Fetal Bovine Serum Is Essential for Maintaining Viability of Porcine Blastocysts During Extended In Vitro Culture: A Comparative Study With Defined Supplements

ABSTRACT

Extended in vitro culture (EIVC) of porcine embryos beyond Day 7 is critical for understanding peri‐implantation development but remains technically challenging due to the rapid degeneration of blastocysts. While defined serum‐free supplements, such as B27 and growth factor cocktails (FGF2, LIF, IGF1; FLI), have successfully supported EIVC in bovine and murine models, their efficacy in porcine embryos has not been systematically evaluated against fetal bovine serum (FBS). This study investigated the effects of these supplements on the long‐term viability and molecular integrity of porcine blastocysts. Porcine blastocysts produced in vitro were cultured from Day 7 to Day 11 in Porcine Zygote Medium (PZM) supplemented with either 10% FBS, FLI cocktail, B27 or no supplement (Control). Contrary to findings in other species, supplementation with FLI or B27 failed to support porcine blastocyst survival, resulting in complete degeneration by Day 11, similar to the control group. In contrast, FBS supplementation significantly extended blastocyst viability and maintained structural integrity up to Day 11. Although blastocyst expansion plateaued after Day 9, the FBS group retained a significantly higher total cell number and preserved the expression of pluripotency (OCT4, SOX2) and lineage (CDX2, GATA6) markers compared to other groups. Furthermore, FBS significantly suppressed apoptosis, as evidenced by a lower BAX/BCL2 ratio. These findings demonstrate a distinct species‐specific requirement for porcine EIVC; defined supplements effective in other mammals are insufficient for pigs, suggesting that while FBS is essential for preventing rapid degeneration and maintaining cellular viability, further optimisation is required to fully support extended developmental progression comparable to in vivo peri‐implantation elongation.

1. Introduction

Domestic pigs ( Sus scrofa domesticus ) play a fundamental role in agricultural production and biomedical research. Pigs are widely used as translational models for human diseases, including cardiovascular disorders, diabetes, kidney dysfunction and neurodegenerative diseases, and have emerged as valuable donors for xenotransplantation owing to their physiological and anatomical similarities to humans (Lunney et al. 2021). Stable production of good‐quality embryos using assisted reproductive technologies (ARTs), such as in vitro fertilisation (IVF), is required to maximise the potential of this model species (Garcia‐Canovas et al. 2024).

However, in vitro production (IVP) of porcine embryos remains a major technical challenge beyond the blastocyst stage (Machado et al. 2013; Vejlsted et al. 2006). A phenomenon often described as the ‘Day 7 developmental bottleneck’ is frequently observed, in which the viability and developmental competence of embryos sharply decline shortly after blastocyst formation (Lin et al. 2017). This decline has been attributed to an imbalance in metabolic and cellular interactions, particularly impaired trophectoderm expansion and reduced inner cell mass integrity in suboptimal culture environments and represents a critical obstacle for studies of peri‐implantation development (Chen et al. 2021). Overcoming this bottleneck is a major challenge for production and development of embryos of livestock species. For example, complex defined media systems have been developed to extend the culture of bovine embryos up to Day 10 (Isaac et al. 2024), and co‐culture methods have supported bovine embryos up to Day 20 (Saadeldin et al. 2025). These advances in ruminant models highlight the need for an equivalent and stable extended in vitro culture (EIVC) system for pigs.

Various culture medium supplements have been investigated to overcome this limitation. Recent efforts have successfully optimised media to improve hatching efficiency by Day 8, often using a combination of fetal bovine serum (FBS), amino acids and other supplements (Le et al. 2025). However, most of these studies have focused primarily on maximising blastocyst yield rather than establishing a physiologically stable long‐term culture model (e.g., up to Day 11) capable of recapitulating peri‐implantation development.

Advances in ruminant models have highlighted the potential of defined culture systems. For instance, complex defined media supplemented with B27 or growth factor cocktails (FGF‐2, LIF and IGF‐1; FLI) have successfully supported bovine embryo culture up to Day 10 or beyond (Isaac et al. 2024; Ramos‐Ibeas et al. 2020; Rosenbaum Bartkova et al. 2024). However, it remains unclear whether these defined conditions can support porcine embryos, which possess distinct metabolic characteristics, such as higher intracellular lipid content and greater sensitivity to oxidative stress. To date, no study has systematically compared the efficacy of these defined supplements against FBS in a standardised porcine EIVC system.

Therefore, this study aimed to evaluate whether defined serum‐free supplements (FLI and B27) could replace FBS for the extended culture of porcine blastocysts from Days 7 to 11. We assessed blastocyst viability, morphological integrity, total cell number and the expression of key developmental and apoptotic genes. This comparative analysis seeks to determine whether the complex factors in FBS are essential for maintaining porcine blastocyst viability during the peri‐implantation period or if defined conditions effective in other species can be translated to the porcine model.

2. Materials and Methods

2.1. Ethics Statement

The animal study protocol, including the collection of ovaries from a local abattoir, was reviewed and approved by the Institutional Animal Care and Use Committee of Jeonbuk National University (approval no. NON2024‐068‐001).

2.2. In Vitro Production of Porcine Embryos

Ovaries were obtained from prepubertal gilts at a local abattoir and transported within 2 h to the laboratory in saline solution at 36°C. Cumulus‐oocyte complexes (COCs) were aspirated from antral follicles (3–6 mm in diameter) using an 18‐gauge needle, and only COCs with compact, multilayered cumulus cells and a homogenous cytoplasm were chosen for in vitro maturation (IVM). Approximately 50 COCs were matured in groups for 41–42 h in TCM‐199 culture medium (Thermo Fisher Scientific) supplemented with 10% (v/v) porcine follicular fluid, gonadotropins (10 IU/mL equine chorionic gonadotropin and 10 IU/mL human chorionic gonadotropin) and growth factors as previously described (Almubarak et al. 2021).

For in vitro fertilisation (IVF), the mature oocytes were washed and placed into 40 μL drops of modified Tris‐buffered medium (mTBM) (Abeydeera and Day 1997). Commercially obtained fresh boar semen was washed and resuspended in mTBM at a final concentration of 5 × 10⁶ sperm/mL. Aliquots (5 μL) of sperm suspension were then added to the fertilisation droplets. The gametes were then co‐incubated for 5 h at 39°C in an atmosphere containing 5% CO₂.

At the end of the co‐incubation period, the presumptive zygotes were washed to remove excess spermatozoa and cultured in porcine zygote medium 3 (PZM‐3) at 39°C in a humidified atmosphere containing 5% O₂, 5% CO₂ and 90% N₂ for 7 Days.

2.3. Experimental Design and Extended Embryo Culture

On Day 7 of culture, blastocysts of similar size and morphology (expanded blastocyst stage) were randomly allocated to one of four experimental groups for extended culture. The overall experimental workflow is shown in Figure 1. The basal medium used in all the groups was PZM‐3. Experimental groups were cultured in PZM‐3 supplemented with either 10% (v/v) FBS, FLI cocktail or 2% (v/v) B27 Supplement (50× stock; Thermo Fisher Scientific), resulting in a 1× final concentration, while the control group received no supplementation.

FIGURE 1.

Schematic diagram of the experimental design for the extended in vitro culture of porcine blastocysts. Porcine embryos produced in vitro were cultured to the blastocyst stage in porcine zygote medium (PZM) for 7 Days. On Day 7, blastocysts of similar quality were randomly allocated to one of four experimental groups for extended culture until Day 11. B27, B27 supplement; FBS, fetal bovine serum; FLI, FGF, LIF and IGF cocktail; qPCR, quantitative real‐time polymerase chain reaction. Created in BioRender. Lee, S. (2026) https://BioRender.com/40cs3tw.

Details on the four experimental groups are presented in Table 1. The concentrations of supplements (FBS, FLI and B27) were determined based on previous studies demonstrating their efficacy in supporting mammalian embryo development (Chen et al. 2025; Isaac et al. 2024; Moore et al. 2007).

TABLE 1.

Four experimental treatment groups were established for the extended in vitro culture of porcine blastocysts.

Group	Basal medium	Key supplement(s)	Brief description
1 (Control)	PZM	None	Blastocysts cultured in PZM medium only
2 (FBS)		FBS	PZM medium supplemented with 10% FBS
3 (FLI)		FGF‐2, LIF and IGF	PZM medium supplemented with FGF‐2 (40 ng/mL), LIF (20 ng/mL) and IGF (20 ng/mL)
4 (B27)		B27 supplement	PZM medium supplemented with 1× (2% v/v) B27

Note: Following initial culture in porcine zygote medium (PZM) until Day 7 post‐insemination, blastocysts were randomly allocated to one of the described treatment conditions for subsequent culture and analysis. Full details of the supplement concentrations and commercial sources are provided in the Materials and Methods section.

Abbreviations: FBS, fetal bovine serum; FGF‐2, fibroblast growth factor 2; IGF, insulin‐like growth factor; LIF, leukaemia inhibitory factor; PZM, porcine zygote medium.

2.4. Assessment of Blastocyst Development

The developmental stage and morphology of the blastocysts were assessed on Days 7, 9 and 11 using an inverted microscope (Leica Microsystems, Wetzlar, Germany). The blastocysts were classified as early, expanded, hatched or degenerative. The diameter of each blastocyst was measured using imaging software (Leica Application Suite), and the average of two perpendicular measurements was recorded. All assessments were conducted by an observer who was blinded to the experimental groups.

2.5. Total Cell Count in Blastocysts

To determine the total cell number, blastocysts on Days 7, 9 and 11 were fixed in 4% paraformaldehyde solution for 5 min. To ensure accurate analysis, only morphologically intact blastocysts (excluding collapsed or clearly degenerated ones) were selected for cell counting. After fixation, nuclear staining was performed by incubating the blastocysts with Hoechst 33342 (5 μL) for 5 min at room temperature. Blastocysts were then mounted on glass slides with glycerol and visualised under a fluorescence microscope (Observer A1; Carl Zeiss, Oberkochen, Germany). The number of nuclei in each blastocyst was counted by a trained observer blinded to the treatment.

2.6. RNA Extraction and Quantitative Real‐Time Polymerase Chain Reaction (qRT‐PCR)

Total RNA was extracted from the blastocyst pools of morphologically intact blastocysts (10–15 per group) using TRIzol reagent (Molecular Research Center, OH, USA), according to the manufacturer's instructions. The purity and concentration of the total RNA were analysed using an Epoch microplate spectrophotometer (BioTek Instruments, VT, USA). The first‐strand cDNA was synthesised from the total amount of RNA extracted from each pool of blastocysts using SuperScript IV VILO Master Mix (Thermo Fisher Scientific). Quantitative real‐time PCR (qRT‐PCR) was performed using a QuantStudio 1 Real‐Time PCR System (Applied Biosystems, Waltham, MA). Each reaction was 20 μL with template cDNA, forward and reverse primers (10 pmol/μL each) and 2× qPCR Master Mix (GeneAll Biotechnology, Seoul, Korea). Thermal cycling conditions were as follows: 95°C for 15 min and 40 cycles of 95°C for 20 s, 60°C for 60 s and 72°C for 30 s. Relative expression levels of target genes (OCT4, SOX2, CDX2, GATA6, BAX and BCL2) were analysed using the comparative ΔΔCt method with 18S ribosomal RNA (RN18S) as an internal reference gene. The specific primer sequences used in this study are listed in Table 2.

TABLE 2.

List of primers used for real‐time qPCR.

Gene	Primer sequences (5′→3′)	Product size (bp)	Accession number
RN18S	F: CGCGGTTCTATTTTGTTGGT R: AGTCGGCATCGTTTATGGTC	219	NR_046261.1
OCT4	F: GCGGACAAGTATCGAGAACC R: CCTCAAAATCCTCTCGTTGC	200	NM_001113060.1
NANOG	F: TAAAACCACTGCCCACATCT R: CTGCCTCTGAAATCTGTCGT	131	NM_001129971.1
SOX2	F: AACCAGAAGAACAGCCCAGAC R: TCCGACAAAAGTTTCCACTCG	176	NM_001123197
CDX2	F: CTGTTTGGGTTGTTGGTCTG R: CCCACTCCCTTCACCATATC	95	NM_001278769.1
GATA6	F: GAGGGAATTCAGACCAGGAA R: AGCTGGCGTTTGTGTTGTAG	159	NM_214328.2
BAX	F: TGCCTCAGGATGCATCTACC R: AAGTAGAAAAGCGCGACCAC	199	XM_013998624.2
BCL2L1	F: AATGACCACCTAGAGCCTTG R: GGTCATTTCCGACTGAAGAG	182	NM_214285.1

Abbreviations: F, forward; R, reverse.

2.7. Statistical Analysis

Data are presented as mean ± standard error of the mean (SEM). Data were analysed using GraphPad Prism version 10 (GraphPad Software, USA). Comparisons between groups were conducted using one‐ or two‐way analysis of variance (ANOVA) followed by Tukey's multiple comparison test. p < 0.05 was considered to be statistically significant.

3. Results

3.1. FBS Supplementation Maintains Blastocyst Viability and Structural Integrity During Extended Culture

Before allocation to the extended culture groups on Day 7, the in vitro production system maintained consistent developmental competence. The mean cleavage rate on Day 2 was 71.56% ± 0.518%, and the blastocyst formation rate on Day 7 was 22.06% ± 0.413% (n = 1085) (Figure S1). Only blastocysts with high‐quality morphology (early to expanded stages) were selected for the subsequent extended culture experiments. On Day 7, prior to treatment exposure, most embryos across all groups were at the early blastocyst stage (ranging from 40.6% to 72.9%), with the remainder having reached the expanded stage. However, distinct morphological differences emerged during extended culture. In the Control, FLI and B27 groups, blastocysts failed to progress further; no hatched blastocysts were observed on Day 9 or 11, and the proportion of expanded blastocysts dropped significantly as degeneration rapidly ensued (Table 3). In contrast, the FBS group sustained developmental progression for a longer duration. On Day 9, 26.37% of the embryos in the FBS group remained at the expanded stage and 13.26% had successfully progressed to the hatched blastocyst stage, whereas hatching was rarely observed in the other groups. By Day 11, although degeneration increased in all groups, the FBS group was the only one to retain viable expanded blastocysts (10.67%), highlighting its capacity to maintain structural integrity beyond the standard culture period.

TABLE 3.

Developmental stage distribution (%) of blastocysts on Days 7, 9 and 11 across the four experimental groups.

Group	Total embryos assessed (n)	Day no.	Early blastocyst (%)	Expanded blastocyst (%)	Hatched blastocyst (%)	Degenerated (%)
Control (PZM only)	57	7	72.93	27.07	0	0
		9	14.61	1.56	1.79	82.04
		11	0	3.87	0	96.13
PZM+FBS	52	7	64.87	35.13	2.27	0
		9	0	26.37	13.26	60.37
		11	0	10.67	0	89.33
PZM+FLI	52	7	40.64	59.36	0	0
		9	0	8.48	0	91.52
		11	0	0	0	100
PZM+B27	53	7	53.95	44.2	1.85	0
		9	0	11.06	0	88.94
		11	0	0	0	100

Note: All experiments were repeated at least three times.

Abbreviations: B27, B27 supplement; FBS, fetal bovine serum; FLI, FGF‐2, LIF and IGF cocktail; N, total embryos assessed; PZM, porcine zygote medium.

In contrast, the PZM+FBS group significantly extended blastocyst viability. Although distinct blastocyst expansion was observed primarily up to Day 9 (Figure 2B), the FBS group successfully maintained morphological integrity through Day 11, unlike the other groups which underwent rapid structural collapse. Consequently, survival rates in the FBS group were markedly higher across the culture period (Figure 2A). Representative images illustrate that while blastocysts in defined media degenerated, those in the FBS group remained expanded and intact (Figure 2C).

FIGURE 2.

Effects of FBS, FLI and B27 supplementation on the developmental competence and viability of porcine blastocysts during extended culture (A) Survival rates of blastocysts from day 7 to Day 11 in each treatment group. (B) Average blastocyst diameter (μm) measured daily from day 7 to Day 11. (C) Representative bright‐field images of blastocysts on days 7, 9 and 11. Note the superior morphology and expansion in the PZM+FBS group. All experiments were repeated at least three times. All quantitative data are presented as the mean ± SEM. Scale bar = 100 μm.

3.2. FBS Supplementation Increases Total Cell Number in Extended‐Cultured Blastocysts

To determine whether the enhanced development in the FBS group was correlated with cellular proliferation, we compared the total cell number per blastocyst between the PZM+FBS and Control groups. Although the average total cell number on day 7 was similar between the two groups, the cell number in the FBS group increased significantly on day 9, and even more significantly on Day 11 (p < 0.01) and even more significantly on Day 11 (p < 0.01). On Day 11, the total cell number in the Control group was significantly lower than that in the FBS group (p < 0.01) (Figure 3A). This quantitative analysis was supported by Hoechst staining, which revealed more nuclei in the blastocysts from the FBS group than in those from the Control group, particularly on Days 9 and 11 (Figure 3A).

FIGURE 3.

Assessment of blastocyst quality: Total cell number and gene expression. (A) Comparison of the average total cell number per blastocyst in the Control and PZM+FBS groups on Days 7, 9 and 11. Left panel shows Hoechst‐stained nuclei; right panel shows the quantitative graph. (B) Relative mRNA expression of genes related to pluripotency (OCT4, SOX2), trophectoderm specification (CDX2), hypoblast specification (GATA6) and apoptosis (BAX, BCL2) in blastocysts on Day 11. Gene expression levels were determined by qRT‐PCR, normalised to the RN18S housekeeping gene and are shown as a fold change relative to that of the Day 7 Control group (set to 1). All experiments were repeated at least three times. Data are presented as mean ± SEM. Statistical significance was determined by two‐way ANOVA followed by Tukey's multiple comparisons test. Asterisks denote statistically significant differences between groups (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). Scale bar = 20 μm.

3.3. FBS Supplementation Modulates Gene Expression Related to Apoptosis and Pluripotency

qRT‐PCR analysis was performed on blastocysts from days 7 and 11, along with day 9 blastocysts, to study the molecular mechanisms that contributed to improved viability (Figure 3B).

Assessment of apoptotic markers showed that although the pro‐apoptotic marker BAX was upregulated in the Control group on days 9 and 11, its expression was low in the FBS group. In contrast, the anti‐apoptotic marker BCL2 was maintained at a high level in the FBS group, specifically on day 9 (Figure 3B). This was associated with a significantly more positive (lower) BAX/BCL2 ratio on days 9 (p < 0.05) and 11 (p < 0.01) in the FBS group than in the Control group.

The FBS group had significantly higher expression levels of the core pluripotency genes OCT4 (p < 0.001) and SOX2 (p < 0.05), along with the trophectoderm lineage marker CDX2 (p < 0.05) and the hypoblast lineage marker GATA6 (p < 0.01) on Day 9, compared to the rapidly degrading Control group. The expression of OCT4 and CDX2 on Day 11 decreased in both groups; however, the FBS group was still able to maintain significantly higher levels of SOX2 (p < 0.01) and GATA6 (p < 0.05).

4. Discussion

The low production of viable porcine embryos beyond the blastocyst stage using in vitro culture remains a major limiting factor in ARTs (Machado et al. 2013; Vejlsted et al. 2006). In this study, we demonstrated that the addition of 10% FBS to the culture medium was essential for maintaining the viability and structural integrity of porcine blastocysts during long‐term culture up to Day 11 post‐insemination. While previous studies focused on hatching efficiency up to Day 8 (Le et al. 2025), our results highlight a critical distinction: FBS supplementation significantly extended the survival window of blastocysts that otherwise degenerated rapidly in defined serum‐free conditions. This suggests that FBS provides indispensable factors for delaying degeneration during the peri‐implantation period.

It is important to note that while the blastocyst diameter in the FBS group increased up to Day 9, it plateaued thereafter. This observation suggests that the current FBS‐based system is primarily effective at preserving blastocyst viability and structural integrity rather than supporting the active proliferation required for continuous elongation. However, considering the complete degeneration observed in the control and defined media groups by Day 11, the ability of FBS to preserve morphological structure is a significant finding. This indicates that while FBS alone may be insufficient for full peri‐implantation development, it is currently the only effective option for maintaining the embryo's developmental competence window in vitro by suppressing the rapid onset of apoptosis (Biswas and Hyun 2021; Miles et al. 2017).

The strong performance of the FBS‐supplemented group is likely attributable to the complex biochemical composition of the serum. FBS contains a wide array of undefined components, including essential amino acids, vitamins, lipids and a cocktail of growth factors and hormones that support cellular growth and metabolism (Dobrinsky et al. 1996). This multifactorial support appears to be critical for maintaining the osmotic and metabolic balance required for blastocoel expansion and sustained cellular proliferation during EIVC. The increased total cell number observed in the FBS group suggests that these components collectively promote both cellular proliferation and the maintenance of the hydrostatic pressure required for blastocoel integrity (Huang et al. 2016; Manejwala et al. 1989). Our results align with those of previous studies that have reported the beneficial effects of serum on embryo development in various species, reinforcing its role as an effective, albeit unrefined, culture supplement (Culshaw et al. 2019; Thompson et al. 1998).

In contrast, the defined supplements tested in this study (FLI and B27) were insufficient in maintaining long‐term survival of porcine blastocysts. The FLI cocktail, while known to impact porcine genome activity (Rosenbaum Bartkova et al. 2024), may consist of factors that are insufficient on their own to meet the complex metabolic and survival demands of extended culture. The failure of B27 supplementation is particularly noteworthy. In bovine EIVC models, B27‐containing media have been used to successfully culture embryos until day 10 (Isaac et al. 2024; Ramos‐Ibeas et al. 2020). However, B27 was originally formulated to support the survival of neuronal cells (Brewer et al. 1993) and lacks the lipid and antioxidant components necessary for porcine embryos, which are known to exhibit high oxidative metabolism and sensitivity to oxidative stress compared to other mammals (Kang et al. 2021). Therefore, the complete degeneration of B27‐ and FLI‐treated blastocysts by Day 11 reflects a distinct species‐specific metabolic requirement of porcine embryos that cannot be met by these defined media formulations, further justifying the necessity of FBS in current culture systems.

The molecular data obtained in our study provide a mechanistic basis for this success. Although the anti‐apoptotic effect of FBS‐containing media has been confirmed by day 8 of development (Le et al. 2025), our analysis on day 11 revealed a more significant outcome regarding long‐term maintenance. In addition to the suppression of apoptosis (as indicated by a more favourable BAX/BCL2 ratio), which is a critical factor impacting cell survival in mammalian embryos (Putri 2025), FBS supplementation also supported the stable expression of several key lineage‐specific markers. The maintenance of pluripotency markers OCT4 and SOX2 (Lee et al. 2022), along with the segregation markers CDX2 and GATA6 (Cha et al. 2009), confirms that FBS allows the rescued embryos to maintain their cellular identity and lineage distinctions, which are otherwise lost in degenerating embryos.

Despite its beneficial attributes, the use of FBS presents inherent limitations owing to its undefined composition and batch‐to‐batch variability, which may compromise experimental reproducibility (Dobrinsky et al. 1996). Therefore, the results of this study should be considered a foundational step toward defining the critical bioactive components within FBS that mediate these effects. Future studies should employ proteomic and metabolomic profiling of effective FBS batches to identify the molecular factors responsible for enhanced blastocyst maintenance (Zheng et al. 2006). This characterisation will facilitate the development of a fully defined and standardised culture medium for extended porcine embryo culture, enabling more reproducible studies on peri‐implantation development.

5. Conclusion

In conclusion, supplementation with 10% FBS is an effective and practical strategy for overcoming the ‘Day 7 developmental bottleneck’ in porcine in vitro embryo culture. Compared to the defined supplements effective in other species, FBS uniquely supported the long‐term maintenance of blastocysts up to Day 11. While further optimisation is needed to support full elongation, FBS significantly improved viability, total cell numbers and molecular integrity. These findings provide a starting point for the production of high‐quality, long‐term cultured porcine embryos and their subsequent applications in reproductive biology.

Author Contributions

Seongju Lee: conceptualisation, methodology, investigation, formal analysis, writing – original draft. Il‐Jeoung Yu: resources, validation, writing – review and editing. Yubyeol Jeon: conceptualisation, supervision, project administration, funding acquisition, writing – review and editing.

Funding

This work was supported by Chungnam National University.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

FIGURE S1: Developmental competence of porcine embryos prior to extended culture. Cleavage rates (Day 2) and blastocyst formation rates (Day 7) were assessed to verify the efficiency of the in vitro production system. A total of 1085 oocytes were fertilised and cultured in PZM‐3, then randomly allocated to four experimental groups: Control, FBS, FLI and B27. (A) The cleavage rate was calculated based on the total number of oocytes. (B) The blastocyst formation rate represents the percentage of oocytes that developed to the blastocyst stage by Day 7. Data are presented as mean ± SEM of three independent replicates. No significant differences were observed among the groups (p > 0.05), confirming unbiased allocation of embryos before treatment initiation.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.