. These receptors are thought to target cargo to autophagosomes through interactions between their ubiquitin binding domains and ubiquitin molecules attached to autophagy targets [74,75,98]. Hence, the interaction between Vpr and these cargo receptors suggests that Vpr ubiquitination might be an important post-translational modification that regulates its autophagy susceptibility. However, our attempts to investigate this scenario proved complex and somewhat contradictory. While the ubiquitination inhibitor TAK-243 rescued Vpr levels under conditions of mTOR inhibition, it also caused defects in LC3 lipidation, likely by impacting ATG7 (the E1-like activating enzyme in the lipidation reaction for LC3 [19]), as TAK-243 has been reported to exhibit low level of activity against ATG7 [80]. So, it is unclear whether the rescue in Vpr is due to blocking ubiquitination or impacting autophagy. Moreover, the Vpr K₂₇M mutant, in which the only Lysine residue in Vpr (and a likely ubiquitination site) was mutated, remained susceptible to degradation upon mTOR inhibition, suggesting that Vpr ubiquitination is dispensable to target the protein for autophagy elimination. However, because ubiquitination can also occur at non-lysine residues, these data does not completely discount ubiquitination as part of the mechanism for tagging Vpr to autophagosomes. Another ambiguity in our data is that, despite their different susceptibility to autophagy, the ubiquitination profiles of Lab-Vpr and TFV-Vpr were very similar, suggesting that ubiquitination may not be a key post-translational modification in tagging Vpr as an autophagy target. Finally, co-IP assays using SQSTM1 mutants lacking domains necessary to detect ubiquitinated cargo revealed that Vpr still associated with these mutants, indicating that Vpr ubiquitination is dispensable for binding with this autophagy receptor. Therefore, the role of ubiquitination as a signal to recruit Vpr to autophagosomes warrants further investigation. Mass Spectrometry assays to identify post-translational modifications using Lab-Vpr and TFV-Vpr might bring light into the role of ubiquitination and/or other post-translational modifications in tagging Vpr for autophagy elimination.

Because all the TFVs we tested here exhibited resistance to autophagy, both in their Gag [43] and Vpr proteins, we took a reductionist approach to investigate if Vpr resistance to autophagy influences virus infection and spread. For this, we engineered NL4–3-based molecular clones encoding either autophagy-sensitive (Lab; NL4–3) or -resistant (TFV; CH077) vpr while maintaining the same genetic background. Still, because there are more amino acid differences between CH077 and NL4–3 Vpr than the ones responsible for their differential susceptibility to autophagy, we generated a molecular clone harboring NL4–3 Vpr with minimal substitutions to render it resistant to autophagy (P₃₇Y₄₅ or Vpr_mut). The goal here was to exclude any of the roles attributed to Vpr that could enhance infection and focus exclusively on autophagy sensitivity. While Vpr susceptibility to autophagy caused no significant differences in the efficacy of cell-free infection in a 2D in vitro system, the infection efficacy of TFV-Vpr and P₃₇Y₄₅-Vpr recombinant viruses was significantly higher than the Lab-Vpr recombinant virus in the other scenarios, as long as Nef was autophagy-competent. In fact, for viruses harboring autophagy-defective Nef proteins (Nef_mut) infection and spread were significantly reduced, regardless of the experimental system (2D vs. 3D), infection setup (total vs. cell-free), or the susceptibility of Vpr to autophagy. Because NL4–3 Tat and Gag have previously been reported as autophagy targets [43,47], we hypothesize that resistance to autophagy of Vpr alone is not sufficient to restore the fitness loss caused by Nef’s disruption in counteracting autophagy and preventing the autophagy-mediated clearance of Tat and Gag. Furthermore, it is also possible that the impact of autophagy on virus infection extends beyond the degradation of Gag, Vpr, and Tat. For instance, autophagy may reduce the permissiveness of target cells because they are in a “survival mode” since, under conditions of autophagy activation, anabolic activity is reduced, which could impact virion biogenesis and progeny size. So, harboring Nef proteins capable of counteracting autophagy not only curbs the autophagy-mediated degradation of Gag, Tat, and Vpr, but also would help counter these additional restrictions imposed by autophagy. Of note, Nef’s ability to antagonize autophagy is not unlimited. At high doses of mTOR inhibitors, HIV-1 proteins are still targeted for degradation despite the presence of Nef. Thus, in high autophagic flux conditions, harboring autophagy-resistant Vpr proteins would provide an advantage in virus replication and spread, which is consistent with our findings with the Vpr_mutNef_WT recombinant virus.

To uncover whether beyond targeting Gag, Vpr and Tat for elimination autophagy poses additional restrictions to HIV-1 infection and spread, assays with recombinant viruses harboring autophagy-resistant Gag, Vpr and Tat proteins are necessary, and these experiments should be performed in autophagy-competent and -deficient cells, as well as with Nef proteins that can and cannot counteract autophagy. As a first approach, we attempted a rescue assay with our six recombinant viruses, where cells were treated with the autophagy inhibitors VPS34IN, Chloroquine (Chlor) or BafilomycinA1 (BafA1). However, the combination of Torin2 + VPS34IN, Torin2 + Chlor as well as Torin2 + BafA1 caused toxicity and significant cell death. Also, while these inhibitors are commonly used to modulate autophagy, they may cause pleiotropic effects. Hence, to validate a role for autophagy in virus infection and spread, future work using CRISPR editing to generate autophagy-deficient cells in either donor cells (MT4), target cells (Jurkat LTR-GFP) and, more importantly, in primary CD4⁺ T cells are necessary. Finally, our infection/virus spread assay measures the number of cells expressing GFP and mCherry. The expression of GFP and mCherry is a composite readout of multiple processes, including particle transfer, entry, reverse transcription, integration and gene expression. Hence, a reduction in GFP/mCherry cells caused by mTOR inhibition may be the result of one or multiple steps of the HIV-1 life cycle being impacted by autophagy. Measuring viral RNA uptake, levels of integrated and unintegrated HIV-1 DNA, as well as HIV-1 gene expression would more accurately determine the specific step(s) of the virus life cycle impacted by autophagy, and how resistance of Vpr to autophagy helps mitigate this effect. This information will be valuable for the development of autophagy-modulating compounds that could be incorporated into PrEP regimens as potentially effective tools to limit HIV-1 transmission among individuals.

In summary, this study identifies Vpr as a novel autophagy target, reveals a new role for the Vpr-autophagy interplay in HIV-1 replication and spread, and suggests that sensitivity of Vpr to autophagy may be a hallmark of lab adaptation.

Materials and methods

Plasmid DNA constructs

(i) Full-length proviral constructs.
- a. The following full-length proviral constructs were obtained through BEI resources. Wild-type HIV-1 NL4–3 (pNL4–3, #ARP-114) and NL4–3 Δnef (pNL4–3 Δnef, #ARP-12755) were obtained from Drs. Malcolm Martin and Olivier Schwartz, respectively [99,100]. HIV-1 viruses based on these plasmids were generated by transient transfection in HEK293T cells, as previously described [44,101,102].
- b. The proviral constructs for subtype A transmitted-founder virus clone A191084 (pBR322_HIV-1 M subtype A 191084) was provided by Dr. Konstantin Sparrer, University of Ulm, Germany. The subtype B transmitted-founder virus clones CH077 (pCH077.t/2627), and CH106 (pCH106.c/2633,) were obtained from Dr. John Kappes and Dr. Christina Ochsenbauer (University of Alabama at Birmingham). Clone CH470 was provided by Dr. Konstantin Sparrer, University of Ulm, Germany. The subtype C transmitted-founder virus clone Z3576 (pZ3576F) was obtained from Dr. Eric Hunter (Emory University) [103–105]. Clones CH042 and CH198 were provided by Dr. Konstantin Sparrer, University of Ulm, Germany. Clones Z1123M, 3137M, and N31F were obtained from Dr. Christina Ochsenbauer (University of Alabama at Birmingham).
- c. Full-length proviral constructs of HIV-1 NL4–3 harboring mCherry were generated following a previously described cloning approach [106]. Specifically, mCherry-furin-P2A-T2A was inserted between env and nef using the HapI and XhoI unique restriction sites. A version of this mCherry clone in which vpr harbored substitutions at positions 37 and 45 and another recombinant virus in which vpr was replaced by CH077 vpr was generated using the AgeI and NheI unique restriction sites (Fig S3). Virus versions harboring Alanine substitutions at residues 48 and 49 in Nef were also generated. These recombinant viruses were generated by transient transfection in HEK293T cells, as previously described [44,101,102]
(ii) Vpr constructs.

pALPS Vpr, a construct harboring codon optimized HIV-1 NL4–3 Vpr, was a gift from Jeremy Luban (Addgene #101329) [107]. This construct was later engineered to harbor a Myc tag in the C-terminus of the protein. HIV-1 transmitted-founder virus vpr genes were cloned into the expression vector pcDNA5 (ThermoFisher Scientific, V601020) using the KpnI and BamHI unique restriction sites. Vpr constructs harbored a Myc tag in their C-terminus. In the case that the Myc tag conflicted with the cloning restriction sites, either a Flag or a 6xHis tag was used. Vpr chimera I and chimera II were generated by overlapping PCR and were cloned into the expression vector pcDNA5 using the same strategy. Vpr mutants were generated by site-directed mutagenesis using QuickChange (Stratagene, #200518) and following the manufacturer’s instructions.

(iii) Vif constructs.

The HIV-1 NL4–3 Flag-Vif construct was a gift from Dr. Judd Hultquist (Northwestern University).

(iv) Lentivirus-based CRISPR-Cas9 genome editing constructs.

ATG5 knockout cell lines were generated using LentiCRISPRv2-ATG5, a gift from Dr. Edward Campbell (Addgene plasmid # 99573) [108]. SQSTM1, TAX1BP1 and NDP52 knockout cell lines were generated by CRISPR-Cas9. For this, the guide RNAs (gRNAs) that appear below were cloned into LentiCRISPRv2, a gift from Dr. Feng Zhang (Addgene plasmid# 52961) [109], using the BsmBI unique restriction site. Guide RNA sequences were generated using the CRISPR design tool (http://crispor.tefor.net). SQSTM1 gRNAs: 5’- CGACTTGTGTAGCGTCTGCG -3’, 5’- TCAGGAGGCGCCCCGCAACA-3’, and 5’- GCCCACGTCCTCCTCGTGCA-3’. TAX1BP1 gRNAs: 5’-GGCCGACTAAAGTTTCGAGC -3’, 5’- CAACGTACGAGACAGAACGA -3’, and 5’- TCCACGAATTTCACCCTTAT -3’. NDP52 gRNAs: 5’- GTGAGTATTACACCTTCATG -3’, 5’- GTATTACCAGTTCTGCTATG -3’, and 5’- GGAGGCGCAAGACAAAATCC -3’. The HIV-Gag-Pol packaging plasmid (psPAX2, Addgene plasmid# 12260; a gift from Dr. Didier Trono) was used to generate lentiviral particles harboring Cas9 and these gRNAs.

(v) VSV-G construct.

The plasmid for the expression of the Indiana variant of the Vesicular Stomatitis Virus (VSV) glycoprotein was a gift from Dr. David T. Evans (University of Wisconsin, Madison, WI).

(vi) Plasmids coding for autophagy proteins.

Human LC3B was cloned into the expression vector pQCXIP with an EGFP-tag attached to its N-terminus. MLV Gag-Pol, a gift from Dr. Patrick Salmon (Addgene plasmid # 35614) was used to generate retroviral particles encoding for EGFP-LC3B. The SQSTM1/p62 constructs SQSTM1 mCherry-WT, mCherry-ΔPB1, and mCherry-ΔUBA were gifts from Dr. Sascha Martens (Addgene plasmids # 187986, # 187985, and # 187984).

Transfections

HEK293T cells were transfected using GenJet in vitro DNA transfection reagent (SignaGen Laboratories, SL100488), following the manufacturer’s instructions, including total DNA, dish size, incubation time, and the ratio of GenJet:DNA for optimal transfection efficiency. Cell viability was monitored for every transfection to evaluate potential toxicity. If viability was below 85%, cells were considered unsuitable for further analyses. Viabilities were usually above 90%. For autophagy studies, cells were transfected with 2,000 ng of the indicated plasmid DNAs. Forty-four h later, cells were treated with either DMSO, Rapamycin, Torin and/or VPS34IN or Bafilomycin A1 (see drug treatments section for details). Next, cells were analyzed by western blot, immunofluorescence and/or immunoprecipitation.

Cell culture

Human HEK293T cells (American Type Culture Collection [ATCC], CRL-11268) and BJ fibroblast cells (ATCC, #CRL 2522) were cultured in complete medium (Dulbecco’s Modified Eagle Medium [DMEM, ThermoFisher Scientific, 11885–084] supplemented with 10% fetal bovine serum [FBS, ThermoFisher Scientific, 26140–079], 1% Penicillin-Streptomycin [ThermoFisher Scientific, 15070–063] and 1% L-glutamine [ThermoFisher Scientific, 25030–081]). HEK293T cells stably expressing EGFP-LC3 [44], HEK293T ATG5KO [110], SQSTM1, TAX1BP1, and NDP52 knockout cells were cultured in complete medium supplemented with 1 ng/mL of puromycin. VK2-E6-E7 vaginal epithelial cells (ATCC, #CRL 2616) were maintained in VK2 complete medium (Keratinoctye-SFM with BPE and EGF, Gibco, #10725–018) supplemented with 0.4 M calcium chloride (Amresco, #E506).

CD4⁺ T Jurkat (ATCC, TIB-152), MT4 (BEI, #ARP-120) and Jurkat LTR-GFP CCR5⁺ (BEI, #ARP-11586) cells were cultured in complete medium (RPMI 1640 Medium [ThermoFisher Scientific, 11875–119] supplemented with 10% fetal bovine serum [FBS, ThermoFisher Scientific, 26140–079], 1% Penicillin-Streptomycin [ThermoFisher Scientific, 15070–063] 1% L-glutamine [ThermoFisher Scientific, 25030–081]), and 2.5% HEPES [ThermoFisher Scientific, 15630080].

Normal human peripheral blood cryopreserved naïve CD4⁺ T cells (SER-PBCD4⁺TH-N-F) were purchased from ZenBio. Cells were activated using 25 μL anti-CD3/CD28 beads (Invitrogen, #111.31D), 1 μg/mL of IL-4 (Peprotech, #500-P24), 2 μg/mL IL-12 (Peprotech, #500-P154G), 1 ng/mL TGF-B (Peprotech, #100–21) and expanded for 3 days in RPMI medium (RPMI 1640 Medium [ThermoFisher Scientific, 11875–119] supplemented with 10% fetal bovine serum [FBS, ThermoFisher Scientific, 26140–079], 1% Penicillin-Streptomycin [ThermoFisher Scientific, 15070–063] 1% L-glutamine [ThermoFisher Scientific, 25030–081]), 2.5% HEPES [ThermoFisher Scientific, 15630080] in the presence of 30 IU/ mL of IL-2 (BEI #ARP-136).

Generation of knockout cells using CRISPR-Cas9 genome editing

Five million HEK293T cells were seeded in 10 cm dishes. Twenty-four h later, cells were transfected with 3.45 μg HIV-Gag-Pol packaging plasmid, 1.725 μg VSV-G envelope expressing plasmid, and 6.9 μg of either LentiCRISPRv2-ATG5, SQSTM1, TAX1BP1 or NDP52 plasmids. The supernatant was collected 48 h post-transfection and centrifuged for 10 min at 931 x g to remove the cell debris. Supernatants containing VLPs for CRISPR/Cas9 engineering were then aliquoted into 1 mL cryotubes and stored at -80ºC. To CRISPR-engineer HEK293T cells, cells were seeded in 25 cm² flasks. 24 h later, cells were transduced with VLPs harboring Cas9 and the gRNA targeting ATG5, SQSTM1, TAX1BP1 and/or NDP52. 48 h later, the cell medium was replaced and supplemented with puromycin. Cells were cultured under puromycin for 10 days to allow for the selection of cells successfully transduced with Cas9 and the corresponding gRNAs. Cells were then harvested for knockout assessment by western blotting and phenotypic analyses.

Infections

(i) One million Jurkat CD4⁺ T cells were infected with 100 ng of p24 equivalents of HIV-1 NL4–3 or NL4–3 Δnef by spinoculation at 1650 xg for 2 h at 37 °C. After infection, cells were washed and re-suspended in 5 mL of RPMI medium supplemented with 10% of fetal bovine serum. Cells were then cultured with increasing concentrations of Rapamycin (Sigma- Aldrich, #R8781): 1.3 μM, 2.6 μM, 4 μM, 6.5 μM, and 13 μM for 18 h. Cell lysates were subjected to western blot analysis 18 h post-infection.
(ii) One million primary CD4⁺ T cells (Zen-Bio, Inc., SER-PBMCD4⁺TH-N-F) were activated and infected with 100 ng of p24 equivalents of HIV-1 NL4–3 or HIV-1 NL4–3 Δnef by spinoculation at 1650 xg for 2 h at 37 °C. After the infection, cells were washed and re-suspended in 5 mL of RPMI medium supplemented with 10% of fetal bovine serum and 30 IU/mL of IL-2. One d post-infection, cells were either treated with DMSO, Rapamycin (0–13 μM at 2-fold increments; Sigma- Aldrich, #R8781) or Torin2 (2.5-20 nM Torin2 [Selleckchem, #S2817]) for 18 h. Cell lysates were then subjected to western blot analysis.

2D HIV infection assay

(i) Total (cell-free + cell-to-cell) HIV infection.

One million MT4 cells were infected with 100 ng of p24 equivalents of HIV NL4–3 Vpr_Lab mCherry, Mutant Vpr (Vpr_mut; harboring P₃₇Y₄₅ substitutions) mCherry, or Vpr_TFV mCherry by spinoculation at 1650 xg for 2 h at 37 °C. Similar infections were performed with these recombinant viruses harboring mutations in Nef that render the protein unable to counteract autophagy (Nef_mut). After the infection, cells were washed and re-suspended in 1 mL of RPMI medium supplemented with 10% of fetal bovine serum and seeded in a well of a 24-well plate and further incubated at 37 ºC. 2 d post-infection, cells were analyzed by flow cytometry to examine infectivity. Infectivity usually ranged between 85–90%. Next, 10⁶ infected MT4 cells were washed and re-suspended in 1 mL of RPMI medium supplemented with 10% of fetal bovine serum. At that moment, 10⁶ Jurkat LTR-GFP CCR5⁺ cells were added to the culture, in the presence or absence of Torin2 at 10 nM and incubated at 37 ºC. 18 h later, cells were collected for flow cytometry analysis.

(ii) Cell-free HIV infection.

One million MT4 cells were infected with 100 ng of p24 equivalents of HIV-1 NL4–3 Vpr_Lab mCherry, Vpr_mut mCherry, or Vpr_TFV mCherry harboring autophagy-competent or -defective Nef proteins by spinoculation at 1650 xg for 2 h at 37 °C. After the infection, cells were washed and re-suspended in 1 mL of RPMI medium supplemented with 10% of fetal bovine serum and seeded in a well of a 24-well plate and further incubated at 37 ºC. 2 d post-infection, cells were analyzed by flow cytometry to examine infectivity. Infectivity usually ranged between 85–90%. Next, 10⁶ MT4 infected cells were washed, re-suspended in 1.6 mL of RPMI medium supplemented with 10% of fetal bovine serum, and seeded in the bottom of a well of a 24-well with a transwell insert (Fisher, #07-000-676). Next, 10⁶ Jurkat LTR-GFP CCR5⁺ cells were re-suspended in 0.4 mL of RPMI medium supplemented with 10% of fetal bovine serum, and seeded on the top of the transwell in the presence or absence of Torin2 at 10 nM. Cells were incubated at 37 ºC. 18 h later, cells were collected for flow cytometry analysis.

3D HIV infection assay

The 3D cervicovaginal epithelium model was established following the protocol described by Edwards et al., [88]. Briefly, VK2 epithelial cells were polarized following the pipeline in S4 Fig in which collagen and BJ fibroblast cells provide support and mimic the epithelial-air interface. After 8 d in culture, the cervicovaginal epithelium is stratified, closely resembling the 3D structure in the female reproductive tract.

(i) Total (cell-free + cell-to-cell) HIV infection. To prepare donor cells, 10⁶ MT4 cells were infected by spinoculation with 100 ng of p24 equivalents of HIV-1 NL4–3 Vpr_Lab mCherry, Vpr_mut mCherry, or Vpr_TFV mCherry harboring autophagy-competent or -defective Nef proteins and cells were kept in culture for 2 d at 37 ºC. After this period of time, the VK2 epithelial cells were infiltrated with 10⁵ Jurkat LTR-GFP CCR5⁺ cells in 10 μL RPMI supplemented with 10% of fetal bovine serum. Two h later, 2.5 x 10⁵ infected MT4 cells were inoculated at the same location where Jurkat cells were infiltrated, and cells were incubated at 37 ºC. Four d later, cells in the apical compartment were collected for flow cytometry analysis.
(ii) Cell-free HIV infection. For this, 10⁵ Jurkat LTR-GFP CCR5⁺ cells were infiltrated into the VK2 epithelial cells in an analogous manner as explained above. Next, 1,500 ng of p24 equivalents of either HIV-1 NL4–3 Vpr_Lab mCherry, Vpr_mut mCherry, or Vpr_TFV mCherry harboring autophagy-competent or -defective Nef proteins were inoculated to the apical part of the 3D tissue and kept at 37 ºC. Four d later, cells in the apical compartment were collected for flow cytometry analysis.

Drug treatments

HEK293T cells were transfected with 2,000 ng of Vpr or Vif constructs. Forty-four h later, cells were treated with DMSO, Rapamycin (1.3-13 μM Rapamycin [Sigma-Aldrich, #R8781]), Torin2 (2.5-10 nM Torin2 [Selleckchem, #S2817]) or Torin2 (5–10 nM) plus Bafilomycin A1 (BafA1; 500 nM [Fisher, # J67193XFPM]). Treatments were kept for 4 h. Then samples were collected. Jurkat and primary CD4⁺ T cells were treated with Rapamycin (1.3-13 μM) or Torin 2 (2.5-20 nM) 18 h before sample collection. For the 3D HIV transmission assay, 10 nM Torin2 was added on day 1 and day 3 post-infection. To inhibit autophagy, cells were treated with 10 μM VPS34IN (Selleckchem, S7980) 18 h before sample collection. To investigate how Vif is degraded, the lysosomal inhibitor Hydroxychloroquine (Sigma-Aldrich, #H0915, 60 μM) and the proteasomal inhibitor MG132 (Sigma-Aldrich, #474791, 20 μM) were added to ATG5KO cells 18 h before sample collection. To inhibit ubiquitination, cells were treated with 200 nM TAK-243 (Fisher, #50-187-1707) 4 h before sample collection.

Western blotting

Transfected and infected cells were washed with DPBS and harvested in 0.3 mL lysis IP buffer (ThermoFisher Scientific, #87787) supplemented with protease inhibitors (Roche, #04693116001) and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich, #P5726 and #P0044). Cell lysates were then incubated on ice for 30 min. Samples were centrifuged at 16,000 xg at 4 °C for 8 min to remove cell debris. Supernatants were collected, mixed with 2x SDS sample buffer (Sigma-Aldrich, S3401), and boiled for 10 min on a heat block. Proteins were then separated by electrophoresis on 12% SDS-PAGE polyacrylamide gels and transferred to a polyvinylidene difluoride (PVDF) membrane (BioRad, #1620177) using a Trans-Blot Turbo Transfer System (Bio-Rad, #1704150EDU). Membranes were then incubated for 1 h with blocking buffer (Bio-Rad, #1706404) at room temperature, followed by an overnight incubation at 4 ºC with a primary antibody against our protein of interest (antibody sources and dilutions are detailed in Table 2). The following day, membranes were washed with PBS-tween (Sigma-Aldrich, #P3563) 3 times for 15 min at room temperature, followed by a 60-min incubation with the corresponding secondary antibody (antibody sources and dilutions are detailed in Table 2) at room temperature. Next, the membranes were washed 3 additional times for 15 min in PBS-tween. Finally, membranes were imaged with SuperSignal West Femto maximum sensitivity substrate (ThermoFisher Scientific, #34095), and visualized in a ChemiDoc MP imaging system (Bio-Rad, #12003154). The expression level of proteins was quantified using Image Lab software (Bio-Rad, Hercules, CA).

Immunoprecipitation assays

One million HEK293T cells were transfected with either 2,000 ng of Vpr constructs or 2,000 ng of Vpr constructs plus 2,000 ng of SQSTM1 plasmids. Forty-eight h post-transfection, cells were washed with DPBS and incubated with lysis IP buffer on ice for 30 min. After cell debris was eliminated by centrifugation (16,000 xg at 4 °C for 8 min), the whole cell lysates were incubated for 1 h at room temperature with Protein G magnetic beads (New England Biolabs, #S1430S). This step was performed to remove proteins unspecifically bound to the beads. In parallel, fresh Protein G magnetic beads were coated with an antibody against SQSTM1, NDP52, TAX1BP1, BNIP3L, NBR1, OPNT, or Vpr (Table 2) for 1 h at room temperature. Next, pre-cleared lysates were incubated with the antibody-coated Protein G beads overnight at 4 °C. The next day, the beads were washed with lysis IP buffer 5 times and resuspended in 2x SDS sample buffer. Samples were analyzed by western blotting by probing membranes with antibodies for Vpr, SQSTM1, NDP52, TAX1BP1, BNIP3L, OPNT, or ubiquitin (Table 2). As controls, cell lysates incubated with beads (but not coated with antibody; beads control) as well as a sample consisting of IP lysis buffer mixed with beads and antibody (IgG control) were included. These controls helped rule out any bands detected by western blot that corresponded to proteins unspecifically bound to the beads, material from the magnetic beads as well as the IgG heavy or light chains.

Fluorescence microscopy

One hundred thousand HEK293T or HEK293T EGFP-LC3B cells were seeded in sterile tissue culture-treated 8-well slides. Eighteen h later, cells were transfected with Vpr and/or Nef or SQSTM1 constructs. Forty-four h later, cells were treated with DMSO or Torin2. Four h later, cells were washed with ice-cold DPBS, permeabilized, and fixed by incubating in 1:1 acetone-methanol (Sigma-Aldrich, #270725, #34860) at room temperature for 1 h. Cells were then blocked with antibody diluent solution (2% fish skin gelatin [Sigma-Aldrich, 67765] + 0.1% Triton X-100 [Sigma-Aldrich, #X100] + 10% goat serum [ThermoFisher Scientific, #500062Z] with 1 x DPBS) for 30 min at room temperature and incubated for 60 min with the following primary antibody cocktail: antibody diluent solution + anti-Vpr/anti-SQSTM1/anti-NDP52/anti-TAX1BP1/anti-Nef at a dilution of 1:200 (Table 2). Subsequently, cells were washed with wash buffer (2% fish skin gelatin + 0.1% Triton X-100 with 1 x DPBS) 3 times and incubated with a secondary antibody cocktail (Table 2). Next, cells were washed with wash buffer 3 times and incubated with Hoechst (ThermoFisher Scientific, #H3570; 1:5,000 dilution) for 3 min to visualize cell nuclei. After staining, the slides were washed and mounted using an anti-quenching mounting medium (Vector Laboratories, #3304770). The slides were visualized in a BioTek Lionheart FX automated microscope and a Nikon A1R HD with TIRF confocal microscope using 40x and 60x/1.49 oil objectives, respectively, and filter cubes or excitation diodes 350 nm, 488 nm, and 586 nm in order to excite DAPI, EGFP, and TexasRed, respectively. Images were processed and analyzed using the Gen5 software (BioTek Instruments, Winooski, VT). Proportional adjustments of brightness and contrast were applied. Co-localization between Vpr and autophagy markers (EGFP-LC3B, NDP52, SQSTM1 and TAX1BP1) was determined by calculating the Pearson’s correlation coefficient of 8–25 independent fields using ImageJ (NIH https://imagej.nih.gov/ij/).

Flow cytometry

Cells from the HIV-1 infection assays were collected, washed with DPBS (ThermoFisher Scientific, #14190144), and centrifuged at 600 xg for 5 min. Samples were then fixed with 2% paraformaldehyde in DPBS. Cells were analyzed using an Attune instrument (ThermoFisher Scientific, Waltham, MA). Data were processed with FlowJo software (version 10.5.3) using 50,000 events. Debris and doublets were excluded using FSC and SSC gating, and the percentage of double positive GFP and mCherry cells was calculated for every sample and treatment condition.

Statistical analysis

Statistical calculations for 2-group comparisons were performed with a two-tailed unpaired Student T test. All other statistical comparisons were performed with One-Way ANOVA with Dunnet post hoc testing. Analyses were performed using Graph Pad Prism version 10.4.2. P values ≤ 0.05 were considered statistically significant.

Supporting information

S1 Fig. Mutagenesis strategy in Vpr.

(A-D) To elucidate the residues at positions 77–96 in CH077 Vpr that confer resistance to autophagy, multiple combinations of the amino acids that differ between NL4–3 and CH077 Vpr (red dots) were introduced into NL4–3 Vpr and they were tested for their susceptibility to autophagy. Blots are representative of 3 independent experiments. The average Vpr levels from 3 independent experiments relative to the DMSO treatment are provided underneath the blots.

(TIFF)

ppat.1014020.s001.tiff^{(2.6MB, tiff)}

S2 Fig. Amino acid usage at residues 37, 45, 77, 83–86, 93–94 in Vpr.

(A) Protein alignment of Vpr of 4 HIV-1 lab-adapted molecular clones. Consensus sequence is shown underneath. (B) Amino acid usage of Vpr at positions 37, 45, 77, 83–86, 93–94 was determined for 212 primary HIV-1 group M sequences from the Los Alamos database https://www.hiv.lanl.gov/content/sequence/HIV/COMPENDIUM/2021/hiv1dna.pdf. Green bars represent residues present in Lab (NL4–3), orange bars represent residues present in TFV (CH077), and blue bars represent residues that differ from Lab and TFV. (C) Vpr alignment between NL4–3 and the 10 group M TFVs analyzed here. Consensus sequence is shown underneath. Red boxes indicate substitutions that our mapping analyses have revealed as responsible for NL4–3 Vpr susceptibility to autophagy.

(TIFF)

ppat.1014020.s002.tiff^{(4.1MB, tiff)}

S3 Fig. Design of the NL4–3 recombinant viruses.

Schematic organization of the genome structure of the NL4–3 recombinant viruses engineered to harbor mCherry-furin-P2A-T2A-nef and either NL4–3 (Lab) Vpr, CH077 (TFV) Vpr or NL4–3 Vpr with mutations in residues 37 and 45. Diagram was created in BioRender (License: Serra-moreno, R. (2026) https://BioRender.com/7laq4uh). Blots show the degree of expression of Nef, Vpr and mCherry from these molecular clones. White arrowhead indicates band corresponding to Nef in CH077. Blots are representative of 3 independent experiments.

(TIFF)

ppat.1014020.s003.tiff^{(2.9MB, tiff)}

S4 Fig. Pipeline for the generation of the 3D cervicovaginal epithelial model used for the 3D infection studies.

Diagram created in BioRender (License: Serra-moreno, R. (2025) https://.BioRender.com/7tqr7m5)

(TIFF)

ppat.1014020.s004.tiff^{(2MB, tiff)}

S1 File. All raw, numerical data used in the graphs of this manuscript are provided in an excel file.

(XLSX)

ppat.1014020.s005.xlsx^{(44.1KB, xlsx)}

Data Availability

All the data is found in the manuscript and the supplementary materials.

Funding Statement

This work has been supported by the National Institutes of Health (R01 AI155012 to RSM) and the University of Rochester (startup funds to RSM). Dr. Anju Bansal is supported by the National Institutes of Health (R01 AI162168 to AB). Dr. Konstantin Sparrer was supported by the German Research Society (DFG; SPP1923, RC1279, SP 1600/7-1, SP 1600/9-1 to KMS) and the German Federal Ministry for Education and Research (BMBF, project IMMUNOMOD 01KI2014 to KMS). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Mizushima N. Autophagy: process and function. Genes Dev. 2007;21(22):2861–73. doi: 10.1101/gad.1599207 [DOI] [PubMed] [Google Scholar]
2.Parzych KR, Klionsky DJ. An overview of autophagy: morphology, mechanism, and regulation. Antioxid Redox Signal. 2014;20(3):460–73. doi: 10.1089/ars.2013.5371 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Reggiori F, Klionsky DJ. Autophagy in the eukaryotic cell. Eukaryot Cell. 2002;1(1):11–21. doi: 10.1128/EC.01.1.11-21.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Ohsumi Y. Historical landmarks of autophagy research. Cell Res. 2014;24(1):9–23. doi: 10.1038/cr.2013.169 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.King JS. Autophagy across the eukaryotes: is S. cerevisiae the odd one out?. Autophagy. 2012;8(7):1159–62. doi: 10.4161/auto.20527 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Rabinowitz JD, White E. Autophagy and metabolism. Science. 2010;330(6009):1344–8. doi: 10.1126/science.1193497 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Kaur J, Debnath J. Autophagy at the crossroads of catabolism and anabolism. Nat Rev Mol Cell Biol. 2015;16(8):461–72. doi: 10.1038/nrm4024 [DOI] [PubMed] [Google Scholar]
8.Klionsky DJ, Abdel-Aziz AK, Abdelfatah S, Abdellatif M, Abdoli A, Abel S, et al. Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1. Autophagy. 2021;17(1):1–382. doi: 10.1080/15548627.2020.1797280 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Tanida I, Ueno T, Kominami E. LC3 and Autophagy. Methods Mol Biol. 2008;445:77–88. doi: 10.1007/978-1-59745-157-4_4 [DOI] [PubMed] [Google Scholar]
10.Jung CH, Ro S-H, Cao J, Otto NM, Kim D-H. mTOR regulation of autophagy. FEBS Lett. 2010;584(7):1287–95. doi: 10.1016/j.febslet.2010.01.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Codogno P, Mehrpour M, Proikas-Cezanne T. Canonical and non-canonical autophagy: variations on a common theme of self-eating?. Nat Rev Mol Cell Biol. 2011;13(1):7–12. doi: 10.1038/nrm3249 [DOI] [PubMed] [Google Scholar]
12.Zaffagnini G, Martens S. Mechanisms of Selective Autophagy. J Mol Biol. 2016;428(9 Pt A):1714–24. doi: 10.1016/j.jmb.2016.02.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Hurley JH, Young LN. Mechanisms of Autophagy Initiation. Annu Rev Biochem. 2017;86:225–44. doi: 10.1146/annurev-biochem-061516-044820 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Johansen T, Lamark T. Selective Autophagy: ATG8 Family Proteins, LIR Motifs and Cargo Receptors. J Mol Biol. 2020;432(1):80–103. doi: 10.1016/j.jmb.2019.07.016 [DOI] [PubMed] [Google Scholar]
15.Dikic I, Elazar Z. Mechanism and medical implications of mammalian autophagy. Nat Rev Mol Cell Biol. 2018;19(6):349–64. doi: 10.1038/s41580-018-0003-4 [DOI] [PubMed] [Google Scholar]
16.Menon MB, Dhamija S. Beclin 1 Phosphorylation - at the Center of Autophagy Regulation. Front Cell Dev Biol. 2018;6:137. doi: 10.3389/fcell.2018.00137 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Nascimbeni AC, Codogno P, Morel E. Local detection of PtdIns3P at autophagosome biogenesis membrane platforms. Autophagy. 2017;13(9):1602–12. doi: 10.1080/15548627.2017.1341465 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Matsunaga K, Morita E, Saitoh T, Akira S, Ktistakis NT, Izumi T, et al. Autophagy requires endoplasmic reticulum targeting of the PI3-kinase complex via Atg14L. J Cell Biol. 2010;190(4):511–21. doi: 10.1083/jcb.200911141 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Brier LW, Ge L, Stjepanovic G, Thelen AM, Hurley JH, Schekman R. Regulation of LC3 lipidation by the autophagy-specific class III phosphatidylinositol-3 kinase complex. Mol Biol Cell. 2019;30(9):1098–107. doi: 10.1091/mbc.E18-11-0743 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Mizushima N, Yoshimori T, Ohsumi Y. The role of Atg proteins in autophagosome formation. Annu Rev Cell Dev Biol. 2011;27:107–32. doi: 10.1146/annurev-cellbio-092910-154005 [DOI] [PubMed] [Google Scholar]
21.Kirisako T, Ichimura Y, Okada H, Kabeya Y, Mizushima N, Yoshimori T, et al. The reversible modification regulates the membrane-binding state of Apg8/Aut7 essential for autophagy and the cytoplasm to vacuole targeting pathway. J Cell Biol. 2000;151(2):263–76. doi: 10.1083/jcb.151.2.263 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Behrends C, Fulda S. Receptor proteins in selective autophagy. Int J Cell Biol. 2012;2012:673290. doi: 10.1155/2012/673290 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Xu Z, Yang L, Xu S, Zhang Z, Cao Y. The receptor proteins: pivotal roles in selective autophagy. Acta Biochim Biophys Sin (Shanghai). 2015;47(8):571–80. doi: 10.1093/abbs/gmv055 [DOI] [PubMed] [Google Scholar]
24.Reggiori F, Ungermann C. Autophagosome Maturation and Fusion. J Mol Biol. 2017;429(4):486–96. doi: 10.1016/j.jmb.2017.01.002 [DOI] [PubMed] [Google Scholar]
25.Itakura E, Kishi C, Inoue K, Mizushima N. Beclin 1 forms two distinct phosphatidylinositol 3-kinase complexes with mammalian Atg14 and UVRAG. Mol Biol Cell. 2008;19(12):5360–72. doi: 10.1091/mbc.e08-01-0080 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Itakura E, Mizushima N. Atg14 and UVRAG: mutually exclusive subunits of mammalian Beclin 1-PI3K complexes. Autophagy. 2009;5(4):534–6. doi: 10.4161/auto.5.4.8062 [DOI] [PubMed] [Google Scholar]
27.Mizushima N, Yoshimori T. How to interpret LC3 immunoblotting. Autophagy. 2007;3(6):542–5. doi: 10.4161/auto.4600 [DOI] [PubMed] [Google Scholar]
28.Schmid D, Münz C. Innate and adaptive immunity through autophagy. Immunity. 2007;27(1):11–21. doi: 10.1016/j.immuni.2007.07.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Kudchodkar SB, Levine B. Viruses and autophagy. Rev Med Virol. 2009;19(6):359–78. doi: 10.1002/rmv.630 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Cavignac Y, Esclatine A. Herpesviruses and autophagy: catch me if you can!. Viruses. 2010;2(1):314–33. doi: 10.3390/v2010314 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Jordan TX, Randall G. Manipulation or capitulation: virus interactions with autophagy. Microbes Infect. 2012;14(2):126–39. doi: 10.1016/j.micinf.2011.09.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Orvedahl A, Levine B. Viral evasion of autophagy. Autophagy. 2008;4(3):280–5. doi: 10.4161/auto.5289 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Tang S-W, Ducroux A, Jeang K-T, Neuveut C. Impact of cellular autophagy on viruses: Insights from hepatitis B virus and human retroviruses. J Biomed Sci. 2012;19(1):92. doi: 10.1186/1423-0127-19-92 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Choi Y, Bowman JW, Jung JU. Autophagy during viral infection - a double-edged sword. Nat Rev Microbiol. 2018;16(6):341–54. doi: 10.1038/s41579-018-0003-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Kyei GB, Dinkins C, Davis AS, Roberts E, Singh SB, Dong C, et al. Autophagy pathway intersects with HIV-1 biosynthesis and regulates viral yields in macrophages. J Cell Biol. 2009;186(2):255–68. doi: 10.1083/jcb.200903070 [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Denizot M, Varbanov M, Espert L, Robert-Hebmann V, Sagnier S, Garcia E, et al. HIV-1 gp41 fusogenic function triggers autophagy in uninfected cells. Autophagy. 2008;4(8):998–1008. doi: 10.4161/auto.6880 [DOI] [PubMed] [Google Scholar]
37.Li JCB, Au K, Fang J, Yim HCH, Chow K, Ho P, et al. HIV-1 trans-activator protein dysregulates IFN-γ signaling and contributes to the suppression of autophagy induction. AIDS. 2011;25(1):15–25. doi: 10.1097/QAD.0b013e328340fd61 [DOI] [PubMed] [Google Scholar]
38.Campbell GR, Rawat P, Bruckman RS, Spector SA. Human Immunodeficiency Virus Type 1 Nef Inhibits Autophagy through Transcription Factor EB Sequestration. PLoS Pathog. 2015;11(6):e1005018. doi: 10.1371/journal.ppat.1005018 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Campbell GR, Spector SA. Inhibition of human immunodeficiency virus type-1 through autophagy. Curr Opin Microbiol. 2013;16(3):349–54. doi: 10.1016/j.mib.2013.05.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Chang C, Young LN, Morris KL, von Bülow S, Schöneberg J, Yamamoto-Imoto H, et al. Bidirectional Control of Autophagy by BECN1 BARA Domain Dynamics. Mol Cell. 2019;73(2):339-353.e6. doi: 10.1016/j.molcel.2018.10.035 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Dinkins C, Pilli M, Kehrl JH. Roles of autophagy in HIV infection. Immunol Cell Biol. 2015;93(1):11–7. doi: 10.1038/icb.2014.88 [DOI] [PubMed] [Google Scholar]
42.Nardacci R, Ciccosanti F, Marsella C, Ippolito G, Piacentini M, Fimia GM. Role of autophagy in HIV infection and pathogenesis. J Intern Med. 2017;281(5):422–32. doi: 10.1111/joim.12596 [DOI] [PubMed] [Google Scholar]
43.Castro-Gonzalez S, Chen Y, Benjamin J, Shi Y, Serra-Moreno R. Residues T48 and A49 in HIV-1 NL4-3 Nef are responsible for the counteraction of autophagy initiation, which prevents the ubiquitin-dependent degradation of Gag through autophagosomes. Retrovirology. 2021;18(1):33. doi: 10.1186/s12977-021-00576-y [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Castro-Gonzalez S, Shi Y, Colomer-Lluch M, Song Y, Mowery K, Almodovar S, et al. HIV-1 Nef counteracts autophagy restriction by enhancing the association between BECN1 and its inhibitor BCL2 in a PRKN-dependent manner. Autophagy. 2021;17(2):553–77. doi: 10.1080/15548627.2020.1725401 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Alfaisal J, Machado A, Galais M, Robert-Hebmann V, Arnaune-Pelloquin L, Espert L, et al. HIV-1 Vpr inhibits autophagy during the early steps of infection of CD4 T cells. Biol Cell. 2019;111(12):308–18. doi: 10.1111/boc.201900071 [DOI] [PubMed] [Google Scholar]
46.Shoji-Kawata S, Sumpter R, Leveno M, Campbell GR, Zou Z, Kinch L, et al. Identification of a candidate therapeutic autophagy-inducing peptide. Nature. 2013;494(7436):201–6. doi: 10.1038/nature11866 [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Sagnier S, Daussy CF, Borel S, Robert-Hebmann V, Faure M, Blanchet FP, et al. Autophagy restricts HIV-1 infection by selectively degrading Tat in CD4+ T lymphocytes. J Virol. 2015;89(1):615–25. doi: 10.1128/JVI.02174-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Chen BK, Rousso I, Shim S, Kim PS. Efficient assembly of an HIV-1/MLV Gag-chimeric virus in murine cells. Proc Natl Acad Sci U S A. 2001;98(26):15239–44. doi: 10.1073/pnas.261563198 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Inlora J, Chukkapalli V, Bedi S, Ono A. Molecular Determinants Directing HIV-1 Gag Assembly to Virus-Containing Compartments in Primary Macrophages. J Virol. 2016;90(19):8509–19. doi: 10.1128/JVI.01004-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Molle D, Segura-Morales C, Camus G, Berlioz-Torrent C, Kjems J, Basyuk E, et al. Endosomal trafficking of HIV-1 gag and genomic RNAs regulates viral egress. J Biol Chem. 2009;284(29):19727–43. doi: 10.1074/jbc.M109.019844 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Freed EO. HIV-1 gag proteins: diverse functions in the virus life cycle. Virology. 1998;251(1):1–15. doi: 10.1006/viro.1998.9398 [DOI] [PubMed] [Google Scholar]
52.Huseby D, Barklis RL, Alfadhli A, Barklis E. Assembly of human immunodeficiency virus precursor gag proteins. J Biol Chem. 2005;280(18):17664–70. doi: 10.1074/jbc.M412325200 [DOI] [PubMed] [Google Scholar]
53.Hubbard VM, Valdor R, Patel B, Singh R, Cuervo AM, Macian F. Macroautophagy regulates energy metabolism during effector T cell activation. J Immunol. 2010;185(12):7349–57. doi: 10.4049/jimmunol.1000576 [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Jacquin E, Apetoh L. Cell-Intrinsic Roles for Autophagy in Modulating CD4 T Cell Functions. Front Immunol. 2018;9:1023. doi: 10.3389/fimmu.2018.01023 [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Li C, Capan E, Zhao Y, Zhao J, Stolz D, Watkins SC, et al. Autophagy is induced in CD4+ T cells and important for the growth factor-withdrawal cell death. J Immunol. 2006;177(8):5163–8. doi: 10.4049/jimmunol.177.8.5163 [DOI] [PubMed] [Google Scholar]
56.Watanabe R, Fujii H, Shirai T, Saito S, Ishii T, Harigae H. Autophagy plays a protective role as an anti-oxidant system in human T cells and represents a novel strategy for induction of T-cell apoptosis. Eur J Immunol. 2014;44(8):2508–20. doi: 10.1002/eji.201344248 [DOI] [PubMed] [Google Scholar]
57.Liu Q, Xu C, Kirubakaran S, Zhang X, Hur W, Liu Y, et al. Characterization of Torin2, an ATP-competitive inhibitor of mTOR, ATM, and ATR. Cancer Res. 2013;73(8):2574–86. doi: 10.1158/0008-5472.CAN-12-1702 [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Mauvezin C, Neufeld TP. Bafilomycin A1 disrupts autophagic flux by inhibiting both V-ATPase-dependent acidification and Ca-P60A/SERCA-dependent autophagosome-lysosome fusion. Autophagy. 2015;11(8):1437–8. doi: 10.1080/15548627.2015.1066957 [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Zhao J, Zhai B, Gygi SP, Goldberg AL. mTOR inhibition activates overall protein degradation by the ubiquitin proteasome system as well as by autophagy. Proc Natl Acad Sci U S A. 2015;112(52):15790–7. doi: 10.1073/pnas.1521919112 [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Livneh I, Cohen-Kaplan V, Fabre B, Abramovitch I, Lulu C, Nataraj NB, et al. Regulation of nucleo-cytosolic 26S proteasome translocation by aromatic amino acids via mTOR is essential for cell survival under stress. Mol Cell. 2023;83(18):3333-3346.e5. doi: 10.1016/j.molcel.2023.08.016 [DOI] [PubMed] [Google Scholar]
61.Puertollano R. mTOR and lysosome regulation. F1000Prime Rep. 2014;6:52. doi: 10.12703/P6-52 [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Sardiello M, Palmieri M, di Ronza A, Medina DL, Valenza M, Gennarino VA, et al. A gene network regulating lysosomal biogenesis and function. Science. 2009;325(5939):473–7. doi: 10.1126/science.1174447 [DOI] [PubMed] [Google Scholar]
63.Sanjuan MA, Dillon CP, Tait SWG, Moshiach S, Dorsey F, Connell S, et al. Toll-like receptor signalling in macrophages links the autophagy pathway to phagocytosis. Nature. 2007;450(7173):1253–7. doi: 10.1038/nature06421 [DOI] [PubMed] [Google Scholar]
64.Ye X, Zhou X-J, Zhang H. Exploring the Role of Autophagy-Related Gene 5 (ATG5) Yields Important Insights Into Autophagy in Autoimmune/Autoinflammatory Diseases. Front Immunol. 2018;9:2334. doi: 10.3389/fimmu.2018.02334 [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Noda NN, Fujioka Y, Hanada T, Ohsumi Y, Inagaki F. Structure of the Atg12-Atg5 conjugate reveals a platform for stimulating Atg8-PE conjugation. EMBO Rep. 2013;14(2):206–11. doi: 10.1038/embor.2012.208 [DOI] [PMC free article] [PubMed] [Google Scholar]
66.Otomo C, Metlagel Z, Takaesu G, Otomo T. Structure of the human ATG12~ATG5 conjugate required for LC3 lipidation in autophagy. Nat Struct Mol Biol. 2013;20(1):59–66. doi: 10.1038/nsmb.2431 [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Bago R, Malik N, Munson MJ, Prescott AR, Davies P, Sommer E, et al. Characterization of VPS34-IN1, a selective inhibitor of Vps34, reveals that the phosphatidylinositol 3-phosphate-binding SGK3 protein kinase is a downstream target of class III phosphoinositide 3-kinase. Biochem J. 2014;463(3):413–27. doi: 10.1042/BJ20140889 [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Mizushima N, Yoshimori T, Levine B. Methods in mammalian autophagy research. Cell. 2010;140(3):313–26. doi: 10.1016/j.cell.2010.01.028 [DOI] [PMC free article] [PubMed] [Google Scholar]
69.Parrish NF, Gao F, Li H, Giorgi EE, Barbian HJ, Parrish EH, et al. Phenotypic properties of transmitted founder HIV-1. Proc Natl Acad Sci U S A. 2013;110(17):6626–33. doi: 10.1073/pnas.1304288110 [DOI] [PMC free article] [PubMed] [Google Scholar]
70.Fregoso OI, Emerman M. Activation of the DNA Damage Response Is a Conserved Function of HIV-1 and HIV-2 Vpr That Is Independent of SLX4 Recruitment. mBio. 2016;7(5):e01433-16. doi: 10.1128/mBio.01433-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
71.Tristem M, Marshall C, Karpas A, Hill F. Evolution of the primate lentiviruses: evidence from vpx and vpr. EMBO J. 1992;11(9):3405–12. doi: 10.1002/j.1460-2075.1992.tb05419.x [DOI] [PMC free article] [PubMed] [Google Scholar]
72.Tristem M, Purvis A, Quicke DL. Complex evolutionary history of primate lentiviral vpr genes. Virology. 1998;240(2):232–7. doi: 10.1006/viro.1997.8929 [DOI] [PubMed] [Google Scholar]
73.Apetrei CHB, Rambaut A, Wolinsky S, Brister JR, Keele B, Faser C. HIV Sequence Compendium 2021. In: Theoretical Biology and Biophysics Group LANL, editor. Los Alamos National Laboratory. 2021. [Google Scholar]
74.Lamark T, Kirkin V, Dikic I, Johansen T. NBR1 and p62 as cargo receptors for selective autophagy of ubiquitinated targets. Cell Cycle. 2009;8(13):1986–90. doi: 10.4161/cc.8.13.8892 [DOI] [PubMed] [Google Scholar]
75.White J, Suklabaidya S, Vo MT, Choi YB, Harhaj EW. Multifaceted roles of TAX1BP1 in autophagy. Autophagy. 2023;19(1):44–53. doi: 10.1080/15548627.2022.2070331 [DOI] [PMC free article] [PubMed] [Google Scholar]
76.Ying H, Yue BYJT. Optineurin: The autophagy connection. Exp Eye Res. 2016;144:73–80. doi: 10.1016/j.exer.2015.06.029 [DOI] [PMC free article] [PubMed] [Google Scholar]
77.Fan S, Wu K, Zhao M, Zhu E, Ma S, Chen Y, et al. The Role of Autophagy and Autophagy Receptor NDP52 in Microbial Infections. Int J Mol Sci. 2020;21(6):2008. doi: 10.3390/ijms21062008 [DOI] [PMC free article] [PubMed] [Google Scholar]
78.Li Y, Zheng W, Lu Y, Zheng Y, Pan L, Wu X, et al. BNIP3L/NIX-mediated mitophagy: molecular mechanisms and implications for human disease. Cell Death Dis. 2021;13(1):14. doi: 10.1038/s41419-021-04469-y [DOI] [PMC free article] [PubMed] [Google Scholar]
79.Deng Z, Purtell K, Lachance V, Wold MS, Chen S, Yue Z. Autophagy Receptors and Neurodegenerative Diseases. Trends Cell Biol. 2017;27(7):491–504. doi: 10.1016/j.tcb.2017.01.001 [DOI] [PubMed] [Google Scholar]
80.Hyer ML, Milhollen MA, Ciavarri J, Fleming P, Traore T, Sappal D, et al. A small-molecule inhibitor of the ubiquitin activating enzyme for cancer treatment. Nat Med. 2018;24(2):186–93. doi: 10.1038/nm.4474 [DOI] [PubMed] [Google Scholar]
81.Jacquot G, Le Rouzic E, David A, Mazzolini J, Bouchet J, Bouaziz S, et al. Localization of HIV-1 Vpr to the nuclear envelope: impact on Vpr functions and virus replication in macrophages. Retrovirology. 2007;4:84. doi: 10.1186/1742-4690-4-84 [DOI] [PMC free article] [PubMed] [Google Scholar]
82.Guo HJ, Rahimi N, Tadi P. Ubiquitination. Treasure Island (FL): StatPearls. 2025. [Google Scholar]
83.Nityanandam R, Serra-Moreno R. BCA2/Rabring7 targets HIV-1 Gag for lysosomal degradation in a tetherin-independent manner. PLoS Pathog. 2014;10(5):e1004151. doi: 10.1371/journal.ppat.1004151 [DOI] [PMC free article] [PubMed] [Google Scholar]
84.Lamark T, Perander M, Outzen H, Kristiansen K, Øvervatn A, Michaelsen E, et al. Interaction codes within the family of mammalian Phox and Bem1p domain-containing proteins. J Biol Chem. 2003;278(36):34568–81. doi: 10.1074/jbc.M303221200 [DOI] [PubMed] [Google Scholar]
85.Vadlamudi RK, Joung I, Strominger JL, Shin J. p62, a phosphotyrosine-independent ligand of the SH2 domain of p56lck, belongs to a new class of ubiquitin-binding proteins. J Biol Chem. 1996;271(34):20235–7. doi: 10.1074/jbc.271.34.20235 [DOI] [PubMed] [Google Scholar]
86.Johansen T, Lamark T. Selective autophagy mediated by autophagic adapter proteins. Autophagy. 2011;7(3):279–96. doi: 10.4161/auto.7.3.14487 [DOI] [PMC free article] [PubMed] [Google Scholar]
87.Szucs G, Melnick JL, Hollinger FB. A simple assay based on HIV infection preventing the reclustering of MT-4 cells. Bull World Health Organ. 1988;66(6):729–37. [PMC free article] [PubMed] [Google Scholar]
88.Edwards VL, McComb E, Gleghorn JP, Forney L, Bavoil PM, Ravel J. Three-dimensional models of the cervicovaginal epithelia to study host-microbiome interactions and sexually transmitted infections. Pathog Dis. 2022;80(1):ftac026. doi: 10.1093/femspd/ftac026 [DOI] [PMC free article] [PubMed] [Google Scholar]
89.Futter CE, Collinson LM, Backer JM, Hopkins CR. Human VPS34 is required for internal vesicle formation within multivesicular endosomes. J Cell Biol. 2001;155(7):1251–64. doi: 10.1083/jcb.200108152 [DOI] [PMC free article] [PubMed] [Google Scholar]
90.Ali A, Ng HL, Blankson JN, Burton DR, Buckheit RW 3rd, Moldt B, et al. Highly Attenuated Infection With a Vpr-Deleted Molecular Clone of Human Immunodeficiency Virus-1. J Infect Dis. 2018;218(9):1447–52. doi: 10.1093/infdis/jiy346 [DOI] [PMC free article] [PubMed] [Google Scholar]
91.Guenzel CA, Hérate C, Benichou S. HIV-1 Vpr-a still “enigmatic multitasker”. Front Microbiol. 2014;5:127. doi: 10.3389/fmicb.2014.00127 [DOI] [PMC free article] [PubMed] [Google Scholar]
92.Belzile J-P, Duisit G, Rougeau N, Mercier J, Finzi A, Cohen EA. HIV-1 Vpr-mediated G2 arrest involves the DDB1-CUL4AVPRBP E3 ubiquitin ligase. PLoS Pathog. 2007;3(7):e85. doi: 10.1371/journal.ppat.0030085 [DOI] [PMC free article] [PubMed] [Google Scholar]
93.Wen X, Duus KM, Friedrich TD, de Noronha CMC. The HIV1 protein Vpr acts to promote G2 cell cycle arrest by engaging a DDB1 and Cullin4A-containing ubiquitin ligase complex using VprBP/DCAF1 as an adaptor. J Biol Chem. 2007;282(37):27046–57. doi: 10.1074/jbc.M703955200 [DOI] [PubMed] [Google Scholar]
94.Reuschl AK, Mesner D, Shivkumar M, Whelan MVX, Pallett LJ, Guerra-Assuncao JA, et al. HIV-1 Vpr drives a tissue residency-like phenotype during selective infection of resting memory T cells. Cell reports. 2022;39(2):110650. doi: 10.1016/j.celrep.2022.110650 [DOI] [PMC free article] [PubMed] [Google Scholar]
95.Klute S, Sparrer KMJ. Friends and Foes: The Ambivalent Role of Autophagy in HIV-1 Infection. Viruses. 2024;16(4):500. doi: 10.3390/v16040500 [DOI] [PMC free article] [PubMed] [Google Scholar]
96.Shi B, Huang Q-Q, Birkett R, Doyle R, Dorfleutner A, Stehlik C, et al. SNAPIN is critical for lysosomal acidification and autophagosome maturation in macrophages. Autophagy. 2017;13(2):285–301. doi: 10.1080/15548627.2016.1261238 [DOI] [PMC free article] [PubMed] [Google Scholar]
97.Santerre M, Arjona SP, Allen CN, Callen S, Buch S, Sawaya BE. HIV-1 Vpr protein impairs lysosome clearance causing SNCA/alpha-synuclein accumulation in neurons. Autophagy. 2021;17(7):1768–82. doi: 10.1080/15548627.2021.1915641 [DOI] [PMC free article] [PubMed] [Google Scholar]
98.Kirkin V, Lamark T, Johansen T, Dikic I. NBR1 cooperates with p62 in selective autophagy of ubiquitinated targets. Autophagy. 2009;5(5):732–3. doi: 10.4161/auto.5.5.8566 [DOI] [PubMed] [Google Scholar]
99.Adachi A, Gendelman HE, Koenig S, Folks T, Willey R, Rabson A, et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J Virol. 1986;59(2):284–91. doi: 10.1128/JVI.59.2.284-291.1986 [DOI] [PMC free article] [PubMed] [Google Scholar]
100.Schwartz O, Maréchal V, Danos O, Heard JM. Human immunodeficiency virus type 1 Nef increases the efficiency of reverse transcription in the infected cell. J Virol. 1995;69(7):4053–9. doi: 10.1128/JVI.69.7.4053-4059.1995 [DOI] [PMC free article] [PubMed] [Google Scholar]
101.Jia B, Serra-Moreno R, Neidermyer W, Rahmberg A, Mackey J, Fofana IB, et al. Species-specific activity of SIV Nef and HIV-1 Vpu in overcoming restriction by tetherin/BST2. PLoS Pathog. 2009;5(5):e1000429. doi: 10.1371/journal.ppat.1000429 [DOI] [PMC free article] [PubMed] [Google Scholar]
102.Serra-Moreno R, Zimmermann K, Stern LJ, Evans DT. Tetherin/BST-2 antagonism by Nef depends on a direct physical interaction between Nef and tetherin, and on clathrin-mediated endocytosis. PLoS Pathog. 2013;9(7):e1003487. doi: 10.1371/journal.ppat.1003487 [DOI] [PMC free article] [PubMed] [Google Scholar]
103.Keele BF, Giorgi EE, Salazar-Gonzalez JF, Decker JM, Pham KT, Salazar MG, et al. Identification and characterization of transmitted and early founder virus envelopes in primary HIV-1 infection. Proc Natl Acad Sci U S A. 2008;105(21):7552–7. doi: 10.1073/pnas.0802203105 [DOI] [PMC free article] [PubMed] [Google Scholar]
104.Salazar-Gonzalez JF, Salazar MG, Keele BF, Learn GH, Giorgi EE, Li H, et al. Genetic identity, biological phenotype, and evolutionary pathways of transmitted/founder viruses in acute and early HIV-1 infection. J Exp Med. 2009;206(6):1273–89. doi: 10.1084/jem.20090378 [DOI] [PMC free article] [PubMed] [Google Scholar]
105.Deymier MJ, Claiborne DT, Ende Z, Ratner HK, Kilembe W, Allen S, et al. Particle infectivity of HIV-1 full-length genome infectious molecular clones in a subtype C heterosexual transmission pair following high fidelity amplification and unbiased cloning. Virology. 2014;468–470:454–61. doi: 10.1016/j.virol.2014.08.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
106.Suree N, Koizumi N, Sahakyan A, Shimizu S, An DS. A novel HIV-1 reporter virus with a membrane-bound Gaussia princeps luciferase. J Virol Methods. 2012;183(1):49–56. doi: 10.1016/j.jviromet.2012.03.028 [DOI] [PMC free article] [PubMed] [Google Scholar]
107.McCauley SM, Kim K, Nowosielska A, Dauphin A, Yurkovetskiy L, Diehl WE, et al. Intron-containing RNA from the HIV-1 provirus activates type I interferon and inflammatory cytokines. Nat Commun. 2018;9(1):5305. doi: 10.1038/s41467-018-07753-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
108.Imam S, Talley S, Nelson RS, Dharan A, O’Connor C, Hope TJ, et al. TRIM5α Degradation via Autophagy Is Not Required for Retroviral Restriction. J Virol. 2016;90(7):3400–10. doi: 10.1128/JVI.03033-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
109.Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014;11(8):783–4. doi: 10.1038/nmeth.3047 [DOI] [PMC free article] [PubMed] [Google Scholar]
110.Chen Y, Klute S, Sparrer KMJ, Serra-Moreno R. RAB5 is a host dependency factor for the generation of SARS-CoV-2 replication organelles. mBio. 2025;16(5):e0331424. doi: 10.1128/mbio.03314-24 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS Pathog. doi: 10.1371/journal.ppat.1014020.r001

Decision Letter 0

Edward Campbell

26 Aug 2025

HIV-1 Vpr is a novel autophagy target and its susceptibility to autophagy reduces virus transmission

PLOS Pathogens

Dear Dr. Serra-Moreno,

Thank you for submitting your manuscript to PLOS Pathogens. After careful consideration, we feel that it has merit but does not fully meet PLOS Pathogens's publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript within 60 days Oct 25 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plospathogens@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/ppathogens/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

* A rebuttal letter that responds to each point raised by the editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. This file does not need to include responses to any formatting updates and technical items listed in the 'Journal Requirements' section below.

* A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

* An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, competing interests statement, or data availability statement, please make these updates within the submission form at the time of resubmission. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

We look forward to receiving your revised manuscript.

Kind regards,

Edward M Campbell, PhD

Academic Editor

PLOS Pathogens

Susan Ross

Section Editor

PLOS Pathogens

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0003-2946-9497

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

Journal Requirements:

1) Please provide an Author Summary. This should appear in your manuscript between the Abstract (if applicable) and the Introduction, and should be 150-200 words long. The aim should be to make your findings accessible to a wide audience that includes both scientists and non-scientists. Sample summaries can be found on our website under Submission Guidelines:

https://journals.plos.org/plospathogens/s/submission-guidelines#loc-parts-of-a-submission

2) We have noticed that you have uploaded Supporting Information files, but you have not included a list of legends. Please add a full list of legends for your Supporting Information files after the references list.

3) Some material included in your submission may be copyrighted. According to PLOSu2019s copyright policy, authors who use figures or other material (e.g., graphics, clipart, maps) from another author or copyright holder must demonstrate or obtain permission to publish this material under the Creative Commons Attribution 4.0 International (CC BY 4.0) License used by PLOS journals. Please closely review the details of PLOSu2019s copyright requirements here: PLOS Licenses and Copyright. If you need to request permissions from a copyright holder, you may use PLOS's Copyright Content Permission form.

Please respond directly to this email and provide any known details concerning your material's license terms and permissions required for reuse, even if you have not yet obtained copyright permissions or are unsure of your material's copyright compatibility. Once you have responded and addressed all other outstanding technical requirements, you may resubmit your manuscript within Editorial Manager.

Potential Copyright Issues:

i) Figure S5. Please confirm whether you drew the images / clip-art within the figure panels by hand. If you did not draw the images, please provide (a) a link to the source of the images or icons and their license / terms of use; or (b) written permission from the copyright holder to publish the images or icons under our CC BY 4.0 license. Alternatively, you may replace the images with open source alternatives. See these open source resources you may use to replace images / clip-art:

- https://commons.wikimedia.org

- https://openclipart.org/.

ii) We note that Figures 10 and S4 are created through BioRender. Please confirm that you hold a Premium account and provide a pdf copy of the CC BY 4.0 Licence as provided by BioRender. For instructions on how to generate a CC BY 4.0 license for your figure, please see the guidelines here: https://help.biorender.com/hc/en-gb/articles/21282341238045-Publishing-in-open-access-resources.

If you are using the free assets from BioRender, we are unable to publish these images as they are licenced under a stricter licence than CC BY 4.0. In this case we ask you to remove the BioRender images and replace them with open source alternatives.

See these open source resources you may use to replace images / clip-art:

- https://bioart.niaid.nih.gov/

- https://bioicons.com/

- https://healthicons.org/

- https://scidraw.io/

- https://reactome.org/icon-lib

- https://www.phylopic.org/images

- https://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.3002395

4) We note that your Data Availability Statement is currently as follows: "All the data is found in the manuscript and the supplementary materials". Please confirm at this time whether or not your submission contains all raw data required to replicate the results of your study. Authors must share the “minimal data set” for their submission. PLOS defines the minimal data set to consist of the data required to replicate all study findings reported in the article, as well as related metadata and methods (https://journals.plos.org/plosone/s/data-availability#loc-minimal-data-set-definition).

For example, authors should submit the following data:

1) The values behind the means, standard deviations and other measures reported;

2) The values used to build graphs;

3) The points extracted from images for analysis..

Authors do not need to submit their entire data set if only a portion of the data was used in the reported study.

If your submission does not contain these data, please either upload them as Supporting Information files or deposit them to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of recommended repositories, please see https://journals.plos.org/plosone/s/recommended-repositories.

If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent. If data are owned by a third party, please indicate how others may request data access.

5) Please amend your detailed Financial Disclosure statement. This is published with the article. It must therefore be completed in full sentences and contain the exact wording you wish to be published.

1) State the initials, alongside each funding source, of each author to receive each grant. For example: "This work was supported by the National Institutes of Health (####### to AM; ###### to CJ) and the National Science Foundation (###### to AM)."

2) State what role the funders took in the study. If the funders had no role in your study, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

3) If any authors received a salary from any of your funders, please state which authors and which funders.

6) Please ensure that the funders and grant numbers match between the Financial Disclosure field and the Funding Information tab in your submission form. Note that the funders must be provided in the same order in both places as well.

Note: If the reviewer comments include a recommendation to cite specific previously published works, please review and evaluate these publications to determine whether they are relevant and should be cited. There is no requirement to cite these works unless the editor has indicated otherwise.

Reviewers' Comments:

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: This study from the Serra-Moreno group is an elegant demonstration that Vpr-derived from lab adapted HIV-1 NL4-3 is an autophagy target itself, whereas transmitted-founder virus derived Vprs are resistant towards autophagy. By a series of convincing experiments, the authors show that NL4-3 Vpr is sensitive towards degradation when autophagy is induced and this is true in Jurkat CD4+ T cells as well as in primary CD4+ T cells. They show localization of Vpr to autophagosomes; by sequence alignment with T/F Vprs and comprehensive mutagenesis they identify residues in Vpr that confer resistance to autophagy sensitivity of Vpr. Of note, lab-adapted NL4-3 Vpr interacts with autophagy receptors in contrast to T/F virus-derived Vpr. Ubiquitination of Vpr does not seem to be a determinant of Vpr-depletion via autophagy. However, Vpr-sensitivity towards autophagy might be a determinant that lowers efficient HIV-1 transmission in their models.

Altogether, the authors provide a set of convincing results that largely support the conclusions. The strength of the manuscript is the consequent quantification of viral protein expression, i.e. Vpr levels in the presence/absence of autophagy inhibitors in CD4+ T cells (Jurkats) and primary CD4+ T cells. Furthermore, the mutagenesis approach and reverse genetics to delineate the exact residues conferring Vpr-resistance to autophagy are elegant and convincing.

In my opinion less clear remains the phenotypic characterization in terms of biological relevance/HIV-1 transmission (figure 10, see specific comments below). Furthermore, I would like to see some more controls in order to corroborate certain aspects of the manuscript.

Story-telling wise, while I really enjoyed reading the results section, the introduction should be shortened, since it virtually is repetitive to the abstract and pre-introduces all the results. The discussion is again largely redundant to the results and mainly re-iterates them, instead of discussing the potential broader relevance of the findings. In this regard, I do not see any realistic therapeutic application of autophagy inhibition in the field of HIV antivirals. We are in the lenacapavir era, so do you really want to argue somebody would develop an autophagy exploiting approach to target HIV-1? Please tune down these statements.

Specific comments:

1. Figure 2A/D; I do not agree that rapamycin and torrin2 cause a dose dependent reduction in Vif levels

2. Figure 4B/C: Can you perform complementary microscopy to potentially demonstrate that Nef displaces Vpr from autophagosomes? Are T/F Vprs not located in autophagosomes? Upon introduction of autophagy-resistance conferring mutations in Vpr, does it not localize to autophagosomes anymore?

3. Figure 7G: The “further increase” in Vpr level upon NDP52 KO is not convincing; perform signal quantification via multiple WBlots as done before and I would suggest to include an NDP52 single KO to corroborate this

4. Figure 10: Unfortunately, you missed to include a delVpr variant in these experiments throughout to narrow down the relative importance of the autophagy-resistance versus other Vpr functions, respectively a loss of Vpr-expression;

Furthermore, in my opinion, there is a logical gap. As far as I can see the employed constructs are Nef-intact and the authors argue themselves that NL4-3 Nef counteracts autophagy in a way that Vpr-sensitivity towards autophagy is not a determinant, especially in Jurkat CD4+ T cells (Figure 1A). Therefore, the authors should include a Nef-defective version of their constructs in these assays. On top, since they elegantly identified Vpr-mutations conferring resistance to autophagy it would have been straight forward to test NL4-3 Vpr vs NL4-3 Vpr I37P H45Y (that is resistant to autophagy). This would allow to more directly conclude on autophagy as an underlying cause for potential differences as compared to a benchmark of NL4-3 Vpr vs the T/F CH077.

5. line 495: careful, as far as I am aware of none of these observations were clearly confirmed in primary T cells or even Jurkats. Other non-yet identified Vpr-functions might facilitate or enhance transmission in their systems. It would have been very nice to include primary CD4+ T cells in their models in figure 10; however I appreciate that this goes beyond what one could expect at this stage. I strongly encourage the authors to discuss the Jolly paper in this regard (PMID: 35417711).

6. line 581: again, if Nef of lab adapted NL4-3 inhibits autophagy, especially in cell lines, this argumentation does not make sense

7. the authors do not really discuss or address potential underlying reasons for discrepant results compared to an earlier study that demonstrates modulation of autophagy by Vpr (PMID: 31628772). Different cell systems or Vpr alleles can not serve as an explanation (Reference 45 uses also NL4-3 Vpr and Jurkat cells, argumentation in lines 500 – 503).

8. Apparently, the broader relevance and biological significance of the authors findings is limited, as Vpr-sensitivity towards autophagy seems to be the exception from the rule. However, as most studies employ HIV-1 NL4-3 and NL4-3 Vpr, it is very important to stress this potential confounding factor in studies trying to find host cell factors that are depleted by Vpr. The authors might want to discuss this and raise awareness to such limitations imposed by autophagy sensitivity of NL4-3 Vpr.

Reviewer #2: This manuscript investigates the degradation of HIV-1 Vpr by autophagy and claims that autophagy resistance of Vpr in transmitted/founder (TFV) viruses promotes transmission fitness, in contrast to lab-adapted strains like NL4-3. While the topic is conceptually interesting, the work suffers from serious gaps in experimental rigor, overreaching conclusions, and insufficient mechanistic resolution. The central problem is the incomplete and sometimes misleading portrayal of autophagy dynamics—particularly whether Vpr is simply a passive target of autophagy or also an active modulator of the pathway.

Reviewer #3: In this submission, Chen et al. report HIV Vpr as a novel substrate/target protein of the macroautophagy pathway, meaning that a subpopulation of Vpr in cells is degraded in an autophagosome-dependent pathway involving autophagosome-lysosome fusion (i.e. macroautophagy). The authors provide mostly clear findings that autophagy induction by mTOR inhibitors results in a certain degree of Vpr protein loss, in support of their main conclusion. Significantly, the authors show that knockout of autophagic receptors results in recovery of Vpr protein following mTOR inhibition. Furthermore, the authors show that certain lab-adapted Vpr proteins (like that of NL4-3) are more susceptible to turnover by autophagy relative to Vpr proteins encoded by transmitted/founder viruses. This suggests that there may be selective pressure for Vpr to avoid recognition and destruction by the autophagy machinery. I mostly appreciated how the manuscript was written and how the authors comprehensively cover the previous literature. However, I think the manuscript could be significantly improved with modifications to the text and experimental additions.

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".

Reviewer #1: Experiments I suggested to improve data shown in Fig.4B/C, Fig.7 and Fig.10

Reviewer #2: General Critique and Central Hypothesis

- The authors claim that HIV-1 Vpr is a direct target of autophagy, and that resistance to autophagy promotes viral transmission.

- Most experiments rely on overexpressed Vpr or non-replicating systems, not full-length HIV-1 infection.

- Overexpression artifacts are a major concern, particularly in HEK293T cells, which do not represent natural infection environments.

- The hypothesis that autophagy-sensitive Vpr correlates with reduced transmission is speculative and unsupported by causal data.

- The claim that Vpr sensitivity to autophagy is a hallmark of lab adaptation lacks evolutionary justification.

Experimental Strategy and Key Technical Concerns

- Torin2, a non-specific mTOR inhibitor, upregulates both autophagy and proteasome activity, complicating the attribution of Vpr degradation to autophagy.

- The use of MG132 does not adequately rule out proteasomal involvement; more rigorous assays (e.g., proteasome activity reporters) are lacking.

- Autophagy-deficient models (ATG5 KO and VPS34 inhibitors) were used, but flux analysis was not performed.

- p62 and LC3-II/I measurements are insufficient without flux controls (e.g., Bafilomycin A1).

- There is a lack of experiments in physiologically relevant cell types such as macrophages or primary T cells.

Figure-by-Figure Critique

- Figures 1–3: Vpr degradation is observed in autophagy-competent cells, but flux validation and pathway specificity are not demonstrated.

- Figures 4–5: The link between Vpr degradation and reduced transmission is correlational. No rescue experiments or mechanistic proof are provided.

- Figures 6–7: Residue mapping is performed in overexpression systems, not full virus contexts. Structural modeling is superficial. The role of residues in full HIV-1 replication remains untested.

Conceptual and Logical Gaps

- Equating Vpr's presence in LC3+ compartments with autophagic degradation is an overreach; other routes (e.g., lysophagy or direct proteasomal degradation) are not excluded.

- Claims about lab-adapted vs. primary isolate Vpr are not well-supported; the phylogenetic and sequence analysis is shallow.

- Structural mapping lacks functional testing in full-length virus.

- No autophagy receptors, ubiquitination signals, or degradation adaptors are identified.

- Torin2’s dual activation of proteasome and autophagy was not experimentally separated, undermining conclusions.

Recommendations and Final Evaluation

- Include autophagic flux assays using Bafilomycin A1 or Leupeptin.

- Use live-cell reporters for Vpr degradation and full-length HIV-1 constructs for testing mutant phenotypes.

- Perform infectivity and transmission assays with autophagy-deficient target cells.

- Rescue experiments (e.g., using autophagy-resistant Vpr) are needed to link degradation to viral transmission.

- The hypothesis is interesting but insufficiently supported. Mechanistic clarity and evolutionary context must be strengthened.

- Recommendation: Major revision.

Reviewer #3: 1. Figure 1: LC3 immunoblotting results are confusing. Autophagic flux is generally measured by assessing LC3-II levels, since LC3-II is a hallmark of autophagy initiation, with losses to LC3-II suggestive of clearance in the lysosome following autophagosome-lysosome fusion. Why is LC3-I selectively lost upon rapamycin treatment? Can the authors show that bafilomycin A1 restores LC3-I in rapamycin treated cells? It may be useful to do LC3-GFP cluster analysis in this figure to complement immunoblotting. Also, the results in the primary CD4+ T cells suggest that LC3-II levels are high under basal conditions and rapamycin does not impact LC3-II levels. This is an indication of incomplete autophagic flux (i.e. a defect in autophagy), which doesn’t support the authors claims of “primary CD4+ T cells have more active autophagy at steady state.” Authors should include some instances where mTOR inhibition and bafilomycin are combined and modify how they discuss these results. This is important considering the previous publication reporting that Vpr inhibits autophagic flux (Alfaisal et al, 2019 and others).

The authors should include an experiment in which, in an experiment with increasing concentrations of rapamycin/Torin2, they include a rapamycin + bafilomycin A1 condition. Restoring Vpr with bafilomycin A1 (which inhibits autophagosome-lysosome fusion) would further support the authors’ claims that Vpr is targeted by macroautophagy. Also, the rapamycin + bafilomycin A1 condition would be helpful for addressing LC3 and SQSTM1 phenotypes. Bafilomycin A1 will prevent autophagosome-mediated turnover of LC3-II, and the authors should expect to see LC3-II levels increased compared to rapamycin alone. The combination of conditions would then allow the authors to properly speak about autophagic flux (flux = turnover). Without restoring LC3-II with bafilomycin A1 in mTOR-treated cells, the authors can only speak of LC3 lipidation levels, not autophagic flux. The authors use the term “maturation” to imply that autophagosome-lysosome fusion has occurred, but I would argue that “flux/turnover” is the correct term, and that term can only be used when the extent of turnover is revealed by including bafilomycin A1 or a similar drug. Similarly, an mTOR inhibitor + bafilomycin should be added to immunofluorescence data, because Vpr expression may intensify in that condition and it would reveal the location of Vpr prior to its terminal degradation in lysosomes.

2. Line 216: chloroquine, as an inhibitor of lysosome acidification, is expected to inhibit macroautophagy, since lysosomes are an integral part in macroautophagy. In fact, there is no “autophagy” without lysosomes. Autophagosomes must fuse with lysosomes in order for cargo to be degraded. How can the authors explain why chloroquine does not restore Vpr levels? Use of bafilomycin A1 could also be added, which like chloroquine, should disrupt lysosomal activity and therefore inhibit autophagosome-mediated protein turnover (autophagy). Also, there is no loss of Vpr protein upon Torin2 treatment in Supplemental Figure 1, so the authors are unable to say whether chloroquine or MG132 rescued Vpr protein levels.

3. Figure 10: The authors could have tested the impact of the specific residues in Vpr that govern sensitivity to turnover by autophagy on HIV transmission in their 2D and 3D assays, instead of comparing NL4-3 Vpr to T/F Vpr. As the data currently stands, the authors cannot distinguish between the impact of multiple Vpr functions, which are likely to be different between NL4-3 Vpr and T/F Vpr. Since the authors have engineered full length HIV encoding mutant Vpr, the authors should use the chimeras/mutants of NL4-3 Vpr and CH077 Vpr to specifically address whether residues that dictate susceptibility to autophagic turnover and binding to autophagy receptors are important for HIV transmission. As it stands, the data does not report large effect sizes and is hard to connect with the other figures. Does NL4-3 Vpr transmit better in these 2D and 3D culture systems when the C-terminal residues at “ISTR” from CH077 have been introduced into it? Also, the authors could have included additional Vpr mutants which have been shown to disrupt other, previously recognized, functions of Vpr. This would allow the authors to discern just how important the autophagy-dependent turnover of Vpr is to virus spread, compared to other Vpr functions.

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: see my comments related to the introduction and discussion part of the manuscript

Reviewer #2: (No Response)

Reviewer #3: 1. There are redundancies in the Introduction and Discussion, including topics and references. I would remove those from the Discussion and focus more on the implications of your work rather than rehighlighting critical references that were already mentioned in the Introduction.

2. The sentence at line 59 is confusing and should be re-written: “As class III PtdIns3K complex II produces PtdIns3p.” It’s unclear whether the authors are claiming that complex I or complex II (or both) is producing PtdIns3P. Perhaps replace “as” with “like.”

3. Line 103: replace “would” with “may.”

4. Line 106: Begin sentence with, “In this manuscript…”

5. mTOR should be written as “mTOR” and not “MTOR” as per standard convention in the literature.

6. Figure 2: the loss of SQSTM1 in PAR by western in Figure 2A is not apparent in the membranes depicted, making it hard to envision how the quantified relative SQSTM1 levels were quantified in Figure 2C. Also, instead of the term Parental (PAR), I would use the term WT for clarity. You can specify “parental, WT” cells in the text and then write “WT” in the figure.

7. Figure 2D: can the authors perform a similar experiment, but using SAR405? SAR405 was shown to be a specific vps34 inhibitor and any results obtained with it could corroborate findings using VPS34IN.

8. Figure 4B-C: it seems that Nef expression, in the absence of mTOR inhibitor, causes increased levels of Vpr protein. Can the authors comment on this and discuss its significance? I do not find these results particularly convincing, nor are they essential to the message of the paper, and so I would remove them.

9. Figure 5: I do not think the LC3 blots here are particularly helpful, because you don’t see a consistent phenotype following Torin treatment. In most panels shown, it looks like Torin has no obvious impact on LC3.

10. Figure 6: In the mutagenesis studies, if you combine the findings using ChII and the “QITSR”, it seems reasonable to conclude that the Q77 is less/not important, while the “ITSR” region is what dictates the resistance of CH077 Vpr to autophagy. That’s because the ChII is resistant to autophagy, and it contains only the “ITSR” region from CH077. In fact, when depicting that mutant in Figure 6D, the authors could shade the C-terminal region in yellow, just as they do when depicting the ChII construct.

11. Figure 6: I don’t like the designation “LAB-Vpr” because LAB is not an acronym—it’s just a short form of Lab-adapted. So, if the authors insist on referring to it as Lab, it should be “Lab-Vpr.” “TFV” is a proper acronym and so “TFV-Vpr” is logical. However, it would be more straightforward to just call the constructs NL43-Vpr and CH077-Vpr in the text and figures.

12. Figure 6: I would say that it is strange to show two replicates of the co-IP experiments in Figure 6F, but to show only one for Figure 6A-E. By indicating to the readers that NDP52 pulled down Lab-Vpr 50% of the time, they will be left asking “What percentage of the time does SQSTM1/TAX1BP1 pull down Lab-Vpr?”

13. Does Vpr co-immunoprecipitate with LC3? This is a logical question to ask since the authors observe colocalization between Vpr and LC3-GFP, and since they show co-IP between Vpr and certain autophagic receptors. Thus, Vpr may interact directly or indirectly with LC3.

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy .

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

Figure resubmission:

Reproducibility:

PLoS Pathog. 2026 Mar 2;22(3):e1014020. doi: 10.1371/journal.ppat.1014020.r002

Author response to Decision Letter 1

7 Jan 2026

Attachment

Submitted filename: Response to the Reviewrs.docx

ppat.1014020.s007.docx^{(49.1KB, docx)}

PLoS Pathog. doi: 10.1371/journal.ppat.1014020.r003

Decision Letter 1

Edward Campbell

27 Jan 2026

PPATHOGENS-D-25-01899R1

HIV-1 Vpr is an autophagy target and its susceptibility to autophagy reduces virus transmission

PLOS Pathogens

Dear Dr. Serra-Moreno,

Please submit your revised manuscript by Mar 28 2026 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plospathogens@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/ppathogens/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

* A letter that responds to each point raised by the editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. This file does not need to include responses to any formatting updates and technical items listed in the 'Journal Requirements' section below.

* A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

* An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Edward M Campbell, PhD

Academic Editor

PLOS Pathogens

Susan Ross

Section Editor

PLOS Pathogens

Sumita Bhaduri-McIntosh

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0003-2946-9497

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

Additional Editor Comments:

The reviews still have minor concerns regarding language that.can be resolved without any additional experimentation.

Journal Requirements:

If the reviewer comments include a recommendation to cite specific previously published works, please review and evaluate these publications to determine whether they are relevant and should be cited. There is no requirement to cite these works unless the editor has indicated otherwise.

Reviewers' Comments:

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: (No Response)

Reviewer #2: SUMMARY:

This revised manuscript presents interesting and potentially important findings on Vpr as an autophagy target. The authors have conducted extensive experimental work (10 main figures, 2 supplemental datasets) and demonstrate appropriate scientific rigor in acknowledging limitations. However, some key claims require closer alignment with the data, and clarifying the scope and limitations of certain conclusions would strengthen the manuscript. These issues can be addressed primarily through textual revisions to ensure claims precisely match the supporting data.

Reviewer #3: In this revision, the authors have performed extensive revisions to the text and figures (including of new experimental data) to address reviewers' points. The article has been improved as a result.

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Reviewer #1: The authors were very responsive and addressed all of my concerns. Either by new experiments or textual changes/discussion. Thank you for your efforts.

Reviewer #2: Most of the critiques can be addressed with textual Revision

1. Alignment of Transmission Claims with Assay Readout

The abstract and title emphasize effects on "HIV-1 transmission" (lines 28-31), and the GFP+/mCherry+ assay is framed as measuring "successful transmission."

The authors appropriately and honestly acknowledge (lines 786-793): "a defect in transmission for viruses harboring autophagy-sensitive Vpr proteins might be caused by a defect in infectivity...there are many steps in the replication cycle that can impact GFP and mCherry expression."

This caveat is scientifically sound but creates a discrepancy: the data show reduced GFP+/mCherry+ cells (a composite readout of multiple processes), whereas the claims specifically invoke "transmission" (particle transfer and entry).

Pls, revise the title, abstract, and key conclusions to more precisely reflect what was measured. Options include:

- Framing as "viral spread" or "infection/replication" rather than specifically "transmission."

- Explicitly stating throughout that the readout reflects composite effects

- Emphasizing that reduced GFP+/mCherry+ cells could result from multiple mechanisms

- Expand the discussion of this limitation beyond lines 786-793 to help readers understand the scope of the findings

- Acknowledge in the discussion that future work will be needed to dissect which specific step(s) are affected

2. Framing of Causality and Autophagy Dependence:

The manuscript uses pharmacological approaches (Torin2, VPS34IN, etc.) to implicate autophagy. The authors note difficulty with genetic rescue due to toxicity (lines 810-816).

Pharmacological data are valuable but have inherent limitations (off-target effects, pleiotropic responses). While ATG5KO cells are used for mechanistic studies, the transmission phenotype itself has not been demonstrated in autophagy-null genetic backgrounds.

Pls, acknowledge more explicitly that causality is established through pharmacological rather than genetic approaches for the transmission of the phenotype

- Discuss this limitation and note that while ATG5KO data support the mechanism, genetic validation of the transmission phenotype specifically would strengthen future work

- Note in the discussion that genetic approaches for the transmission assay will be important future directions

3. Ubiquitination Mechanism Discussion:

The ubiquitination data show complex patterns:

- TAK-243 rescues LAB-Vpr (Figure 10A)

- K27M is still degraded (Figure 10B)

- LAB-Vpr and TFV-Vpr show similar ubiquitination (Figure 10C)

- SQSTM1-ΔUBA still binds Vpr (Figure 10E-F)

The authors conclude that the effects are "ubiquitin-independent" (lines 751-769) and speculate about TAK-243's off-target effects (lines 735-749).

These findings are difficult to reconcile, and the current presentation may overstate what can be concluded.

The team should acknowledge more clearly that the ubiquitination results are complex and somewhat contradictory

- Present the TAK-243 rescue and K27M/ΔUBA data more evenhandedly rather than dismissing TAK-243 as off-target

- Revise the conclusion to state that ubiquitination's role remains unclear or requires further investigation

4. Primary Cell Context and Scope:

The mechanistic work primarily uses HEK293T cells, with limited validation in primary CD4+ T cells (Figures 1D-F, 4A-B).

HEK293T cells provide excellent experimental tractability but differ from physiologically relevant HIV-1 host cells.

The team should discuss the limitation that most mechanistic insights are from kidney epithelial cells

- Frame conclusions as "in our experimental system" rather than as universal HIV-1 biology

Reviewer #3: (No Response)

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: (No Response)

Reviewer #2: 1. TFV Resistance Mechanisms:

The authors acknowledge (lines 672-678) that some TFV Vpr proteins lack the mapped resistance determinants, suggesting mechanistic diversity.

Pls clarify in the text that the CH077 mapping may represent one of potentially multiple resistance mechanisms

- Avoid overgeneralizing from one TFV to all TFVs

2. NDP52 Interaction Variability:

NDP52 co-IP showed 50% reproducibility (lines 425-427).

The team should acknowledge this variability more explicitly when discussing NDP52's role

MINOR ISSUES

- Sample sizes: State explicitly in figure legends the number of biological replicates for transmission experiments

- Statistical clarity: Clarify statistical approaches for transmission assays

- Consistency: Ensure consistent terminology (transmission vs. infection vs. viral spread) throughout

Reviewer #3: There remain a couple of issues that could be handled by reformatting and revising certain conclusions made by the authors:

1. Figure 4C appears incomplete since it does not contain the same experiment in WT cells (only ATG5 KO cells are shown). The MG132 and chloroquine treatments should also be performed with WT cells, since the authors need to show that Rapamycin/Torin treatment causes Vpr protein loss in WT cells, and that protein is recovered by chloroquine but not MG132. This would support the turnover of Vpr in lysosomes upon mTOR inhibition and would better complement the other data in the paper. Another option is to simply remove Figure 4C, because it does not add any appreciable value to the revised version of the paper.

2. The transmission data in the final figure still contains some of the least convincing functional data in the paper, despite it being revised. Even though the Vpr mutant that is resistant to autophagy confers virus with a slightly higher capacity for transmission, as the authors conclude, I think the effect sizes are rather small in both the 2D and 3D systems used. Also, as the authors admit, the use of the Nef mutant causes decreased virus transmission irrespective of which Vpr is expressed alongside it, making it difficult to use this set of conditions to discern how Vpr’s susceptibility to autophagy is related to virus transmission. It seems to me that the most appropriate conditions to compare to one another are VprLabNefMut and VprMutNefMut. That’s because by including the mutated Nef incapable of antagonizing autophagy (therefore the cellular autophagy response is intact), it should be easier to determine whether mutating the Vpr to an autophagy-resistant state impacts virus transmission. However, the authors do not perform a comparison and statistical analysis between those two conditions. That diminishes the utility of having NetMut in the figure. Nonetheless, by eye, the VprLabNefMut condition transmits as well as the VprMutNefMut in nearly all of the transmission systems studied (with the exception of the 3D total, where VprMutNefMut is relatively increased).Therefore, I think it is inappropriate to state “reduces virus transmission” in the title of the article. I would recommend that they revise the title to emphasize what their data best supports (that Vpr is targeted for degradation by autophagy).

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy .

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Figure resubmission:

While revising your submission, we strongly recommend that you use PLOS’s NAAS tool (https://ngplosjournals.pagemajik.ai/artanalysis) to test your figure files. NAAS can convert your figure files to the TIFF file type and meet basic requirements (such as print size, resolution), or provide you with a report on issues that do not meet our requirements and that NAAS cannot fix.

After uploading your figures to PLOS’s NAAS tool - https://ngplosjournals.pagemajik.ai/artanalysis, NAAS will process the files provided and display the results in the "Uploaded Files" section of the page as the processing is complete. If the uploaded figures meet our requirements (or NAAS is able to fix the files to meet our requirements), the figure will be marked as "fixed" above. If NAAS is unable to fix the files, a red "failed" label will appear above. When NAAS has confirmed that the figure files meet our requirements, please download the file via the download option, and include these NAAS processed figure files when submitting your revised manuscript.

Reproducibility:

To enhance the reproducibility of your results, we recommend that authors of applicable studies deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

PLoS Pathog. 2026 Mar 2;22(3):e1014020. doi: 10.1371/journal.ppat.1014020.r004

Author response to Decision Letter 2

19 Feb 2026

Attachment

Submitted filename: Reviewers comments round 2 v2.docx

ppat.1014020.s008.docx^{(26.2KB, docx)}

PLoS Pathog. doi: 10.1371/journal.ppat.1014020.r005

Decision Letter 2

Edward Campbell

20 Feb 2026

Dear Dr. Serra-Moreno,

We are pleased to inform you that your manuscript 'HIV-1 Vpr is targeted for degradation by autophagy' has been provisionally accepted for publication in PLOS Pathogens.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Edward M Campbell, PhD

Academic Editor

PLOS Pathogens

Susan Ross

Section Editor

PLOS Pathogens

Sumita Bhaduri-McIntosh

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0003-2946-9497

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************************************************

Thank you for your continued proactive responsiveness to the reviewer comments. This is a strong study. Congratulations on its acceptance.

Reviewer Comments (if any, and for reference):

PLoS Pathog. doi: 10.1371/journal.ppat.1014020.r006

Acceptance letter

Edward Campbell

Dear Dr. Serra-Moreno,

We are delighted to inform you that your manuscript, "HIV-1 Vpr is targeted for degradation by autophagy," has been formally accepted for publication in PLOS Pathogens.

We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

For Research Articles, you will receive an invoice from PLOS for your publication fee after your manuscript has reached the completed accept phase. If you receive an email requesting payment before acceptance or for any other service, this may be a phishing scheme. Learn how to identify phishing emails and protect your accounts at https://explore.plos.org/phishing.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Sumita Bhaduri-McIntosh

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0003-2946-9497

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Mutagenesis strategy in Vpr.

(TIFF)

ppat.1014020.s001.tiff^{(2.6MB, tiff)}

S2 Fig. Amino acid usage at residues 37, 45, 77, 83–86, 93–94 in Vpr.

(TIFF)

ppat.1014020.s002.tiff^{(4.1MB, tiff)}

S3 Fig. Design of the NL4–3 recombinant viruses.

(TIFF)

ppat.1014020.s003.tiff^{(2.9MB, tiff)}

S4 Fig. Pipeline for the generation of the 3D cervicovaginal epithelial model used for the 3D infection studies.

Diagram created in BioRender (License: Serra-moreno, R. (2025) https://.BioRender.com/7tqr7m5)

(TIFF)

ppat.1014020.s004.tiff^{(2MB, tiff)}

S1 File. All raw, numerical data used in the graphs of this manuscript are provided in an excel file.

(XLSX)

ppat.1014020.s005.xlsx^{(44.1KB, xlsx)}

Attachment

Submitted filename: Response to the Reviewrs.docx

ppat.1014020.s007.docx^{(49.1KB, docx)}

Attachment

Submitted filename: Reviewers comments round 2 v2.docx

ppat.1014020.s008.docx^{(26.2KB, docx)}

Data Availability Statement

All the data is found in the manuscript and the supplementary materials.

[ppat.1014020.ref001] 1.Mizushima N. Autophagy: process and function. Genes Dev. 2007;21(22):2861–73. doi: 10.1101/gad.1599207 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref002] 2.Parzych KR, Klionsky DJ. An overview of autophagy: morphology, mechanism, and regulation. Antioxid Redox Signal. 2014;20(3):460–73. doi: 10.1089/ars.2013.5371 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref003] 3.Reggiori F, Klionsky DJ. Autophagy in the eukaryotic cell. Eukaryot Cell. 2002;1(1):11–21. doi: 10.1128/EC.01.1.11-21.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref004] 4.Ohsumi Y. Historical landmarks of autophagy research. Cell Res. 2014;24(1):9–23. doi: 10.1038/cr.2013.169 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref005] 5.King JS. Autophagy across the eukaryotes: is S. cerevisiae the odd one out?. Autophagy. 2012;8(7):1159–62. doi: 10.4161/auto.20527 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref006] 6.Rabinowitz JD, White E. Autophagy and metabolism. Science. 2010;330(6009):1344–8. doi: 10.1126/science.1193497 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref007] 7.Kaur J, Debnath J. Autophagy at the crossroads of catabolism and anabolism. Nat Rev Mol Cell Biol. 2015;16(8):461–72. doi: 10.1038/nrm4024 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref008] 8.Klionsky DJ, Abdel-Aziz AK, Abdelfatah S, Abdellatif M, Abdoli A, Abel S, et al. Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1. Autophagy. 2021;17(1):1–382. doi: 10.1080/15548627.2020.1797280 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref009] 9.Tanida I, Ueno T, Kominami E. LC3 and Autophagy. Methods Mol Biol. 2008;445:77–88. doi: 10.1007/978-1-59745-157-4_4 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref010] 10.Jung CH, Ro S-H, Cao J, Otto NM, Kim D-H. mTOR regulation of autophagy. FEBS Lett. 2010;584(7):1287–95. doi: 10.1016/j.febslet.2010.01.017 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref011] 11.Codogno P, Mehrpour M, Proikas-Cezanne T. Canonical and non-canonical autophagy: variations on a common theme of self-eating?. Nat Rev Mol Cell Biol. 2011;13(1):7–12. doi: 10.1038/nrm3249 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref012] 12.Zaffagnini G, Martens S. Mechanisms of Selective Autophagy. J Mol Biol. 2016;428(9 Pt A):1714–24. doi: 10.1016/j.jmb.2016.02.004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref013] 13.Hurley JH, Young LN. Mechanisms of Autophagy Initiation. Annu Rev Biochem. 2017;86:225–44. doi: 10.1146/annurev-biochem-061516-044820 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref014] 14.Johansen T, Lamark T. Selective Autophagy: ATG8 Family Proteins, LIR Motifs and Cargo Receptors. J Mol Biol. 2020;432(1):80–103. doi: 10.1016/j.jmb.2019.07.016 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref015] 15.Dikic I, Elazar Z. Mechanism and medical implications of mammalian autophagy. Nat Rev Mol Cell Biol. 2018;19(6):349–64. doi: 10.1038/s41580-018-0003-4 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref016] 16.Menon MB, Dhamija S. Beclin 1 Phosphorylation - at the Center of Autophagy Regulation. Front Cell Dev Biol. 2018;6:137. doi: 10.3389/fcell.2018.00137 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref017] 17.Nascimbeni AC, Codogno P, Morel E. Local detection of PtdIns3P at autophagosome biogenesis membrane platforms. Autophagy. 2017;13(9):1602–12. doi: 10.1080/15548627.2017.1341465 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref018] 18.Matsunaga K, Morita E, Saitoh T, Akira S, Ktistakis NT, Izumi T, et al. Autophagy requires endoplasmic reticulum targeting of the PI3-kinase complex via Atg14L. J Cell Biol. 2010;190(4):511–21. doi: 10.1083/jcb.200911141 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref019] 19.Brier LW, Ge L, Stjepanovic G, Thelen AM, Hurley JH, Schekman R. Regulation of LC3 lipidation by the autophagy-specific class III phosphatidylinositol-3 kinase complex. Mol Biol Cell. 2019;30(9):1098–107. doi: 10.1091/mbc.E18-11-0743 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref020] 20.Mizushima N, Yoshimori T, Ohsumi Y. The role of Atg proteins in autophagosome formation. Annu Rev Cell Dev Biol. 2011;27:107–32. doi: 10.1146/annurev-cellbio-092910-154005 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref021] 21.Kirisako T, Ichimura Y, Okada H, Kabeya Y, Mizushima N, Yoshimori T, et al. The reversible modification regulates the membrane-binding state of Apg8/Aut7 essential for autophagy and the cytoplasm to vacuole targeting pathway. J Cell Biol. 2000;151(2):263–76. doi: 10.1083/jcb.151.2.263 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref022] 22.Behrends C, Fulda S. Receptor proteins in selective autophagy. Int J Cell Biol. 2012;2012:673290. doi: 10.1155/2012/673290 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref023] 23.Xu Z, Yang L, Xu S, Zhang Z, Cao Y. The receptor proteins: pivotal roles in selective autophagy. Acta Biochim Biophys Sin (Shanghai). 2015;47(8):571–80. doi: 10.1093/abbs/gmv055 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref024] 24.Reggiori F, Ungermann C. Autophagosome Maturation and Fusion. J Mol Biol. 2017;429(4):486–96. doi: 10.1016/j.jmb.2017.01.002 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref025] 25.Itakura E, Kishi C, Inoue K, Mizushima N. Beclin 1 forms two distinct phosphatidylinositol 3-kinase complexes with mammalian Atg14 and UVRAG. Mol Biol Cell. 2008;19(12):5360–72. doi: 10.1091/mbc.e08-01-0080 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref026] 26.Itakura E, Mizushima N. Atg14 and UVRAG: mutually exclusive subunits of mammalian Beclin 1-PI3K complexes. Autophagy. 2009;5(4):534–6. doi: 10.4161/auto.5.4.8062 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref027] 27.Mizushima N, Yoshimori T. How to interpret LC3 immunoblotting. Autophagy. 2007;3(6):542–5. doi: 10.4161/auto.4600 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref028] 28.Schmid D, Münz C. Innate and adaptive immunity through autophagy. Immunity. 2007;27(1):11–21. doi: 10.1016/j.immuni.2007.07.004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref029] 29.Kudchodkar SB, Levine B. Viruses and autophagy. Rev Med Virol. 2009;19(6):359–78. doi: 10.1002/rmv.630 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref030] 30.Cavignac Y, Esclatine A. Herpesviruses and autophagy: catch me if you can!. Viruses. 2010;2(1):314–33. doi: 10.3390/v2010314 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref031] 31.Jordan TX, Randall G. Manipulation or capitulation: virus interactions with autophagy. Microbes Infect. 2012;14(2):126–39. doi: 10.1016/j.micinf.2011.09.007 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref032] 32.Orvedahl A, Levine B. Viral evasion of autophagy. Autophagy. 2008;4(3):280–5. doi: 10.4161/auto.5289 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref033] 33.Tang S-W, Ducroux A, Jeang K-T, Neuveut C. Impact of cellular autophagy on viruses: Insights from hepatitis B virus and human retroviruses. J Biomed Sci. 2012;19(1):92. doi: 10.1186/1423-0127-19-92 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref034] 34.Choi Y, Bowman JW, Jung JU. Autophagy during viral infection - a double-edged sword. Nat Rev Microbiol. 2018;16(6):341–54. doi: 10.1038/s41579-018-0003-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref035] 35.Kyei GB, Dinkins C, Davis AS, Roberts E, Singh SB, Dong C, et al. Autophagy pathway intersects with HIV-1 biosynthesis and regulates viral yields in macrophages. J Cell Biol. 2009;186(2):255–68. doi: 10.1083/jcb.200903070 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref036] 36.Denizot M, Varbanov M, Espert L, Robert-Hebmann V, Sagnier S, Garcia E, et al. HIV-1 gp41 fusogenic function triggers autophagy in uninfected cells. Autophagy. 2008;4(8):998–1008. doi: 10.4161/auto.6880 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref037] 37.Li JCB, Au K, Fang J, Yim HCH, Chow K, Ho P, et al. HIV-1 trans-activator protein dysregulates IFN-γ signaling and contributes to the suppression of autophagy induction. AIDS. 2011;25(1):15–25. doi: 10.1097/QAD.0b013e328340fd61 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref038] 38.Campbell GR, Rawat P, Bruckman RS, Spector SA. Human Immunodeficiency Virus Type 1 Nef Inhibits Autophagy through Transcription Factor EB Sequestration. PLoS Pathog. 2015;11(6):e1005018. doi: 10.1371/journal.ppat.1005018 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref039] 39.Campbell GR, Spector SA. Inhibition of human immunodeficiency virus type-1 through autophagy. Curr Opin Microbiol. 2013;16(3):349–54. doi: 10.1016/j.mib.2013.05.006 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref040] 40.Chang C, Young LN, Morris KL, von Bülow S, Schöneberg J, Yamamoto-Imoto H, et al. Bidirectional Control of Autophagy by BECN1 BARA Domain Dynamics. Mol Cell. 2019;73(2):339-353.e6. doi: 10.1016/j.molcel.2018.10.035 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref041] 41.Dinkins C, Pilli M, Kehrl JH. Roles of autophagy in HIV infection. Immunol Cell Biol. 2015;93(1):11–7. doi: 10.1038/icb.2014.88 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref042] 42.Nardacci R, Ciccosanti F, Marsella C, Ippolito G, Piacentini M, Fimia GM. Role of autophagy in HIV infection and pathogenesis. J Intern Med. 2017;281(5):422–32. doi: 10.1111/joim.12596 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref043] 43.Castro-Gonzalez S, Chen Y, Benjamin J, Shi Y, Serra-Moreno R. Residues T48 and A49 in HIV-1 NL4-3 Nef are responsible for the counteraction of autophagy initiation, which prevents the ubiquitin-dependent degradation of Gag through autophagosomes. Retrovirology. 2021;18(1):33. doi: 10.1186/s12977-021-00576-y [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref044] 44.Castro-Gonzalez S, Shi Y, Colomer-Lluch M, Song Y, Mowery K, Almodovar S, et al. HIV-1 Nef counteracts autophagy restriction by enhancing the association between BECN1 and its inhibitor BCL2 in a PRKN-dependent manner. Autophagy. 2021;17(2):553–77. doi: 10.1080/15548627.2020.1725401 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref045] 45.Alfaisal J, Machado A, Galais M, Robert-Hebmann V, Arnaune-Pelloquin L, Espert L, et al. HIV-1 Vpr inhibits autophagy during the early steps of infection of CD4 T cells. Biol Cell. 2019;111(12):308–18. doi: 10.1111/boc.201900071 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref046] 46.Shoji-Kawata S, Sumpter R, Leveno M, Campbell GR, Zou Z, Kinch L, et al. Identification of a candidate therapeutic autophagy-inducing peptide. Nature. 2013;494(7436):201–6. doi: 10.1038/nature11866 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref047] 47.Sagnier S, Daussy CF, Borel S, Robert-Hebmann V, Faure M, Blanchet FP, et al. Autophagy restricts HIV-1 infection by selectively degrading Tat in CD4+ T lymphocytes. J Virol. 2015;89(1):615–25. doi: 10.1128/JVI.02174-14 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref048] 48.Chen BK, Rousso I, Shim S, Kim PS. Efficient assembly of an HIV-1/MLV Gag-chimeric virus in murine cells. Proc Natl Acad Sci U S A. 2001;98(26):15239–44. doi: 10.1073/pnas.261563198 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref049] 49.Inlora J, Chukkapalli V, Bedi S, Ono A. Molecular Determinants Directing HIV-1 Gag Assembly to Virus-Containing Compartments in Primary Macrophages. J Virol. 2016;90(19):8509–19. doi: 10.1128/JVI.01004-16 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref050] 50.Molle D, Segura-Morales C, Camus G, Berlioz-Torrent C, Kjems J, Basyuk E, et al. Endosomal trafficking of HIV-1 gag and genomic RNAs regulates viral egress. J Biol Chem. 2009;284(29):19727–43. doi: 10.1074/jbc.M109.019844 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref051] 51.Freed EO. HIV-1 gag proteins: diverse functions in the virus life cycle. Virology. 1998;251(1):1–15. doi: 10.1006/viro.1998.9398 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref052] 52.Huseby D, Barklis RL, Alfadhli A, Barklis E. Assembly of human immunodeficiency virus precursor gag proteins. J Biol Chem. 2005;280(18):17664–70. doi: 10.1074/jbc.M412325200 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref053] 53.Hubbard VM, Valdor R, Patel B, Singh R, Cuervo AM, Macian F. Macroautophagy regulates energy metabolism during effector T cell activation. J Immunol. 2010;185(12):7349–57. doi: 10.4049/jimmunol.1000576 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref054] 54.Jacquin E, Apetoh L. Cell-Intrinsic Roles for Autophagy in Modulating CD4 T Cell Functions. Front Immunol. 2018;9:1023. doi: 10.3389/fimmu.2018.01023 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref055] 55.Li C, Capan E, Zhao Y, Zhao J, Stolz D, Watkins SC, et al. Autophagy is induced in CD4+ T cells and important for the growth factor-withdrawal cell death. J Immunol. 2006;177(8):5163–8. doi: 10.4049/jimmunol.177.8.5163 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref056] 56.Watanabe R, Fujii H, Shirai T, Saito S, Ishii T, Harigae H. Autophagy plays a protective role as an anti-oxidant system in human T cells and represents a novel strategy for induction of T-cell apoptosis. Eur J Immunol. 2014;44(8):2508–20. doi: 10.1002/eji.201344248 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref057] 57.Liu Q, Xu C, Kirubakaran S, Zhang X, Hur W, Liu Y, et al. Characterization of Torin2, an ATP-competitive inhibitor of mTOR, ATM, and ATR. Cancer Res. 2013;73(8):2574–86. doi: 10.1158/0008-5472.CAN-12-1702 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref058] 58.Mauvezin C, Neufeld TP. Bafilomycin A1 disrupts autophagic flux by inhibiting both V-ATPase-dependent acidification and Ca-P60A/SERCA-dependent autophagosome-lysosome fusion. Autophagy. 2015;11(8):1437–8. doi: 10.1080/15548627.2015.1066957 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref059] 59.Zhao J, Zhai B, Gygi SP, Goldberg AL. mTOR inhibition activates overall protein degradation by the ubiquitin proteasome system as well as by autophagy. Proc Natl Acad Sci U S A. 2015;112(52):15790–7. doi: 10.1073/pnas.1521919112 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref060] 60.Livneh I, Cohen-Kaplan V, Fabre B, Abramovitch I, Lulu C, Nataraj NB, et al. Regulation of nucleo-cytosolic 26S proteasome translocation by aromatic amino acids via mTOR is essential for cell survival under stress. Mol Cell. 2023;83(18):3333-3346.e5. doi: 10.1016/j.molcel.2023.08.016 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref061] 61.Puertollano R. mTOR and lysosome regulation. F1000Prime Rep. 2014;6:52. doi: 10.12703/P6-52 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref062] 62.Sardiello M, Palmieri M, di Ronza A, Medina DL, Valenza M, Gennarino VA, et al. A gene network regulating lysosomal biogenesis and function. Science. 2009;325(5939):473–7. doi: 10.1126/science.1174447 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref063] 63.Sanjuan MA, Dillon CP, Tait SWG, Moshiach S, Dorsey F, Connell S, et al. Toll-like receptor signalling in macrophages links the autophagy pathway to phagocytosis. Nature. 2007;450(7173):1253–7. doi: 10.1038/nature06421 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref064] 64.Ye X, Zhou X-J, Zhang H. Exploring the Role of Autophagy-Related Gene 5 (ATG5) Yields Important Insights Into Autophagy in Autoimmune/Autoinflammatory Diseases. Front Immunol. 2018;9:2334. doi: 10.3389/fimmu.2018.02334 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref065] 65.Noda NN, Fujioka Y, Hanada T, Ohsumi Y, Inagaki F. Structure of the Atg12-Atg5 conjugate reveals a platform for stimulating Atg8-PE conjugation. EMBO Rep. 2013;14(2):206–11. doi: 10.1038/embor.2012.208 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref066] 66.Otomo C, Metlagel Z, Takaesu G, Otomo T. Structure of the human ATG12~ATG5 conjugate required for LC3 lipidation in autophagy. Nat Struct Mol Biol. 2013;20(1):59–66. doi: 10.1038/nsmb.2431 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref067] 67.Bago R, Malik N, Munson MJ, Prescott AR, Davies P, Sommer E, et al. Characterization of VPS34-IN1, a selective inhibitor of Vps34, reveals that the phosphatidylinositol 3-phosphate-binding SGK3 protein kinase is a downstream target of class III phosphoinositide 3-kinase. Biochem J. 2014;463(3):413–27. doi: 10.1042/BJ20140889 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref068] 68.Mizushima N, Yoshimori T, Levine B. Methods in mammalian autophagy research. Cell. 2010;140(3):313–26. doi: 10.1016/j.cell.2010.01.028 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref069] 69.Parrish NF, Gao F, Li H, Giorgi EE, Barbian HJ, Parrish EH, et al. Phenotypic properties of transmitted founder HIV-1. Proc Natl Acad Sci U S A. 2013;110(17):6626–33. doi: 10.1073/pnas.1304288110 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref070] 70.Fregoso OI, Emerman M. Activation of the DNA Damage Response Is a Conserved Function of HIV-1 and HIV-2 Vpr That Is Independent of SLX4 Recruitment. mBio. 2016;7(5):e01433-16. doi: 10.1128/mBio.01433-16 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref071] 71.Tristem M, Marshall C, Karpas A, Hill F. Evolution of the primate lentiviruses: evidence from vpx and vpr. EMBO J. 1992;11(9):3405–12. doi: 10.1002/j.1460-2075.1992.tb05419.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref072] 72.Tristem M, Purvis A, Quicke DL. Complex evolutionary history of primate lentiviral vpr genes. Virology. 1998;240(2):232–7. doi: 10.1006/viro.1997.8929 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref073] 73.Apetrei CHB, Rambaut A, Wolinsky S, Brister JR, Keele B, Faser C. HIV Sequence Compendium 2021. In: Theoretical Biology and Biophysics Group LANL, editor. Los Alamos National Laboratory. 2021. [Google Scholar]

[ppat.1014020.ref074] 74.Lamark T, Kirkin V, Dikic I, Johansen T. NBR1 and p62 as cargo receptors for selective autophagy of ubiquitinated targets. Cell Cycle. 2009;8(13):1986–90. doi: 10.4161/cc.8.13.8892 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref075] 75.White J, Suklabaidya S, Vo MT, Choi YB, Harhaj EW. Multifaceted roles of TAX1BP1 in autophagy. Autophagy. 2023;19(1):44–53. doi: 10.1080/15548627.2022.2070331 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref076] 76.Ying H, Yue BYJT. Optineurin: The autophagy connection. Exp Eye Res. 2016;144:73–80. doi: 10.1016/j.exer.2015.06.029 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref077] 77.Fan S, Wu K, Zhao M, Zhu E, Ma S, Chen Y, et al. The Role of Autophagy and Autophagy Receptor NDP52 in Microbial Infections. Int J Mol Sci. 2020;21(6):2008. doi: 10.3390/ijms21062008 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref078] 78.Li Y, Zheng W, Lu Y, Zheng Y, Pan L, Wu X, et al. BNIP3L/NIX-mediated mitophagy: molecular mechanisms and implications for human disease. Cell Death Dis. 2021;13(1):14. doi: 10.1038/s41419-021-04469-y [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref079] 79.Deng Z, Purtell K, Lachance V, Wold MS, Chen S, Yue Z. Autophagy Receptors and Neurodegenerative Diseases. Trends Cell Biol. 2017;27(7):491–504. doi: 10.1016/j.tcb.2017.01.001 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref080] 80.Hyer ML, Milhollen MA, Ciavarri J, Fleming P, Traore T, Sappal D, et al. A small-molecule inhibitor of the ubiquitin activating enzyme for cancer treatment. Nat Med. 2018;24(2):186–93. doi: 10.1038/nm.4474 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref081] 81.Jacquot G, Le Rouzic E, David A, Mazzolini J, Bouchet J, Bouaziz S, et al. Localization of HIV-1 Vpr to the nuclear envelope: impact on Vpr functions and virus replication in macrophages. Retrovirology. 2007;4:84. doi: 10.1186/1742-4690-4-84 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref082] 82.Guo HJ, Rahimi N, Tadi P. Ubiquitination. Treasure Island (FL): StatPearls. 2025. [Google Scholar]

[ppat.1014020.ref083] 83.Nityanandam R, Serra-Moreno R. BCA2/Rabring7 targets HIV-1 Gag for lysosomal degradation in a tetherin-independent manner. PLoS Pathog. 2014;10(5):e1004151. doi: 10.1371/journal.ppat.1004151 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref084] 84.Lamark T, Perander M, Outzen H, Kristiansen K, Øvervatn A, Michaelsen E, et al. Interaction codes within the family of mammalian Phox and Bem1p domain-containing proteins. J Biol Chem. 2003;278(36):34568–81. doi: 10.1074/jbc.M303221200 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref085] 85.Vadlamudi RK, Joung I, Strominger JL, Shin J. p62, a phosphotyrosine-independent ligand of the SH2 domain of p56lck, belongs to a new class of ubiquitin-binding proteins. J Biol Chem. 1996;271(34):20235–7. doi: 10.1074/jbc.271.34.20235 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref086] 86.Johansen T, Lamark T. Selective autophagy mediated by autophagic adapter proteins. Autophagy. 2011;7(3):279–96. doi: 10.4161/auto.7.3.14487 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref087] 87.Szucs G, Melnick JL, Hollinger FB. A simple assay based on HIV infection preventing the reclustering of MT-4 cells. Bull World Health Organ. 1988;66(6):729–37. [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref088] 88.Edwards VL, McComb E, Gleghorn JP, Forney L, Bavoil PM, Ravel J. Three-dimensional models of the cervicovaginal epithelia to study host-microbiome interactions and sexually transmitted infections. Pathog Dis. 2022;80(1):ftac026. doi: 10.1093/femspd/ftac026 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref089] 89.Futter CE, Collinson LM, Backer JM, Hopkins CR. Human VPS34 is required for internal vesicle formation within multivesicular endosomes. J Cell Biol. 2001;155(7):1251–64. doi: 10.1083/jcb.200108152 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref090] 90.Ali A, Ng HL, Blankson JN, Burton DR, Buckheit RW 3rd, Moldt B, et al. Highly Attenuated Infection With a Vpr-Deleted Molecular Clone of Human Immunodeficiency Virus-1. J Infect Dis. 2018;218(9):1447–52. doi: 10.1093/infdis/jiy346 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref091] 91.Guenzel CA, Hérate C, Benichou S. HIV-1 Vpr-a still “enigmatic multitasker”. Front Microbiol. 2014;5:127. doi: 10.3389/fmicb.2014.00127 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref092] 92.Belzile J-P, Duisit G, Rougeau N, Mercier J, Finzi A, Cohen EA. HIV-1 Vpr-mediated G2 arrest involves the DDB1-CUL4AVPRBP E3 ubiquitin ligase. PLoS Pathog. 2007;3(7):e85. doi: 10.1371/journal.ppat.0030085 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref093] 93.Wen X, Duus KM, Friedrich TD, de Noronha CMC. The HIV1 protein Vpr acts to promote G2 cell cycle arrest by engaging a DDB1 and Cullin4A-containing ubiquitin ligase complex using VprBP/DCAF1 as an adaptor. J Biol Chem. 2007;282(37):27046–57. doi: 10.1074/jbc.M703955200 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref094] 94.Reuschl AK, Mesner D, Shivkumar M, Whelan MVX, Pallett LJ, Guerra-Assuncao JA, et al. HIV-1 Vpr drives a tissue residency-like phenotype during selective infection of resting memory T cells. Cell reports. 2022;39(2):110650. doi: 10.1016/j.celrep.2022.110650 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref095] 95.Klute S, Sparrer KMJ. Friends and Foes: The Ambivalent Role of Autophagy in HIV-1 Infection. Viruses. 2024;16(4):500. doi: 10.3390/v16040500 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref096] 96.Shi B, Huang Q-Q, Birkett R, Doyle R, Dorfleutner A, Stehlik C, et al. SNAPIN is critical for lysosomal acidification and autophagosome maturation in macrophages. Autophagy. 2017;13(2):285–301. doi: 10.1080/15548627.2016.1261238 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref097] 97.Santerre M, Arjona SP, Allen CN, Callen S, Buch S, Sawaya BE. HIV-1 Vpr protein impairs lysosome clearance causing SNCA/alpha-synuclein accumulation in neurons. Autophagy. 2021;17(7):1768–82. doi: 10.1080/15548627.2021.1915641 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref098] 98.Kirkin V, Lamark T, Johansen T, Dikic I. NBR1 cooperates with p62 in selective autophagy of ubiquitinated targets. Autophagy. 2009;5(5):732–3. doi: 10.4161/auto.5.5.8566 [DOI] [PubMed] [Google Scholar]

[ppat.1014020.ref099] 99.Adachi A, Gendelman HE, Koenig S, Folks T, Willey R, Rabson A, et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J Virol. 1986;59(2):284–91. doi: 10.1128/JVI.59.2.284-291.1986 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref100] 100.Schwartz O, Maréchal V, Danos O, Heard JM. Human immunodeficiency virus type 1 Nef increases the efficiency of reverse transcription in the infected cell. J Virol. 1995;69(7):4053–9. doi: 10.1128/JVI.69.7.4053-4059.1995 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref101] 101.Jia B, Serra-Moreno R, Neidermyer W, Rahmberg A, Mackey J, Fofana IB, et al. Species-specific activity of SIV Nef and HIV-1 Vpu in overcoming restriction by tetherin/BST2. PLoS Pathog. 2009;5(5):e1000429. doi: 10.1371/journal.ppat.1000429 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref102] 102.Serra-Moreno R, Zimmermann K, Stern LJ, Evans DT. Tetherin/BST-2 antagonism by Nef depends on a direct physical interaction between Nef and tetherin, and on clathrin-mediated endocytosis. PLoS Pathog. 2013;9(7):e1003487. doi: 10.1371/journal.ppat.1003487 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref103] 103.Keele BF, Giorgi EE, Salazar-Gonzalez JF, Decker JM, Pham KT, Salazar MG, et al. Identification and characterization of transmitted and early founder virus envelopes in primary HIV-1 infection. Proc Natl Acad Sci U S A. 2008;105(21):7552–7. doi: 10.1073/pnas.0802203105 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref104] 104.Salazar-Gonzalez JF, Salazar MG, Keele BF, Learn GH, Giorgi EE, Li H, et al. Genetic identity, biological phenotype, and evolutionary pathways of transmitted/founder viruses in acute and early HIV-1 infection. J Exp Med. 2009;206(6):1273–89. doi: 10.1084/jem.20090378 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref105] 105.Deymier MJ, Claiborne DT, Ende Z, Ratner HK, Kilembe W, Allen S, et al. Particle infectivity of HIV-1 full-length genome infectious molecular clones in a subtype C heterosexual transmission pair following high fidelity amplification and unbiased cloning. Virology. 2014;468–470:454–61. doi: 10.1016/j.virol.2014.08.018 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref106] 106.Suree N, Koizumi N, Sahakyan A, Shimizu S, An DS. A novel HIV-1 reporter virus with a membrane-bound Gaussia princeps luciferase. J Virol Methods. 2012;183(1):49–56. doi: 10.1016/j.jviromet.2012.03.028 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref107] 107.McCauley SM, Kim K, Nowosielska A, Dauphin A, Yurkovetskiy L, Diehl WE, et al. Intron-containing RNA from the HIV-1 provirus activates type I interferon and inflammatory cytokines. Nat Commun. 2018;9(1):5305. doi: 10.1038/s41467-018-07753-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref108] 108.Imam S, Talley S, Nelson RS, Dharan A, O’Connor C, Hope TJ, et al. TRIM5α Degradation via Autophagy Is Not Required for Retroviral Restriction. J Virol. 2016;90(7):3400–10. doi: 10.1128/JVI.03033-15 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref109] 109.Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014;11(8):783–4. doi: 10.1038/nmeth.3047 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1014020.ref110] 110.Chen Y, Klute S, Sparrer KMJ, Serra-Moreno R. RAB5 is a host dependency factor for the generation of SARS-CoV-2 replication organelles. mBio. 2025;16(5):e0331424. doi: 10.1128/mbio.03314-24 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

HIV-1 Vpr is targeted for degradation by autophagy

Yuexuan Chen

Susanne Klute

Anju Bansal

Konstantin Maria Johannes Sparrer

Ruth Serra-Moreno

Roles

Abstract

Author summary

Introduction

Results

mTOR inhibition causes a reduction in HIV-1 NL4–3 Gag, Vif, and Vpr

Fig 1. Rapamycin causes a reduction in HIV-1 NL4-3 Gag, Vif and Vpr.

HIV-1 NL4–3 Vif downregulation by mTOR-mediated inhibition is due to increased proteasomal function

Fig 2. The inhibition of mTOR causes the proteasomal degradation of Vif.

HIV-1 NL4–3 Vpr is a bona fide autophagy target

Fig 3. NL4-3 Vpr levels are rescued in ATG5KO cells despite mTOR inhibition.

Fig 4. Vpr levels are rescued by autophagy inhibitors in primary cells.

Fig 5. Vpr localizes to autophagosomes, and its autophagy-mediated elimination is counteracted by Nef.

Vpr proteins from ten HIV-1 group M transmitted/founder viruses are resistant to autophagy

Table 1. Group M HIV-1 transmitted/founder viruses used in this study.

Fig 6. Vpr proteins from group M HIV-1 TFVs are resistant to autophagy.

Residues responsible for Vpr’s sensitivity to autophagy map to the second alpha-helix and the unstructured C-terminal tail

Fig 7. Residues responsible for Vpr’s susceptibility to autophagy cluster in the second alpha helix and C-terminus of the protein.

Amino acid changes between autophagy-sensitive and -resistant Vpr account for their differential binding to autophagy receptors

Table 2. Antibody sources and conditions.

Fig 8. Lab-Vpr but not TFV-Vpr associates with NDP52, SQSTM1 and TAX1BP1 autophagy-cargo receptors.

Fig 9. Lab-Vpr but not TFV-Vpr co-localizes with autophagy receptors SQSTM1, TAX1BP1 and NDP52.

Role of ubiquitination in targeting Vpr to autophagosomes

Fig 10. Role of ubiquitination in targeting Vpr for autophagy-mediated degradation.

Autophagy-resistant Vpr proteins confer an advantage in virus spread in an in vitro setting

Fig 11. Vpr proteins from TFVs provide an advantage in virus spread.

Discussion

Materials and methods

Plasmid DNA constructs

Transfections

Cell culture

Generation of knockout cells using CRISPR-Cas9 genome editing

Infections

2D HIV infection assay

3D HIV infection assay

Drug treatments

Western blotting

Immunoprecipitation assays

Fluorescence microscopy

Flow cytometry

Statistical analysis

Supporting information

Data Availability

Funding Statement

References

Decision Letter 0

Edward Campbell

Roles

Author response to Decision Letter 1

Decision Letter 1

Edward Campbell

Roles

Author response to Decision Letter 2

Decision Letter 2

Edward Campbell

Roles

Acceptance letter

Edward Campbell

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases