Citrinin delays muscle aging and extends lifespan in C. elegans and prevents senescence in C2C12 through SKN-1/Nrf2 activation

Abstract

Sarcopenia, a condition characterized by the loss of muscle mass and function with aging, is linked to various health issues including diabetes and increased risk of falls and fractures. Currently, there is no FDA-approved treatment exists for sarcopenia. Citrinin, a natural compound present in daily dietary sources such as grains, has not been well characterized for its biological effects on muscle aging. Here, we found that citrinin exhibits beneficial effects in delaying muscle aging in both Caenorhabditis elegans (C. elegans) and mouse muscle cells (C2C12). Citrinin attenuated the decline of muscle activities in aged C. elegans, including pharyngeal pumping, body bending, maximum velocity, and locomotor abilities. It also prevented myosin protein loss in C. elegans muscle cells. Citrinin activated SKN-1 (the C. elegans ortholog of mammalian Nrf2), which mediated the prevention of myosin protein loss and the decline in muscle activities. Additionally, citrinin extended the median lifespan of C. elegans via SKN-1. Furthermore, we found that IRE-1 mediated the effects of citrinin on SKN-1 activation and that citrinin delayed aging through the IRE-1/SKN-1 pathway. However, citrinin prevented muscle aging in a UPR^ER (unfolded protein response of the endoplasmic reticulum) independent manner. In addition, in C2C12 cells, citrinin reduced the number of β-galactosidase-positive stained cells, prevented nuclear expansion, and decreased p21 expression under etoposide-induced senescence conditions, while also activating Nrf2. These findings suggest that citrinin is a potential candidate compound for preventing muscle aging by inducing well-conserved stress response mechanisms from C. elegans to humans. Thus, we propose that citrinin may have positive effects on promoting healthy aging in humans.

Supplementary Information

The online version contains supplementary material available at 10.1007/s11357-025-01713-7.

Introduction

Sarcopenia is defined as the age-related loss of muscle mass and function [1]. It is characterized by declines in muscle quality, strength, and changes in muscle composition. Sarcopenia is associated with reduced quality of life in the elderly and is linked to higher morbidity (e.g., falls, fractures, hospitalizations) and mortality. It is also closely tied to the development of comorbidities such as diabetes, hypertension, and cardiovascular diseases, including arteriosclerosis, making it a critical factor in age-related health decline. Despite its significant impact, no drug has been approved by the U.S. Food and Drug Administration (FDA) for sarcopenia treatment.

Citrinin, a mycotoxin produced by certain Penicillium [2] and Aspergillus species, exhibits complex biological properties. While primarily known for its nephrotoxic and cytotoxic properties [3, 4], it is also found in traditional Asian medicines like red yeast rice. Recent studies suggest citrinin may have paradoxical benefits, such as anticancer [5, 6] and neuroprotective effects [7]. However, its impact on muscle aging remains unexplored, necessitating further research to clarify its role in human health.

Caenorhabditis elegans (C. elegans) is a microscopic roundworm widely used as a model organism in aging research due to its short lifespan (approximately 3 weeks), ease of maintenance, and genetic tractability [8]. Importantly, C. elegans shares conserved molecular pathways regulating muscle aging with mammals, including humans [9]. For example, C. elegans muscles exhibit a striated structure and sarcomeres responsible for contraction, which are structurally and functionally analogous to human skeletal muscle. These similarities extend to molecular mechanisms governing muscle development and function, making C. elegans a valuable model for studying interventions to delay age-related diseases like sarcopenia [10].

SKN-1, the C. elegans homolog of mammalian Nrf2 (nuclear factor erythroid 2-related factor), plays a critical role in stress resistance and longevity. In mammals, Nrf2 regulates adaptive responses to oxidative and toxic stressors (e.g., paraquat, hydrogen peroxide, cadmium, ultraviolet light) [11]. Similarly, constitutively active SKN-1 extends C. elegans lifespan, positioning SKN-1 activators as potential anti-aging targets [12]. For example, dietary restriction—a well-established longevity intervention [13, 14], increases the lifespan of C. elegans through SKN-1 activation [15]. Additionally, insulin/IGF-1-mediated longevity pathways partially depend on SKN-1 [12].

The ribonuclease inositol-requiring protein-1 (IRE-1) functions as a component of the UPR^ER (unfolded protein response in the endoplasmic reticulum) system, which monitors environmental stress and triggers a signaling network to activate protein-folding pathways [16]. ER stress response mechanisms, including the IRE-1 signaling pathway, regulate longevity in C. elegans [17], and IRE-1 has been shown to collaborate with SKN-1 to modulate stress resistance and control SKN-1 activity [18].

Here, we demonstrate citrinin’s anti-aging effects in C. elegans and mouse muscle cells (C2 C12). Citrinin mitigated muscle aging, extended lifespan in C. elegans. We found that citrinin activates SKN-1 in C. elegans, with its anti-aging effects dependent on SKN-1. Notably, citrinin delayed aging via the IRE-1/SKN-1 axis but acted independently of UPR^ER. Furthermore, citrinin activated Nrf2 and reduced senescence in C2 C12 cells. Given the evolutionary conservation of these pathways, our findings suggest citrinin may influence muscle aging in mammals, including humans.

Results

Citrinin prevents the muscle aging in C. elegans

To find materials that can prevent the decline of muscle activity with aging, we screened compounds from the Screen-Well® Natural Product library [each concentration of compounds was 50 μM] (BML-2865) using C. elegans, which is a representative animal model for aging research [19]. We monitored the number of body bends in liquid conditions at the mid-age stage (day 7 of adulthood) in screening assay (See the details in Method and Materials). Through the initial screening (data not shown), interestingly, we found that citrinin mitigated the decline of muscle activity in aging. Citrinin has been reported as a potential treatment for age-related diseases [5–7]. However, the effects of citrinin on the regulation of muscle aging have not been investigated.

As citrinin exhibits toxic properties above a certain concentration [4], we first tested the toxic effect of citrinin (Sigma-Aldrich, CAS No. 518–75-2, ≥ 98% purity) in C. elegans. In animals, the toxicity of a substance is determined by measuring its effects on development or brood size [20], thus we tested the effects of citrinin on the development and brood size in C. elegans. To compare developmental speed with or without citrinin, we transferred synchronized L1 stage worms to control or citrinin-treated assay plates. As shown in Figure S1A, 48 h (I) or 60 h (II) from the L1 stage, the developmental stage of worms was observed independently, and we found that there were no differences in the developmental stage between citrinin-treated worms and control worms. In addition, number of progenies of the two groups were not significantly different (Figure S1B). Therefore, these data imply that citrinin (50 μM) was nontoxic to C. elegans in our assay system.

Next, we investigated the effects of citrinin on preventing muscle aging in C. elegans using various muscle function assays (Figure S2). The pharyngeal pumping rate and body bending rate decrease during aging, both of which are representative muscle aging phenotypes in C. elegans [21]. When the pharyngeal pumping rate was evaluated by chronological age after citrinin treatment from the progeny stage, the control and citrinin-treated wild-type worms (N2) showed similar motor function on day 1 of adulthood (Fig. 1A and Table S1). However, the citrinin-treated group exhibited a significantly higher pharyngeal pumping rate than the control group on day4 (p < 0.05) and day8 (p < 0.0001) of adulthood. The number of body bends was also similar on day 1 of adulthood; however, citrinin-treated worms showed a higher number of body bends than the control group during aging [control group (4.9) vs. citrinin-treated group (8.7), p < 0.01] (Fig. 1B, Figure S3).

Fig. 1.

Citrinin prevents the muscle aging in C. elegans. A Pharyngeal pumping numbers of control or citrinin-treated wild type strains at day8 of adulthood [control (n = 20) and citrinin (n = 18)]. Representative data shown from n = 3 independent biological replicates. See also Figure S3A. B Body bending numbers of control or citrinin-treated wild type strains at day8 of adulthood [control (n = 15) and citrinin (n = 25)]. Representative data shown from n = 2 independent biological replicates. See also Figure S3B. C Maximum velocity of control and citrinin-treated wild type strains at day9 of adulthood [control (n = 16), citrinin (n = 23)]. Sum of n = 2 independent biological replicates. D The proportion of worms in each motility class. At day11 of adulthood, control (n = 78) and citrinin (n = 89). Data were obtained from n = 2 independent experiments. See also Figure S4. E (I) Representative images of MYO-3::GFP with or without citrinin in DM8005 strains at day4 of adulthood. The Scale bar means 100uM. (II) Relative level of MYO-3::GFP in DM8005 strains with citrinin or without citrinin at day4 of adulthood. [control (n = 17), citrinin (n = 26)]. See also Figure S5. Sum of n = 2 independent biological replicates. ** p < 0.01, **** p < 0.0001. The data were analyzed using a t-test to compare two groups

We further tested citrinin’s effect on physical abilities by measuring maximum velocity (MV) [22]. Citrinin improved the MV of aged worms compared to the control group [control MV: 0.21 mms⁻¹ vs. citrinin-treated MV: 0.32 mms⁻¹, p < 0.01] (Fig. 1C). Collectively, these data indicate that citrinin does not enhance physical function but helps maintain motor activity during aging.

Furthermore, the locomotor abilities of C. elegans are observed by dividing them into three class types based on the appearance of movement [23]. Class A moves constantly and draws an S-shaped curve. Class B does not move unless touched and does not show an S-shaped curve movement. Class C does not move back and forth when touched, but moves its head and/or tail when touched. As shown in Fig. 1D, the proportion of Class A worms was approximately 3 times higher in citrinin-treated group compared to the control group (con 13% vs. cit 37%), while the proportion of Class C worms was approximately 3 times lower in the citrinin-treated group compared to the control group (con 49% vs. cit 18%). All of these data imply that citrinin prevents the muscle aging in C. elegans.

In human skeletal muscle, myosin heavy chain synthesis decreases with aging [24], and the expression level of myosin heavy chain (myo-3) also reduced in aged C. elegans [25]. Using DM8005 strains expressing GFP-tagged MYO-3 localized to muscle myofilaments, we compared MYO-3::GFP levels in aging worms with and without citrinin. As shown in Figure S5A, we confirmed that the level of MYO-3::GFP was decreased from early mid-age worms at day4 of adulthood. However, citrinin-treated DM8005 strains showed higher level of MYO-3::GFP than that of control worms [control group (1.0) vs. citrinin-treated group (1.5), p < 0.0001] (Fig. 1E). Note that MYO-3::GFP level were similar between control and citrinin-treated DM8005 strains at day1 of adulthood (Figure S5B). These results demonstrate citrinin preserves muscle protein integrity during aging.

Citrinin activates SKN-1 in C. elegans

To understand the mechanism of action (MOA) of citrinin, we attempted to identify the regulatory gene that mediates the effect of citrinin on aging in C. elegans. Among the pro-longevity genes, DAF-16 is a transcription factor that regulates longevity in many animal models [26], and activation of DAF-16 is sufficient to extend longevity. As shown in Fig. 2A, citrinin-treated daf-16(mu86) mutant strains showed an increased pharyngeal pumping rate compared to the control daf-16(mu86) mutant strains at day8 of adulthood (control group (5.1) vs. citrinin-treated group (14.3), p < 0.0001), suggesting that DAF-16 is not necessary for preventing muscle aging by citrinin (Fig. 2A, Table S1). AAK-2 is an α subunit of 5'adenosine monophosphate-activated protein kinase (AMPK) that is activated by AMP and functions to extend lifespan in C. elegans [27]. We tested the effect of citrinin on aak-2(ok524) mutant strains, and we found that citrinin-treated aak-2(ok524) mutant strains also showed the increased pharyngeal pumping rate than that of control aak-2(ok524) mutant strains at day8 of adulthood (control group (10.7) vs. citrinin treated group (17.8); p < 0.01) (Fig. 2B, Table S1), thereby suggesting that citrinin prevents the decline of muscle activity independent to DAF-16 and AMPK.

Fig. 2.

Citrinin activates SKN-1. A Pharyngeal pumping numbers of control and citrinin-treated daf-16 mutant strains. Data were obtained from n = 2 independent experiments. See also Table S1. B Pharyngeal pumping numbers of control and citrinin-treated aak-2 mutant strains. Data were obtained from n = 2 independent experiments. See also Table S1. C Pharyngeal pumping numbers of control and citrinin-treated skn-1 mutant strains. Data were obtained from n = 2 independent experiments. See also Table S1. D Real-time qPCR analysis of relative expression level of gst-4, a readout for SKN-1 activity, in citrinin non-treated N2 [N2 con], citrinin treated N2 [N2 cit], citrinin non-treated skn-1 mutant strains [skn-1 con], and citrinin treated skn-1 mutant strains [skn-1 cit]. E (I) Epifluorescence images of the expression pattern of gst-4 in vivo at day2 of adulthood in citrinin non-treated CL2166 (CL2166 (-)), citrinin treated CL2166 (CL2166 (+)), citrinin non-treated QV224 (QV224 (-)), citrinin treated QV224 (QV224 (+)). The Scale bar means 100uM. (II) The gst-4p::GFP level was assessed. The quantification of fluorescence intensity in whole body was analyzed using Image J. CL2166 con (n = 26), CL2166 cit (n = 36), QV224 con (n = 8), QV224 cit (n = 8). F Schematic diagram of regulation of SKN-1 activity by WDR-23. G Real-time qPCR analysis of relative expression level of gst-4 in (I) L4440 RNAi N2 strains and (II) wdr-23 RNAi N2 strains. H Relative level of gst-4p::GFP in L4440 RNAi CL2166 strains at day2 of adulthood with or without citrinin [control (n = 21) and citrinin (n = 15)]. The Scale bar means 100uM. I Relative level of gst-4p::GFP in wdr-23 RNAi CL2166 strains at day2 of adulthood with or without citrinin [control (n = 18) and citrinin (n = 16)]. The Scale bar means 100uM. J Schematic diagram of the experiment to explore the regulation of gst-4 expression by citrinin under heat-killed OP50 feeding conditions. H (I) Epifluorescence images of the expression pattern of gst-4 in vivo at day 3 adulthood CL2166 strains fed with or without citrinin for 72 h on heat-killed OP50. The Scale bar means 100uM. (II) Relative levels of gst-4p::GFP in day 3 adulthood CL2166 strains fed with or without citrinin for 72 h on heat-killed OP50 at the L4 stage. ns, not significant, ** p < 0.01, *** p < 0.001, **** p < 0.0001. The data were analyzed using a t-test to compare two groups

In C. elegans, SKN-1 resembles mammalian Nrf2, and it activates a detoxification response and promotes resistance to oxidative stress [28]. We found that citrinin did not improve the muscle activity in skn-1(zj25) mutant strain during aging process (Fig. 2C), implies that skn-1 is necessary for citrinin to prevent muscle aging. To understand the more detailed MOA of citrinin on SKN-1, we tested its effect on SKN-1 activity. GST-4 is flanked by the SKN-1 binding site, and the transcriptional activation of gst-4 is used as a readout for SKN-1 activity [29]. We found that the expression level of gst-4 was highly (2.8-fold; p < 0.001) increased in citrinin-treated wild-type (N2) worms compared to that in control wild-type worms (Fig. 2D). However, in citrinin-treated skn-1(zj25) mutant strains, gst-4 expression levels were significantly reduced compared to those in citrinin-treated wild-type worms (N2 cit (2.8) vs. skn-1 cit (0.8); p < 0.01) (Fig. 2D). These data imply that citrinin induces gst-4 expression in a skn-1 dependent manner. In addition, we observed changes in gst-4 expression by citrinin using a reporter transgenic strains, CL2166 or QV224. (CL2166, containing gst-4p::GFP::NLS in the wild type background, and QV224, containing gst-4p::GFP::NLS in skn-1(zj15) mutant strain background). As shown in Fig. 2E, the expression level of gst-4p::GFP increased 3.0-fold in citrinin treated CL2166 compared to that of control CL2166 (p < 0.0001); however, gst-4p::GFP expression level was significantly reduced in citrinin-treated QV224 compared to citrinin-treated CL2166 (p < 0.0001). Note that although SKN-1 depletion significantly reduces gst-4 levels (Fig. 2D and E), the two-fold increase of gst-4 in skn-1(zj25) mutant strains by citrinin [from 0.4 to 0.8 in skn-1(zj25) mutant strains (Fig. 2D), and from 0.1 to 0.2 in CL2166 strains (Fig. 2E)], suggests that citrinin increases gst-4 expression via a dual regulatory mechanism, a primary SKN-1-dependent pathway and a secondary SKN-1-independent pathway.

By Q-PCR, we found that the expression level of skn-1 was not altered by citrinin (Figure S6), suggesting that citrinin had no effect on the regulation of skn-1 transcription. To understand more detailed MOA of SKN-1 activation by citrinin, we investigated whether WDR-23 is involved in citrinin-induced SKN-1 activation. WDR-23 in C. elegans is a crucial regulatory protein that inhibited the activity of SKN-1 (Fig. 2F) [30]. We confirmed that SKN-1 target gene, gst-4, expression was highly increased by wdr-23 RNAi (Figure S7). As shown in Fig. 2G, by Q-PCR, we found that citrinin increased gst-4 expression level about 2.7-fold in wild-type strains in L4440 RNAi condition, however there was no additive increase of gst-4 expression by citrinin in wdr-23 RNAi condition (Fig. 2G). In addition, we found that citrinin increased gst-4p::GFP level in L4440 RNAi CL2166 strains (Fig. 2H), but it did not increase gst-4p::GFP level of CL2166 strains in wdr-23 RNAi condition (Fig. 2I). All these data suggest that citrinin activates SKN-1 in C. elegans, possibly involving WDR-23.

Recent studies have highlighted the significant role of intestinal bacteria in modulating host responses to drugs [31]. This growing body of evidence emphasizes the complex interactions between the gut microbiome and pharmacological agents, which can influence drug efficacy, toxicity, and metabolism. Thus, we investigated whether E. coli OP50 mediated citrinin-induced activation of SKN-1 in C. elegans. To do that we observed gst-4 expression level using heat-killed E. coli OP50. As shown in Fig. 2J and K, citrinin induced gst-4 expression even when C. elegans were fed heat-killed OP50, suggests that the effect of citrinin on SKN-1 activation is likely due to direct interactions between citrinin and C. elegans, rather than being mediated through E. coli OP50.

Citrinin prevents muscle aging and extends lifespan via SKN-1 in C. elegans

Next, to confirm whether the muscle function protective effect of citrinin is related to the activation of SKN-1, we treated citrinin to skn-1(zj15) mutant stains and observed changes in motor function during aging. As a result, we found that the anti-muscle aging effects of citrinin, which was observed in wild-type (N2) strains, were not observed in skn-1(zj15) mutant strains. The body bending number of citrinin-treated or citrinin non-treated skn-1(zj15) mutant strains were similar in aging (Fig. 3A, Figure S8), and the proportion of Class A worms was slightly reduced in citrinin-treated group compared to the control group (con 77% vs. cit 65%). Conversely, the proportion of Class C worms was increased in the citrinin-treated group compared to the control group (con 9% vs. cit 22%) (Fig. 3B, Figure S8).

Fig. 3.

Citrinin extends health span in C. elegans through SKN-1. A Body bending numbers of control or citrinin-treated wild type strains at day8 of adulthood [control (n = 28) and citrinin (n = 21)]. Representative data shown from n = 3 independent biological replicates. See also Figure S8. B The proportion of worms in each motility class. At day7 of adulthood, control (n = 35) and citrinin (n = 23). Data were obtained from n = 2 independent experiments. See also Figure S8(III). C Relative MYO-3::GFP level in wild-type strains at day4 of adulthood with or without citrinin in skn-1 RNAi condition. Sum of n = 2 independent biological replicates. D The survival rate of wild type strains (N2) with or without citrinin. Representative data shown from n = 3 independent biological replicates. See also Figure S9. E The survival rate of skn-1 mutant strains with or without citrinin. Representative data shown from n = 3 independent biological replicates. See also Figure S10. ns, not significant, *** p < 0.001 Data were analyzed using a Log-rank (Mantel-Cox) test and t-test to compare two groups

In addition, MYO-3::GFP level in body wall muscle in citrinin-treated worms was not higher than that of control groups in skn-1 RNAi condition (Fig. 3C), unlike that was shown in the wild-type strains (Fig. 1E). Furthermore, as constitutively active SKN-1 increased the lifespan of C. elegans [12], we found that citrinin increased median lifespan of wild-type strains (Fig. 3D, Figure S9). However, citrinin did not increase the lifespan in skn-1(zj25) mutant strains (Fig. 3E, Figure S10). Survival data are summarized in Table S2. Therefore, all of these data indicate that citrinin mitigates muscle aging and prolongs lifespan, particularly through the SKN-1 signaling pathway.

Citrinin delays aging via IRE-1/SKN-1 in C. elegans

As SKN-1 is a stress response factor, citrinin induced SKN-1 activation indicates that citrinin may induce a stress. In various stress environments, SKN-1 could interact with various another stress response factors. In fact, under ER stress condition, IRE-1 (inositol-requiring protein-1) activates SKN-1 [18]. In this study, we also found that IRE-1 is necessary for SKN-1 activation in citrinin treated condition. As shown in Fig. 4A, gst-4, a readout for SKN-1 activity, expression level was significantly reduced in ire-1(v33) mutant strains compared with wild-type (N2) worms in citrinin treated condition [N2 cit (3.5) vs. ire-1 cit (1.8); p < 0.001]. In addition, the gst-4p::GFP level was also significantly reduced in citrinin-treated CL2166 strains by ire-1 RNAi compared to citrinin-treated CL2166 strains (p < 0.0001) (Fig. 4B). Furthermore, the pumping rate of ire-1(v33) mutant strains was not increased by citrinin (p = 0.64) (Fig. 4C, Figure S11), and citrinin did not increase the lifespan in ire-1(v33) mutant strains (Fig. 4D, Figure S12). All of these data imply that ire-1 mediates the citrinin effects on preventing aging. In addition, in citrinin-treated condition, the expression level of gst-4 in between SKN-1 single knockdown and SKN-1 and IRE-1 double knockdown condition was similar (p = 0.12) (Fig. 4E), and the expression of gst-4p::GFP was unchanged by ire-1 RNAi in citrinin-treated QV224 strains (p = 0.13) (Fig. 4F). These data suggest that IRE-1 and SKN-1 may respond to citrinin via the same pathway. All of these data imply that IRE-1 is necessary for the SKN-1 activation by citrinin, and IRE-1/SKN-1 signaling may mediate the effects of citrinin.

Fig. 4.

Citrinin delays aging via IRE-1/SKN-1. A Real-time qPCR analysis of relative expression level of gst-4 in citrinin non-treated wild type strains [N2 con], citrinin treated wild type strains [N2 cit], citrinin non-treated ire-1 mutant strains [ire-1 con], and citrinin treated ire-1 mutant strains [ire-1 cit]. n = 3 independent biological replicates. B (I) Representative images of gst-4p::GFP at day2 of adulthood in citrinin non-treated CL2166 L4440 RNAi, citrinin treated CL2166 L4440 RNAi, citrinin non-treated CL2166 ire-1 RNAi, and citrinin treated CL2166 ire-1 RNAi. The Scale bar means 100uM. (II) The gst-4p::GFP level was assessed. The quantification of fluorescence intensity in whole body was analyzed using Image J. L4440 RNAi CL2166 con (n = 15), L4440 RNAi CL2166 cit (n = 13), ire-1 RNAi CL2166 con (n = 18), ire-1 RNAi CL2166 cit (n = 14). C Pharyngeal pumping numbers of control and citrinin-treated ire-1 mutant strains at day8 of adulthood [control (n = 12) and citrinin (n = 14)]. Representative data shown from n = 2 independent biological replicates. See also Figure S11. D The survival rate of ire-1 mutant strains with or without citrinin. Representative data shown from n = 2 independent biological replicates. See also Figure S12. E Realtime qPCR analysis of relative expression level of gst-4 in citrinin non-treated N2 skn-1 RNAi (skn-1 RNAi N2 con), citrinin treated N2 skn-1 RNAi (skn-1 RNAi N2 cit), citrinin non-treated ire-1 mutant strains skn-1 RNAi (skn-1 RNAi ire-1 con), and citrinin treated ire-1 mutant strains skn-1 RNAi (skn-1 RNAi ire-1 cit). F (I) Representative images of gst-4p::GFP at day2 of adulthood in citrinin non-treated QV224 L4440 RNAi, citrinin treated QV224 L4440 RNAi, citrinin non-treated QV224 ire-1 RNAi and citrinin treated QV224 ire-1 RNAi. The Scale bar means 100uM. (II) The gst-4p::GFP level was assessed. The quantification of fluorescence intensity in whole body was analyzed using Image J. L4440 RNAi QV224 con (n = 21), L4440 RNAi QV224 cit (n = 22), ire-1 RNAi QV224 con (n = 21), ire-1 RNAi QV224 cit (n = 19). G Overview of UPR^ER signaling pathway in C. elegans. H Real-time qPCR analysis of relative expression level of hsp-4 in N2 with or without citrinin. n = 3 independent biological replicates. I Pharyngeal pumping numbers in citrinin non-treated pek-1 mutant strains and citrinin treated pek-1 mutant strains at day8 of adulthood [control (n = 28) and citrinin (n = 24)]. Sum of n = 2 independent biological replicates. J Pharyngeal pumping numbers in citrinin non-treated atf-6 mutant strains and citrinin treated atf-6 mutant strains at day8 of adulthood [control (n = 35) and citrinin (n = 32)]. Sum of n = 2 independent biological replicates. ns., not significant. * p < 0.05, *** p < 0.001, **** p < 0.0001. The data were analyzed by a t-test to compare two groups

Citrinin prevents muscle aging UPR^ER independent manner

We found that IRE-1 mediated the response to citrinin. IRE-1 (inositol-requiring protein-1) is a component of UPR^ER (unfolded protein response in endoplasmic reticulum) system [16] that monitors environmental stress conditions and triggers a signaling network that activates an unfolded protein response (Fig. 4G). To investigate whether citrinin induces ER stress, we observed changes in the expression of hsp-4, a UPR^ER marker gene [16]. We found that there was no difference in hsp-4 expression between citrinin-treated and control worms (Fig. 4H). In addition, we found that ATF-6 and PERK, other components of the UPR^ER system, were not necessary for preventing muscle aging by citrinin (Fig. 4I and J). These data suggest that citrinin does not prevent muscle aging through UPR^ER. Note that ire-1 RNAi efficiently reduced the TM-induced increase in hsp-4 expression [16], and skn-1 RNAi clearly inhibited the increase in gst-4 expression induced by citrinin, indicating that ire-1 RNAi and skn-1 RNAi systems worked well (Figures S13 and S14).

Citrinin prevents cellular senescence in mouse muscle cells and activates Nrf2

Next, to investigate whether citrinin also works in mammalian cells, we observed the effects of citrinin on mouse muscle cells (C2 C12). We first performed methyl thiazolyl tetrazolium (MTT) assay to find the optimal safe concentrations of citrinin. MTT, or 3-(4,5-dimethylthiazol-2-yl)−2,5-diphenyltetrazolium bromide, is utilized to evaluate cellular viability and cytotoxicity. This colorimetric assay measures the conversion of MTT to insoluble purple formazan crystals by metabolically active cells, providing a quantitative indication of the number of viable and proliferating cells, as well as assessing cytotoxic effects [32]. As shown in Fig. 5A, we found that cell viability of C2 C12 was not reduced up to 50 μM, means that up to 50 μM citrinin is safe in cells. We also performed lactate dehydrogenase (LDH) assay that evaluates cell damage and lysis by measuring LDH enzyme released from damaged cells [33]. As shown in Fig. 5B, we confirmed that citrinin did not increase cell cytotoxicity up to 50 μM, supporting that up to 50 μM citrinin is safe in cells.

Fig. 5.

Citrinin prevents senescence of C2 C12 activates Nrf2. A Cell viability assessed via MTT assay; cells treated with varying citrinin concentrations (0, 3.125, 6.25, 12.5, 25, 50, 100, and 1000 μM). B Lactate dehydrogenase (LDH) assay in C2 C12 with or without citrinin. C (I) Representative beta‐gal staining images of C2 C12 cells (Left) without etoposide (ETO(-)) and citrinin (Cit(-)), (Middle) with etoposide (ETO(+)) and without citrinin (Cit(-)), (Right) with etoposide (ETO(+)) and citrinin (Cit(+)). The concentration of citirinin was 50 μM and ETO was 0.5 μM. The Scale bar means 20uM. (II) The proportion of SA-β-gal positive cells in each condition. D (I) Representative DAPI images of C2 C12 cells (Left) without etoposide (ETO(-)) and citrinin (Cit(-)), (Middle) with etoposide (ETO(+)) and without citrinin (Cit(-)), (Right) with etoposide (ETO(+)) and citrinin (Cit(+)). The Scale bar means 10uM. The concentration of citirinin was 50 μM and ETO was 0.5 μM. (II) Relative nuclear size in each conditioning cells in Fig. (d, I). Nuclear size was determined by measuring the diameter of stained nuclei and normalized to the average diameter of the ETO(-) Cit(-) group. E and F Relative expression level of p21(E) and p53(F). Real-time qPCR analysis of relative expression level of p21 and p53 under conditions of treatment with (+) or without (-) etoposide or citrinin in C2 C12 cells. Relative expression level of glutathione S-transferases (Gsts) genes in C2 C12 with or without citrinin. The relative expression level of (G). GSTA1, H GSTA2, I GSTA3, J GSTA5, and K Nrf2. Figure 5’s data represent the sum of n = 3 independent biological replicates. ns, not significant, n.s., not significant, * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001. Data were analyzed by t-test to compare two groups

To investigate the effect of citrinin on muscle aging, we observed the effect of citrinin on cellular senescence in C2 C12. We induced senescence in C2 C12 through etoposide treatment. SA-β-gal staining was performed to confirm cellular senescence. The increased activity of SA-β-gal, a typical indicator of senescence, results in blue granules in the cytoplasm [34]. When C2 C12 were treated with 0.5 μM etoposide for 24 h, the percentage of SA-β-gal positive cells significantly increased compared to the control groups [ETO(-)Cit(-), 7%; ETO(+)Cit(-), 71%; p < 0.0001] (Fig. 5C). In addition, based on reports of nuclear expansion in senescent cells [35], changes in nuclear size were confirmed through DAPI staining analysis in etoposide-treated C2 C12. When C2 C12 was treated with 0.5 μM etoposide for 24 h, the size of DAPI stained nucleus increased by approximately 1.2-fold [ETO(-)Cit(-), 1.0; ETO(+)Cit(-), 1.2; p < 0.05] (p < 0.05) compared to the control groups (Fig. 5D). Thus, these data imply that ETO-induced senescence in C2 C12. We found that citrinin treatment significantly reduced the proportion of SA-β-gal positive cells [ETO(+)Cit(-), 71%; ETO(+)Cit(+), 27%; p < 0.0001] (Fig. 5C) and inhibited the increase in nuclear size by ETO [ETO(+)Cit(-), 1.2; ETO(+)Cit(+), 1.0; p < 0.05] (Fig. 5D). These data imply that citrinin prevents cellular senescence in C2 C12.

Furthermore, p21 (CDKN1 A) is a cell cycle regulatory protein that inhibits CDK/Cyclin complexes, halting the cell cycle and inducing cellular senescence [36]. We found that etoposide treatment significantly increased p21 levels, while subsequent citrinin exposure statistically reduced p21 expression (**p < 0.01) (Fig. 5E). While p53 is a known upstream regulator of p21, prior studies demonstrate that p21 upregulation can occur independently of p53 expression changes [37–39]. Consistent with these reports, we observed no detectable alterations in p53 levels under our experimental conditions, despite robust p21 induction (Fig. 5F). These data imply that citrinin mitigates etoposide-induced cellular senescence by targeting the p21-mediated cellular senescence pathway.

Next, we observed whether citrinin could activate Nrf2 in C2 C12. Nrf2 has known to regulate the transcription of several glutathione S-transferases (Gsts) (Gsta1, Gsta2, Gsta3, Gsta5) [40]. As shown in Fig. 5G-J, the expression levels of Gstas significantly increased by citrinin in C2 C12 cells, however the expression level of Nrf2 target genes significantly decreased by siNrf2 in citrinin-treated C2 C12 cells. These data imply that citrinin activates Nrf2. Note that citrinin did not increase the transcriptional level of Nrf2 in C2 C12 (Fig. 5K).

Discussion

In this study, we unveiled the unexpected anti-aging properties of citrinin, a mycotoxin produced by several fungal species, in both C. elegans and mouse muscle cells. We demonstrated that citrinin treatment mitigated the decline in muscle activity and preserved muscle quality in aged C. elegans, while simultaneously prevented cellular senescence in mouse muscle cells. Notably, citrinin administration extended lifespan in C. elegans. Our findings revealed that these beneficial effects were mediated through the activation of SKN-1/Nrf2, a highly conserved transcription factor involved in stress resistance and longevity from nematodes to humans (Fig. 6).

Fig. 6.

A schematic diagram of the working mechanism of citrinin to delay muscle aging

Traditionally, certain environmental chemicals have been classified as toxins due to their detrimental effects at high exposures. However, accumulating evidence suggests that some of these compounds can elicit beneficial biological responses when administered under carefully controlled conditions. This paradox reflects the broader concept of chemical stress-induced adaptation, in which low-level or transient exposure to exogenous stressors activates evolutionarily conserved cellular defense pathways [41]. Such adaptive responses may include the enhancement of antioxidant defenses [42], and modulation of metabolic processes [43]—all of which are intricately linked to aging and longevity. In this context, the re-evaluation of toxic substances as potential modulators of aging-related pathways presents a compelling shift in perspective. Citrinin investigated in this study exemplifies this notion. Previously citrinin has recognized primarily as a mycotoxin [4] however, our findings reveal its capacity to promote longevity-associated phenotypes via upregulation of cellular defense mechanisms, including antioxidant systems and stress response proteins. Citrinin treatment triggered adaptive stress responses that contributed to improved muscle health and longevity, and a key mediator in this process is SKN-1 (ortholog of mammalian Nrf2), a transcription factor that orchestrates cellular defenses against oxidative and xenobiotic stress. SKN-1/Nrf2 activation induces the expression of genes involved in detoxification and stress responses, potentially contributing to enhanced cellular resilience and longevity. This aligns with previous studies showing that SKN-1 is crucial for lifespan extension in C. elegans under various interventions.

Recent research has revealed a novel function of IRE-1, extending beyond its well-known role in the unfolded protein response, UPR^ER [44]. This transmembrane protein can activate the SKN-1/Nrf2 antioxidant response independently of its UPR^ER function, through a mechanism triggered by cysteine sulfenylation within its kinase activation loop [44]. This pathway has been shown to enhance stress resistance and longevity in C. elegans, demonstrating IRE-1's versatility as a cytoplasmic stress sensor. In this study, we also observed that in a citrinin-treated environment, IRE-1 induces SKN-1 activation and prevents muscle aging UPR^ER independent manner. While the exact environmental changes caused by citrinin remain to be elucidated, our findings suggest that IRE-1 can respond to various environmental stimuli, coordinating cellular processes accordingly. This discovery underscores the complexity of cellular stress responses and highlights the adaptability of key regulatory proteins like IRE-1 and SKN-1. It suggests that cells possess sophisticated mechanisms to integrate different types of stress signals, allowing for nuanced responses to environmental challenges. Further research into these pathways may provide valuable insights into stress resistance and aging processes.

In aging, sarcopenia is a representative age-associated muscle disease, defined as the loss of muscle mass and activity with aging, and is a geriatric disease that induces numerous adverse risk outcomes in the elderly. However, currently, there is no suitable preventive agent for sarcopenia. Here, we found that citrinin prevented the decline of muscle quality and activities during aging in C. elegans, and it prevented senescence of mice muscle cells. Furthermore, citrinin worked through the activation of evolutionarily conserved stress resistance signal, SKN-1/Nrf2. Nrf2 plays a crucial role in regulating mitochondrial function and biogenesis [45, 46]. In muscle cells, mitochondria are essential for energy production, and their dysfunction is closely linked to muscle aging. In addition, Nrf2 is significantly involved in the protein quality control (PQC) system [47]. During the aging process of muscle cells, the balance between protein synthesis and degradation often becomes disrupted. The activation of Nrf2 can aid in maintaining this protein homeostasis, which is crucial for protecting muscle quality. Therefore, our findings suggest that functional studies on citrinin have the potential to be applied to the development of new therapeutics for an age-related disease, sarcopenia.

Materials and methods

Cell culture condition

C2 C12 myoblast cells (CRL-1772; ATCC) were cultured in Dulbecco’s Modified Eagles Medium (Cat No. SH30243.01, Hyclone) supplemented with 10% fetal bovine serum (Cat No. SH30919.03, Hyclone) and 1% Penicillin–Streptomycin (Cat No. 15140122, Gibco). Cell incubation condition was maintained at 37 °C in a 5% CO₂ atmosphere.

Methyl thiazolyl tetrazolium (MTT) assay

MTT assays were performed using C2 C12 myoblast cells at passage 7. Cells were seeded 1 × 10⁴ cells/well in 96-well plates with medium, allowed to attach for 24 h, and were incubated. Then, they were treated with various concentrations of citrinin (0, 3.125, 6.25, 12.5, 25, 50, 100, and 1000 μM) and incubated for 24 h. Following a 24 h incubation add 20 µL/well MTT (Cas No. 298–93-1, Sigma-Aldrich, St. Louis, MO, USA) reagent (concentration of 5 mg/mL dissolved in PBS) and 4 h incubating. After 4 h aspirate the all medium and add 200µL of DMSO per well to dissolve formazan. The MTT assay independently performed three times for each cell sample. The absorbance was measured at the wavelength of 560 nm using a microplate reader (Agilent Technologies, Santa Clara, CA, USA).

Senescence induction

Cultured cells were treated with 0.5 μM etoposide (Cas No. 33419–42-0, Sigma-Aldrich, St. Louis, MO, USA) for 24 h, while the control group was treated with 0.1% DMSO. After the 24-h etoposide treatment, cells were washed with phosphate-buffered saline (PBS) and subsequently incubated in medium (DMEM) for an additional 2 days.

β-Galactosidase staining

β-Galactosidase staining assays were performed using C2 C12 myoblast cells at passage 9. Cells were seeded at 0.5 × 10⁵ cells/well in 6-well plates with medium and allowed to attach for 24 h. Subsequently, cells were treated with 50 μM citrinin and incubated for another 24 h. After incubation, cells were washed with PBS and then treated with 0.5 μM etoposide (Cas No. 33419–42-0, Sigma-Aldrich, St. Louis, MO, USA) to induce senescence. β-Galactosidase activity was determined using the Senescence β-Galactosidase Activity Assay Kit (Cell Signaling Technology, Danvers, MA, USA) following a standard protocol. The cells were observed using an inverted system microscope (Olympus, Tokyo, Japan). Absorbance at the wavelength of 640 nm was measured using a microplate reader (Agilent Technologies, Santa Clara, CA, USA) after adding DMSO to the cells to determine the percentage of β-galactosidase-positive cells in the total cell population.

Lactate dehydrogenase (LDH) assay

LDH assays were performed using C2 C12 myoblast cells at passage 7. Cells were seeded 1 × 10⁴ cells/well in 96-well plates with medium, allowed to attach for 24 h, and were incubated. Then, they were treated with various concentrations of citrinin (0, 3.125, 6.25, 12.5, 25 and 50 μM) and incubated for 24 h. Following the 24-h incubation, the CyQUANT™ LDH Cytotoxicity Assay(Cat No. C20300, ThermoFisher) was used. An aliquot of the cell culture medium was transferred to a new plate and the reaction mixture was added. After a 30-min incubation, the reaction was stopped by adding Stop Solution, and absorbance was measured at 490 nm using a microplate reader. (Agilent Technologies, Santa Clara, CA, USA).

Small interfering RNA transfection

siRNA transfections were performed using C2 C12 myoblast cells at passage 6. Cells were seeded at a density of 0.5 × 10⁵ cells/well in 6-well plates in medium (without antibiotics), allowed to attach for 24 h, and then incubated. C2 C12 cells were transfected with Nrf2 siRNA (sc-37049, SANTA CRUZ BIOTECHNOLOGY, USA) using Lipofectamine RNAiMAX (13,778,150, Invitrogen, USA) according to the manufacturer's instructions. Non-targeting siRNA (sc-37007, SANTA CRUZ BIOTECHNOLOGY, USA) was used as a control. Transfection 24 h later, cells were treated with 50 μM citrinin and incubated for an additional 24 h. The transfection was performed for a total duration of 48 h, with a final siRNA concentration of 25 pmol.

C. elegans strains

The following strains were used. N2 wild-type, daf-16(mu86), aak-2(ok524), pmk-1(km25), CL2166; dvIs19[(pAF15)gst-4p::GFP::NLS], QV224; dvIs19;skn-1(zj15) IV, VK737; vkEx737[hsp-4p::GFP + myo-2p::mCherry], skn-1(zj15), ire-1(v33), atf-6(ok551), pek-1(ok275), DM8005; raIs5 [myo-3p::GFP::myo-3 + rol-6(su1006)]. In this study, all strains were maintained at 20℃.

Material screening

The screening process utilized small-molecules from the Screen-Well® Natural Product Library Version 7.4. The small-molecules diluted in dimethyl sulfoxide (DMSO) to a concentration of 50 µM were added on top of each wells in 96-well NGM plates along with E. coli OP50. The synchronized L1 worms (TJ1060 strains) were added in each of wells of assay plates, then worms cultured at 25 °C. At day 7 of adulthood, M9 buffer added in each wells of assay plates, then the muscle activity was assessed by monitoring the bending of the body.

Quantitative-RT PCR

RNeasy Fibrous Tissue Mini Kit (Qiagen, Cat No. 79306) was used to extract total RNA. cDNA was generated by a reverse transcription system (ReverTra Ace™ qPCR RT Master Mix, Toyobo, Cat No. FSQ-201). Quantitative real time PCR was performed with SYBR® Green Realtime PCR Master Mi (Toyobo, Cat No. QPK-201) using A ViiA 7 Real-Time PCR System (ThermoFisher) and analyzed using ΔΔCt methods described in the manufacturer’s manual. Sequences of primers used for quantitative RT-PCR analysis; gst-4-Forward: CGTTTTCTATGGAAGTGACG, and gst-4-Reverse: GAGACTTGTCAAATTGTCAGC, skn-1-Forward: GCAACATCATCACTGATTTTGG, skn-1-Reverse: ATGCTGATGGTTGACTTCATC, act-3-Forward: AAGTCATCACCGTCGGAAAC, hsp-4-Forward: CAACGATCAAGGAAACAGAATCAC, hsp-4-Reverse: GTAGAAACGCCCAATCAGAC, and act-3-Reverse: TTCCTGGGTACATGGTGGTT.. GSTA1 Forward: CCCCTTTCCCTCTGCTGAAG, GSTA1 Reverse: TGCAGCTTCACTGAATCTTGAAAG, GSTA2 Forward: CCCCTTTCCCTCTGCTGAAG, GSTA2 Reverse: TGCAGCCACACTAAAACTTGAAAA, GSTA3 Forward: TGGACAACTTCCCTCTCCTGAA, GSTA3 Reverse: AATCTTCTTTGCTGACTCAACACATT, GSTA5 Forward: AGTTTGATGCCAGCCTTCTGA, GSTA5 Reverse: GCATCCAAGGGAGGCTTTCT, P21 Forward: TCTTGCACTCTGGTGTCTG, P21 Reverse: GGAGTGATAGAAATCTGTCAG, P53 Forward: CACCTACAATGAAATCTCACC, P53 Reverse: GATAAATGCAGACAGGCTTTG, 18 s Forward: TCAACACGGGAAACCTCAC, and 18 s Reverse: GCTCCACCAACTAAGAACG All qRT-PCR experiments were performed in at least two independent experiments.

Life span analysis

Every 1–2 days, the number of live animals that respond to gentle prodding on the head or tail with a platinum wire was scored. Life span assay was performed in solid NGM plate condition at 20 °C. Life span was analyzed by survival analysis within Prism (GraphPad Prism 9). All lifespan measurements were performed without the use of 5′-fluorodeoxyuridine (FUDR).

Heat-killed E. coli OP50 preparation

The bacterial strain used in this study was E. coli OP50, which was cultured in LB broth supplemented with streptomycin at a final concentration of 30 μg/mL. The culture was incubated at 37 °C with shaking at 150 rpm for 16 h. To inactivate the bacteria, the E. coli OP50 culture was subjected to heat killing by placing it in a 70 °C water bath for 1 h. To confirm that the bacteria were successfully inactivated, a sample of the heat-treated culture was inoculated into fresh LB broth and incubated at 37 °C for 24 h. The absence of bacterial growth was considered indicative of successful inactivation by heating. Heat-killed OP50 was centrifuged at 4000 rpm for 30 min to separate the bacterial cells from the supernatant. The supernatant (LB broth) was removed, and the bacterial pellet was resuspended in sterile M9 buffer. The resuspension ratio was set at 18:1, using the initial culture volume as the reference. The prepared suspension of dead E. coli was then applied to 35 mm agar plates by spreading 150 μL of the suspension per plate to create dead E. coli lawns for subsequent use.

Measurement of the number of pharyngeal pumping

The pharyngeal pumping rate tested in solid NGM plate. The number of pharyngeal pump was observed for 10 s. The pharyngeal pump number was observed twice for each worm and the average value was measured. Olympus SZX7 zoom stereo microscope (Olympus Corporation, Japan) was used to measure the number of pharyngeal pump.

Motility class analysis

Worm motility was classified based on the motility grades followed Herndon et al.’s method [23]. Class A is the type that moves constantly and draws an S-curve shape. Type B worms do not move unless they are touched and could not show S-curve movements. The C class worms do not move forward or backward when touched, but move their head and/or tail in response to touch.

Measurement of worm’s maximum velocity (MV)

The movement of worm recorded immediately after transferred to the physical assay plate (NGM plate without peptone and with no bacterial lawn). After recording the worms'movements for 30 s, the movement velocity was expressed as the distance between centroids displaced per second (mm). For all recordings, a stereomicroscope (Olympus SZX7), a CCD camera (Olympus DR74) and imaging software (TUCSEN ISCapture) were used as recording system. Recorded images were analyzed by ImageJ and wrMTrck (plugin for ImageJ: www.phage.dk/plugins). The movement velocity data were imported into an Excel spreadsheet, and the peak locomotion velocity in the 30 s period was used as the MV.

Measurement of worm’s developmental speed

To comparatively analyze the development rate of worms by citrinin, syncronized L1 stage worms were transferred to citrinin non-treated control NGM plates or citrinin-treated NGM plates, respectively. Afterwards, the development stage of the worms was observed in each condition after 48 or 69 h. This experiment was conducted at 20 °C.

Measurement of worm’s progeny number

To comparatively analyze the progeny number of worms by citrinin, syncronized L1 stage worms were transferred to citrinin non-treated control NGM plates or citrinin-treated NGM plates, respectively. Once they become adults, each adult worm was transferred to each single NGM plate. Afterwards, the worms are moved to a new single NGM plate every day, and the number of offspring produced by the worms was counted. This experiment was conducted at 20 °C.

RNAi experiments

In this study, we used a commercial C. elegans RNAi supply feeding library generated by the Ahringer laboratory (Geneservice Ltd., Cambridge, UK). Each RNAi E. coli was confirmed through sequencing analysis, each RNAi treatment was performed for each experimental condition, starting with the progeny.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

J.H.H. conceived and designed the study and wrote the manuscript. Y.C., W.J.L., H.S.K., and J.H.H. performed the experimental works and J.H.H., H.D.S., C.H.J., J.A. and H.S.S., analyzed and discussed the data. J.H.H. edited the manuscript.

Funding

This work was supported by grants from the Korea Food Research Institute (E0210101).

Data availability

Data will be made available on request.

Declarations

Competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.