Hesperidin Attenuates H₂O₂‐Induced Neurotoxicity via Modulation of Inflammatory Pathways and MMP Activity in Differentiated SH‐SY5Y Cells: In Vitro and In Silico Models

ABSTRACT

Chronic inflammation, often aggravated by oxidative stress, is a key contributor to the pathogenesis of neurodegenerative diseases. Molecular mediators such as NF‐κB, COX‐2, pro‐inflammatory cytokines, and matrix metalloproteinases (MMP‐2/MMP‐9) disrupt blood‐brain barrier (BBB) integrity and promote neuronal damage. Hesperidin, a natural citrus flavonoid with low cytotoxicity and high antioxidant capacity, has shown promise as a neuroprotective agent. This study aimed to evaluate its anti‐inflammatory and neuroprotective effects in differentiated SH‐SY5Y neuroblastoma cells exposed to hydrogen peroxide (H₂O₂), a well‐established inducer of oxidative neurotoxicity. The protective effects of Hesperidin (75 and 100 µM for 48 h), administered as both pre‐ and post‐treatment, were evaluated through cell viability assays, assessment of oxidative stress parameters, and expression analysis of inflammatory mediators (TNF‐α, IL‐1β, IL‐6, NF‐κB, COX‐2), and MMP‐2/MMP‐9, using ELISA and RT‐qPCR. In silico molecular docking analyses were also conducted using CB‐Dock2 Tools to support the experimental findings. In our results, Hesperidin significantly increased cell viability (p < 0.001) and reduced morphological damage. It also downregulated TNF‐α, IL‐1β, and IL‐6 at both mRNA and protein levels (p < 0.05–0.005), while markedly suppressing NF‐κB, COX‐2, MMP‐2, and MMP‐9 expression (p < 0.01–0.005) and decreasing oxidative stress (p < 0.005). Molecular docking revealed strong binding affinities of Hesperidin to key inflammatory targets, particularly COX‐2 (–12.2 kcal/mol) and TNF‐α (–11.6 kcal/mol). These findings indicate that Hesperidin exerts potent neuroprotective effects against H₂O₂‐induced oxidative stress and neuroinflammation by modulating pro‐inflammatory signaling pathways, matrix metalloproteinase activity, and redox homeostasis. These results highlight Hesperidin's potential as a therapeutic candidate for neurodegenerative disorders.

Hesperidin protects differentiated SH‐SY5Y cells from H₂O₂‐induced neurotoxicity by reducing oxidative stress and suppressing pro‐inflammatory cytokines. It further inhibits NF‐κB/COX‐2 signaling and downregulates MMP‐2/MMP‐9 activity. In vitro findings are supported by in silico analyses showing strong binding to inflammatory targets.

1. Introduction

Neurodegenerative diseases (NDDs) are among the leading causes of mortality globally and pose a significant public health challenge, particularly due to their profound impact on aging populations [1, 2]. Despite extensive research, the etiopathogenesis and effective treatment strategies for these diseases remain only partially understood [1, 3]. Oxidative stress and neuroinflammation are recognized to play a critical role in the onset and progression of NDDs such as Alzheimer's disease (AD) and Parkinson's disease (PD). However, it remains unclear whether neuroinflammation is a primary causal factor or a secondary consequence of neurodegenerative pathology [4, 5]. Therefore, understanding the molecular basis of neuroinflammation and identifying potential therapeutic targets remains essential to developing effective treatment strategies.

While acute, low‐grade inflammation constitutes a protective and adaptive response in the brain, persistent and dysregulated chronic inflammatory processes, driven by excessive secretion of pro‐inflammatory mediators, can lead to progressive neuronal damage [6, 7]. The overexpression of pro‐inflammatory molecules such as Tumor Necrosis Factor‐alpha (TNF‐α), Interleukin‐6 (IL‐6), IL‐1β, and IL‐8 can cause neuroinflammation, thereby initiating or promoting the progression of the disease [7]. Particularly, TNF‐α, which is the first cytokine to stimulate the inflammation cascade, holds strategic importance due to its neurotoxic effects, induction of mitochondrial dysfunction, and cytotoxic activity [1, 8]. Furthermore, elucidating the molecular mechanisms that regulate these inflammatory cytokines is as crucial as the increase in inflammatory cytokines themselves. Nuclear factor‐kappa B (NF‐κB) is a pivotal transcription factor involved in the regulation of numerous genes associated with the inflammatory response, including cytokines and cyclooxygenase‐2 (COX‐2) [9, 10]. NF‐κB is activated by reactive oxygen species (ROS), increasing the transcription of COX‐2 and thus accelerating the neuroinflammation process [10, 11]. Numerous studies have reported that in diseases such as AD, PD, and ischemic/reperfusion injury, neurodegeneration occurs through NF‐κB‐mediated transcription of COX‐2 and the increase of pro‐inflammatory cytokines such as TNF‐α, IL‐6, and IL‐1β [12, 13, 14].

Beyond promoting neuronal damage, NF‐κB–mediated pro‐inflammatory responses and oxidative stress contribute to blood–brain barrier (BBB) disruption and broader pathological processes in neurodegenerative diseases [7, 15]. In addition to cytokines, matrix metalloproteinases (MMPs), particularly MMP‐2 and MMP‐9, play a key role in compromising BBB permeability, facilitating the infiltration of neurotoxic substances [15, 16]. Various studies on NDDs have associated the increase of MMPs with inflammation, and these molecules have become increasingly considered viable therapeutic targets [13, 17, 18, 19].

Hesperidin, a naturally occurring flavonoid abundant in citrus fruits such as oranges and lemons, has attracted attention for its ability to cross the BBB and its low cytotoxicity in healthy cells [20, 21, 22]. A growing body of evidence has demonstrated its anti‐inflammatory, antioxidant, anti‐carcinogenic, and neuroprotective properties [23, 24, 25]. For instance, in models of AD, PD, and cerebral ischemia, Hesperidin has been shown to prevent neurodegeneration and improve cognitive and neurological outcomes [23, 26, 27, 28]. Despite these promising findings, a comprehensive evaluation of Hesperidin's molecular mechanisms of action—particularly its antioxidant and anti‐inflammatory effects—remains limited in in vitro neurodegeneration models. Moreover, direct comparisons between pre‐ and post‐treatment strategies and mechanistic investigations in SH‐SY5Y neuronal cells are still lacking.

NF‐κB signaling, COX‐2 activation, and oxidative stress are central components of neuroinflammation and represent promising therapeutic targets in neurodegenerative conditions. Modulation of these pathways may offer a strategy to alleviate neuronal damage [29]. In in vitro studies related to neurodegenerative diseases, SH‐SY5Y cells are among the most frequently used cell lines due to their neuronal origin and capacity for differentiation. Moreover, hydrogen peroxide (H₂O₂) is widely employed to induce oxidative stress–mediated neurotoxicity, as it readily permeates cell membranes and mimics neuronal damage associated with oxidative stress [30]. Accordingly, this study aimed to evaluate the neuroprotective potential of Hesperidin against H₂O₂‐induced oxidative stress by comparing pre‐ and post‐treatment strategies, supported by complementary in silico analyses.

2. Materials and Methods

2.1. Chemicals

Type 1 collagen (rat tail) was purchased from Gibco (USA). All trans‐retinoic acid (RA) was purchased from Bldpharm (China), and the stock solution was prepared to 10 mM in dimethyl sulfoxide (DMSO, Sigma‐Aldrich, USA). Hesperidin (C₂₈H₃₄O₁₅; molecular weight: 610.6 g/mol; ≥ 80% purity by HPLC; PubChem ID: 10621), H₂O₂, and pyridine were purchased from Sigma‐Aldrich (USA). The Hesperidin stock solution was prepared at a concentration of 50 mg/mL in pyridine and stored at +4°C for short‐term storage.

2.2. In vitro Cell Culture

The SH‐SY5Y human neuroblastoma cell line (Sigma‐Aldrich, USA) was cultured in DMEM/Ham's F‐12 medium (Capricorn, Germany) supplemented with 10% heat‐inactivated fetal bovine serum (FBS, Capricorn, Germany) and 1% penicillin‐streptomycin (Capricorn, Germany) at 37°C in a humidified atmosphere containing 5% CO₂. Cultures were monitored daily using an inverted light microscope (Axiovert, Zeiss, Germany). When the culture reached approximately 80% confluence, cells were detached via trypsinization and either passaged at a 1:4 ratio or subjected to a differentiation protocol as required for experimental groups [31].

2.3. Differentiation of SH‐SY5Y Cells

The surfaces of 6‐well plates were pre‐coated with 50 µg/mL type I collagen, and SH‐SY5Y cells were seeded at a density of 2 × 10⁴ cells/cm². Cells were cultured in DMEM/Ham's F‐12 medium (Capricorn, Germany) supplemented with 10% FBS (Capricorn, Germany) and 1% penicillin‐streptomycin (Capricorn, Germany). After 24 h, neuronal differentiation was induced by culturing the cells for 5 days in differentiation medium consisting of DMEM/Ham's F‐12 supplemented with 1% heat‐inactivated FBS and 10 µM all‐trans retinoic acid (RA, Sigma‐Aldrich, USA). The differentiation medium was replaced every other day. All culture conditions were maintained at 37°C in an humidified incubator with 5% CO₂ and 95% humidity. Morphological changes in the cells were monitored using an inverted light microscope (Axiovert, Zeiss, Germany) [32, 33].

2.4. Cell Viability Assessment

MTT (3‐(4,5‐dimethylthiazol‐2‐yl)−2,5‐diphenyl‐2H‐tetrazolium bromide) assay was conducted to determine the cytotoxic effect of H₂O₂ on differentiated SH‐SY5Y (d‐SH‐SY5Y) cell viability and the protective effect of Hesperidin in the H₂O₂‐induced neurotoxicity model. MTT is a colorimetric assay that measures metabolic activity by passing through the mitochondrial inner membrane of viable cells.

Cells were seeded at a density of 5 × 10³ cells/well in 96‐well plates and differentiated. Initially, cells were treated with logarithmically increasing doses of H₂O₂ (Sigma‐Aldrich, USA) ranging from 62.5 to 1000 µM, and the dose to be used for toxicity was determined. In the subsequent phase, Hesperidin at logarithmically increasing doses ranging from 6.25 to 200 µM was applied as both pre‐treatment and post‐treatment for 24 and 48 h against 250 µM H₂O₂ (24 h). At the end of the experimental periods, the medium in the plates was removed, and 100 µL of MTT solution (Sigma‐Aldrich, USA) was added to each well to achieve a final concentration of 0.5 mg/mL. After incubation at 37°C for 3 h, 100 µL of DMSO (Sigma‐Aldrich, USA) was added to each well, and the plates were incubated at room temperature for 20 min. The absorbance at 570 nm of each well was read using a microplate reader (Synergy H1, Biotek, USA). Cell viability was calculated as a percentage relative to the control and H₂O₂ groups.

2.5. Evaluation of Morphological Structures of Cells and Neurite Lengths

Morphological changes between the control, H₂O₂, and pre‐treatment and post‐treatment Hesperidin groups were examined under a light microscope. For this purpose, SH‐SY5Y cells were seeded at a density of 2 × 10⁴ cells/cm² in 6‐well plates, and the differentiation protocol described was applied after 24 h of incubation. Following differentiation, morphological differences between groups in randomly selected six areas were visualized using an inverted microscope (Zeiss Axio inverted microscope, Germany) with a 20X objective lens. Neurite lengths and numbers were measured using the NeuronJ plugin of ImageJ software. For quantitative analysis, data were normalized to the total cell density of the undifferentiated control group and expressed as percentages. All analyses were performed in three independent biological replicates [34, 35, 36].

2.6. Gene Expression Assay by RT‐qPCR

RNA was isolated from the experimental groups (control‐untreated differentiated SH‐SY5Y, H₂O₂, and hesperidin treatment groups) using the EZ‐10 Total RNA Isolation Kit (Bio Basic, Canada). Total RNA isolation was performed according to the manufacturer's instructions, and the purity (260/280 nm 1.8–2.1) and concentration of the RNA were measured using the Multimode Microplate Reader (Synergy H1, Biotek, USA). Following this, RNA (100 ng) was reverse transcribed using the complementary DNA (cDNA) synthesis kit (A.B.T.™, Turkey).

mRNA expression levels of IL‐1β, IL‐6, TNF‐α, COX‐2, NF‐κB, MMP‐2, and MMP‐9 genes (sequences, Table 1.) were analyzed by Real Time‐Quantitative PCR (RT‐qPCR) method. Actin beta was used as the endogenous reference gene for normalization. RT‐qPCR was performed using the A.B.T.™ 2X qPCR SYBR‐Green MasterMix (A.B.T., Turkey) according to the manufacturer's instructions, on the Roche Light Cycler 96 System (Basel, Switzerland). PCR was conducted pre‐incubation at 95°C for 5 min, followed by 45 cycles at 95°C for 15 s., 60°C for 30 s., and 72°C for 30 s. The results were analyzed using the Ct (Cycle threshold) method and the 2^−ΔΔCt formula [37].

Table 1.

Sequences of forward and reverse primers used in the analysis of the gene expression.

Gene symbol	Primer forward sequences (F)	Primer revers sequences (R)
TNF‐α	TGCTTGTTCCTCAGCCTCTT	GGTTTGCTACAACATGGGCTA
IL‐1β	ACGATGCACCTGTACGATCA	TCTTTCAACACGCAGGACAG
IL‐6	AGGAGACTTGCCTGGTGAAA	GCATTTTGGTTGGGTCA
NF‐kB	CACCCTGACCTTGCCTATTT	CTCCACCATTTTCTTCCTCTTC
COX‐2	TCCTCCTGTGCCTGATGATT	AACTGATGCGTGAAGTGCTG
MMP‐2	CTACTGAGTGGCCGTGTTTG	TCCCTGAGGTTCTCTTGCTG
MMP‐9	ACGCACGACGTCTTCCAGTA	GTTCAACTCACTCCGGGAACT
Actin‐beta	CATGTACGTTGCTATCCAGGC	CTCCTTAATGTCACGCACGAT

2.7. Enzyme‐Linked Immunosorbent Assay (ELISA)

The levels of IL‐1β, IL‐6, and TNF‐α in cell lysates from the experimental groups were measured using ELISA kits (BT Lab, China). At the end of the experimental period, the culture medium from the culture dishes was collected into 15 mL Falcon tubes and centrifuged at 2500 rpm for 20 min. Following centrifugation, the supernatant was used as the cell lysate. The ELISA assay was performed according to the manufacturer's instructions, and absorbance values were measured at 450 nm using a microplate reader (Synergy H1, Biotek, USA).

2.8. Total Oxidant Capacity (TOC), Total Antioxidant Capacity (TAC) and Oxidative Stress Index (OSI)

The cell pellet was collected by trypsinization, resuspended in distilled water, and homogenized. The suspension was kept on ice for 10 min and then centrifuged. The resulting supernatants were transferred to a new 96‐well plate. Total oxidant status (TOS) and total antioxidant capacity (TAC) were measured spectrophotometrically at 530 nm and 660 nm, respectively, according to the manufacturers' instructions using commercial assay kits (TOS: E‐BC‐K802‐M, Elabscience, Texas, USA; TAC: K025, Finetest, Wuhan, China). TOS and TAC results were expressed as μmol H₂O₂ equivalent/L and mmol Trolox equivalent/L, respectively. The oxidative stress index (OSI) was calculated using the following formula: OSI (arbitary unit) = ((TOS (μmol H₂O₂ Eq/L))/(TAC (μmol Trolox Eq/L))) × 100 [38].

2.9. Molecular Docking

Protein structures, including TNF‐α, IL‐6, IL‐1β, NF‐κB, COX‐2, MMP‐2, and MMP‐9, were sourced from the Protein Data Bank (PDB) (http://www.pdb.org). Hesperidin's molecular structure was retrieved from the MolInstincts database (https://www.molinstincts.com). Prior to docking, the proteins were prepared using CB‐Dock2 Tools, ensuring compatibility with the software. The docking experiments were performed within predetermined grid coordinates for each target protein. For every ligand‐protein interaction, independent docking calculations were conducted. Docking outcomes were ranked based on the binding energies, with lower energy values indicating higher affinities.

2.10. Statistical Analysis

GraphPad Prism 9.0 software was used for statistical analyses and generating graphs. The normality of the distribution of the groups was determined using the Shapiro‐Wilk Test. Accordingly, for comparisons between multiple groups, one‐way analysis of variance (ANOVA) followed by post hoc Tukey's HSD test was applied for data exhibiting a parametric distribution, or Kruskal‐Wallis and Dunnett's multiple comparison tests were used for data showing a non‐parametric distribution. Statistical differences between two groups were determined using the independent samples t‐test for data with a parametric distribution or the Mann‐Whitney U test for data with a non‐parametric distribution. Values of p < 0.05 and p < 0.001 were considered statistically significant.

3. Results

3.1. Cytotoxic Effect of H₂O₂ on d‐SH‐SY5Y Cells

To determine the dose of H₂O₂ used in the neurodegeneration model, d‐SH‐SY5Y cells were treated with H₂O₂ at doses of 62.5, 125, 250, 500, and 1000 µM for 24 h and cell viability was analysed by MTT assay (Figure 1a). A significant decrease in cell viability was observed at H₂O₂ concentrations of 250 µM and above, and the 24‐h IC₅₀ dose was determined to be 277.8 µM. For subsequent experiments, it was decided to use 250 µM H₂O₂ in the neurotoxicity assays.

Figure 1.

Determination of the cytotoxic effect of H₂O₂, and the neuroprotective effect of Hesperidin treatment against H₂O₂ on d‐SHSY5Y by MTT test. (a) The cytotoxic effect of H₂O₂ on d‐SH SY5Y cell viability. (b) Protocol of experiments pre‐ and post‐treatment of Hesperidin on d‐SHSY5Y cells. (c, d) Hesperidin's concentration‐ and time‐dependent protective effect pre‐ and post‐treatment against H₂O₂ toxicity in d‐SHSY5Y cell viability. Results presented as mean ± Standard Deviation (SD). Significant difference compared to H₂O₂ toxicity group, *p < 0.05, **p < 0.01 and ****p < 0.0001. Significant difference compared to control group, ^### p < 0.005 and ^#### p < 0.0001.

3.2. Hesperidin Protects Cell Viability in H₂O₂‐Induced Neurotoxicity

To investigate the potential neuroprotective effects of Hesperidin on H₂O₂‐induced neurotoxicity in d‐SH‐SY5Y cells, cells were treated with different concentrations of Hesperidin (6.25, 12.5, 25, 50, 75, 100 µM) pre‐treatment and post‐treatment for 24 and 48 h and cell viability was determined by MTT assay. The pre‐treatment protocol: d‐Sh‐SY‐5Y cells were treated with Hesperidin for 24 or 48 h, after incubation, they were treated with H₂O₂ (250 µM) for 24 h. The post‐treatment protocol: Cells were treated with H₂O₂ (250 µM) for 24 h, then treated with Hesperidin for 24 or 48 h (200 µM) (Figure 1b).

Accordingly, H₂O₂ alone significantly reduced cell viability in both pre‐treatment and post‐treatment MTT assay results compared to the control (untreated) group (p < 0.005 and p < 0.0001, respectively). However, Hesperidin administration significantly improved cell viability in both paradigms relative to the H₂O₂ group (Figure 1c–d). Notably, in the 48‐h applications, 75 and 100 µM doses of Hesperidin increased viability to the highest levels (respectively, pre‐treatment: 97% and 98.33%; post‐treatment: 94.3% and 97.4%, respectively) (p < 0.0001). Interestingly, a decline in cell viability was observed at the 200 µM concentration, particularly in the pre‐treatment condition, where viability dropped to levels lower than those observed in the H₂O₂‐only group (p < 0.0001). Based on these findings, 75 µM and 100 µM hesperidin (48‐h exposure) were selected as the optimal concentrations for subsequent experiments.

3.3. Hesperidin Improves d‐SH‐SY5Y Cell Morphology

The effects of H₂O₂ and Hesperidin (75 µM and 100 µM) on the morphology of d‐SH‐SY5Y cells were evaluated using an inverted light microscope. Neurite lengths were quantified using NeuronJ (ImageJ) (Figure 2a). Cells exposed to H₂O₂ alone exhibited marked degeneration and neurite retraction. Compared to the untreated control group (d‐Sh‐SY5Y), these cells showed a statistically significant reduction in neurite length and average number of neurites per cell (p < 0.005). In both pre‐treated and post‐treated groups, Hesperidin administration for 48 h significantly increased these two parameters relative to the H₂O₂ group (p < 0.005 and p < 0.005, respectively); however, this recovery remained lower than that observed in the untreated control group (p < 0.05) (Figure 2b,c).

Figure 2.

Morphological alterations following Hesperidin pre‐ and post‐treatment in d‐SH‐SY5Y cells exposed to H₂O₂. (a) Inverted light microscope images of untreated d‐SH‐SY5Y cells, the cells treated with H₂O₂. for 24 h, and the cells pre‐ and post‐treated with Hesperidin (75 µM and 100 µM) for 48 h (20 × magnification; Scale bar: 100 µm). (b) Quantification of the average number of neurites per cell using NeuronJ (ImageJ plugin). (c) Neurite lengths were measured using NeuronJ (ImageJ) and presented as percentages normalized to the untreated control group. Results are presented as mean ± SD. Statistical significance was evaluated versus the H₂O₂ group (**p < 0.01, and ***p < 0.005) and the untreated control group (^#### p < 0.0001).

3.4. Hesperidin Reduces Pro‐Inflammatory Cytokine Expression in H₂O₂‐Induced Neurotoxicity

As shown in Figure 3, the effects of Hesperidin pre‐treatment and post‐treatment on inflammation in the in vitro neurotoxicity model were evaluated by determinating the mRNA expression levels of pro‐inflammatory cytokines (TNF‐α, IL‐1β and IL‐6) in cell lysates using RT‐qPCR and their corresponding protein levels using ELISA.

Figure 3.

The effects of pre‐ and post‐treatment with Hesperidin (75 µM and 100 µM) in 48 h on inflammation markers in the in vitro neurotoxicity model. The effects of Hesperidin on TNF‐α, IL‐1β, and IL‐6 (a–c) mRNA expression levels (fold change) and (d–f) protein levels in the in vitro neurotoxicity model (d‐SH‐SY5Y cells treated with 250 μM H₂O₂ for 24 h). Results presented as mean ± SD. Significant difference compared to H₂O₂ group, *p < 0.05, **p < 0.01, ***p < 0.005, and ****p < 0.0001. Significant difference compared to control group, ^# p < 0.05, ^## p < 0.01, and ^### p < 0.005.

Based on our findings, both mRNA and protein levels of TNF‐α, IL‐1β, and IL‐6 were significantly elevated in the H₂O₂ group compared to the control group (p < 0.05, p < 0.01, p < 0.005). Moreover, TNF‐α expression was significantly suppressed in both the pre‐treatment and post‐treatment groups following administration of hesperidin at 75 µM and 100 µM, in comparison to the H₂O₂ group (p < 0.01, p < 0.005, p < 0.0001). IL‐1β mRNA and protein levels were also significantly reduced, particularly in the 75 µM and 100 µM post‐treatment groups (p < 0.05, p < 0.01, p < 0.005). Although the IL‐6 mRNA expression levels showed a decreasing trend in all treatment groups compared to the H₂O₂ group, the reduction was not statistically significant (p > 0.05); however, IL‐6 protein levels were significantly decreased across the treatment groups (p < 0.01).

3.5. Hesperidin Modulates Key Inflammatory and MMP Genes

The effect of Hesperidin on the gene expression of NF‐κB and COX‐2, two key mediators of neuroinflammation, was analyzed using the RT‐qPCR method. In the H₂O₂‐treatedgroup, NF‐κB and COX‐2 mRNA levels were significantly upregulated compared to the control group, by approximately 1.3‐fold and 3.3‐fold, respectively. Pre‐treatment with 75 and 100 μM Hesperidin prior to H₂O₂ induced neurotoxicity suppressed NF‐κB expression by approximately 1.5‐fold and 1.9‐fold, respectively (p < 0.01 and p < 0.005). In contrast, post‐treatment with 75 and 100 μM Hesperidin significantly inhibited the expression of both NF‐κB (1.5‐fold and 1.6‐fold) and COX‐2 (1.4‐fold and 1.5‐fold) compared to the H₂O₂ group (p < 0.05, p < 0.01 and p < 0.005) (Figure 4a,b).

Figure 4.

The effects of pre‐ and post‐treatment with Hesperidin (75 µM and 100 µM) in 48 h on NF‐κB, COX‐2, MMP‐2, and MMP‐9 gene expression levels in the in vitro neurotoxicity model. (a, b) The effects of Hesperidin on NF‐κB and COX‐2, the mediators of the inflammation pathway, mRNA expression levels (fold change). (c, d) The effects of Hesperidin on MMP‐2, and MMP‐9 mRNA expression levels (fold change). Results presented as mean ± SD. Significant difference compared to H₂O₂ group, *p < 0.05, **p < 0.01, and ***p < 0.005. Significant difference compared to control group, ^# p < 0.05, and ^### p < 0.005.

The mRNA expression of MMP‐2 and MMP‐9 was assessed due to their role in blood‐brain barrier disruption during neurodegeneration. In the H₂O₂group, MMP‐2 and MMP‐9 expression levels significantly increased compared to the control group (p < 0.005). All treatment groups exhibited a statistically significant downregulation of MMP‐2 and MMP‐9 gene expression (p < 0.01 and p < 0.005). Notably, 100 µM Hesperidin significantly suppressed MMP‐9 expression in the pre‐treatment paradigm, whereas post‐treatment administration resulted in a marked inhibition of MMP‐2 (p < 0.005, for both) (Figure 4c,d).

3.6. Hesperidin Modulates Oxidative Stress Markers in H₂O₂‐Treated d‐SH‐SY5Y Cells

The effects of pre‐treatment and post‐treatment with Hesperidin (75 μM and 100 μM) on oxidative stress‐related TAS, TOS, and OSI levels were analyzed in d‐SH‐SY5Y cells. Compared to the control group, the H₂O₂ group exhibited a significant increase in TOS levels and a significant decrease in TAS levels due to oxidative stress (p < 0.01; p < 0.005, respectively).

However, when compared to the H₂O₂ group, post‐treatment with Hesperidin notably increased TAS levels while significantly suppressing TOS levels (p < 0.005, for both). Consequently, the Oxidative Stress Index (OSI), calculated based on the ratio of these two parameters, decreased in both pre‐ and post‐treatment Hesperidin groups compared to H₂O₂ group. However, OSI level was markedly reduced, particularly in the post‐treatment Hesperidin groups (p < 0.0001) (Figure 5).

Figure 5.

The effect of pre‐ and post‐treatment with Hesperidin (75 µM and 100 µM) on TAS, TOS, and OSI values in the in vitro neurotoxicity model (induced 250 µM H₂O₂). Graph of (a) TAS, (b) TOS, (c) OSI results in d‐SH‐SY‐5Y cells. Results presented as mean ± SD. Significant difference compared to H₂O₂ group, **p < 0.01, ***p < 0.005, and ****p < 0.001. Significant difference compared to control group, ^### p < 0.005.

3.7. Molecular Docking of Hesperidin With Inflammatory Targets

This study applied molecular docking techniques to predict how Hesperidin binds within the active or binding sites of selected proteins. Representative docking visualizations illustrate the binding conformations of Hesperidin to TNF‐α, IL‐6, IL‐1β, NF‐κB, COX‐2, MMP‐2, and MMP‐9 (Figure 6). Key interacting residues are highlighted and labeled, with hydrogen bonds shown as , Weak Hydrogen Bonds as , hydrophobic contacts as , halogen bounds as , ionic interaction as , cation‐pi interactions as , and π–π stackings as . Binding energies and interacting residues are summarized in Table 2. These docking models suggest that Hesperidin may interact with critical residues within the active sites of the target proteins. Among the examined protein‐ligand complexes, binding free energy rankings were determined as follows: COX‐2 > TNF‐α > MMP‐2 > MMP‐9 > IL‐1β > NF‐κB > IL‐6.

Figure 6.

Molecular docking analyses demonstrated the interactions of Hesperidin with key inflammatory mediators (TNF‐α, IL‐6, IL‐1β, NF‐κB, and COX‐2) and matrix metalloproteinases (MMP‐9 and MMP‐2). The figure depicts the 2D representations of the amino acid residues involved in the binding interfaces with Hesperidin.

Table 2.

Molecular docking results of Hesperidin with selected target proteins.

Target protein	PDB ID	Binding energy (kcal/mol)	Key interacting residues (chain and position)
TNF‐α	1TNF	−11.6	Chain A: CYS69 LYS98 SER99 PRO100 CYS101 GLN102 ARG103 GLU104 PRO106 GLY108 PRO113 TRP114 TYR115 GLU116
			Chain B: CYS69 LYS98 SER99 PRO100 CYS101 GLN102 ARG103 GLU104 THR105 PRO106 GLU107 GLY108 ALA109 TRP114 TYR115 GLU116
			Chain C: CYS69 HIS73 LYS98 SER99 PRO100 CYS101 GLN102 ARG103 GLU104 THR105 PRO106 GLU107 GLY108 ALA109 GLU110 LYS112 TRP114 TYR115 GLU116
IL‐6	1ALU	−7.9	Chain A: ILE88 LEU92 GLU93 PHE94 GLU95 VAL96 GLU99 LYS120 VAL121 ILE123 GLN124 PHE125 GLN127 LYS128 LYS129 ALA130 LYS131 ASN132 LEU133 ASP134 ALA135 ILE136 THR137 THR138 PRO139 ASP140 PRO141 ASN144
IL‐1β	5I1B	−8.3	Chain A: VAL3 ARG4 SER5 LEU6 ASN7 SER43 SER45 GLY61 LEU62 LYS63 GLU64 LYS65 ASN66 LEU67 TYR68 VAL85 ASP86 PRO87 LYS88 ASN89 TYR90 PRO91 SER152 SER153
NF‐κB	1SVC	−8.0	Chain P: LYS52 ARG54 GLY55 PHE56 ARG57 ARG59 TYR60 GLU63 HIS67 ASN103 HIS144 VAL145 THR146 LYS147 VAL150 THR205 LYS206 MET208 ASP209 LEU210 SER211 VAL212 TYR241 ASP242 SER243 LYS244 ALA245 PRO246 ASN247 ALA248 SER249 ASN250 LEU251 LYS252 ILE253 ASP274 LYS275 GLN277 ASP280 PHE310 ARG336 SER338 ASP339 SER343 GLU344
COX‐2	1CX2	−12.2	Chain C: ALA33 ASN34 PRO35 CYS36 CYS37 SER38 ASN39 PRO40 CYS41 GLN42 ASN43 ARG44 GLY45 GLU46 CYS47 MET48 SER49 PHE52 GLN54 TYR130 ASN131 VAL132 HIS133 TYR134 GLY135 TYR136 ALA151 LEU152 PRO153 PRO154 VAL155 ALA156 ASP157 ASP158 CYS159 GLN461 GLU465 TYR466 LYS468 ARG469 PHE470 SER471
			Chain D: GLU322 TRP323 GLY324 GLU326 GLN327
MMP‐2	1QIB	−10.5	Chain A: TYR155 PRO156 PHE157 ASP161 GLY162 LEU163 LEU164 ALA165 HIS166 ALA167 PHE168 ALA169 TYR193 LEU197 VAL198 HIS201 GLU202 HIS205 LEU209 GLU210 HIS211 SER212 GLN213 ASP214 PRO215 GLY216 ALA217 LEU218 MET219 ALA220 PRO221 ILE222 TYR223 THR227 THR229 ASN231 PHE232 ARG233 SER235
MMP9	1L6J	−10.1	Chain A: LYS92 ARG95 THR96 PRO97 ARG98 CYS99 LYS184 ASP185 LEU188 GLY213 LYS214 GLY215 ASP390 GLN391 GLY392 TYR393 LEU397 VAL398 HIS401 GLU402 PRO415 GLU416 ALA417 LEU418 MET419 TYR420 PRO421 MET422 TYR423 ARG424 PHE425 THR426 GLU427 GLY428 PRO429 PRO430 LEU431 HIS432 LYS433 ASP434 ASP435
UBIQUITIN	1UBQ	−7.0	Chain A: ILE23 GLU24 LYS27 ALA28 GLN31 PRO38 ASP39 GLN41 ARG42 LEU43 GLY47 LYS48 GLN49 LEU50 GLU51 ASP52 GLY53 ARG54 TYR59 ARG72 LEU73 ARG74 GLY75 GLY76

Bioinformatic analysis demonstrated that H₂O₂ exposure was associated with genes involved in oxidative stress responses (CAT, NFE2L2, HMOX1, SOD2), cell survival signaling (MAPK1, MAPK3), and mitochondrial apoptotic pathways (CASP3, BAX, BCL2, TP53) (Figure 7a). In comparison, Hesperidin treatment was linked to the regulation of inflammatory mediators (TNF, IL‐1β, IL‐6, PPARG, TGFβ1), apoptosis‐related genes (CASP3, BAX, BCL2), and antioxidant defense components (NFE2L2, CAT) (Figure 7b). Collectively, these findings show that Hesperidin may exert a robust neuroprotective effect by simultaneously enhancing the antioxidant defense system, suppressing inflammation, and attenuating mitochondria‐mediated apoptotic processes.

Figure 7.

Suggested genes interacting with (a) H₂O₂ and (b) Hesperidin according to “Comparative Toxicogenomics Database (CTD) using https://ctdbase.org/” [39].

4. Discussion

In our previous study, we demonstrated the neuroprotective potential of Hesperidin against Aβ₁‐₄₂‐induced neurotoxicity in d‐SH‐SY5Y cells [40]. Based on these findings, the present study aimed to investigate the protective effects of Hesperidin against H₂O₂‐induced oxidative stress and neuroinflammation, two key pathological drivers in the progression of neurodegenerative disorders. Using an in vitro model, we explored the protective efficacy of Hesperidin through both pre‐ and post‐treatment paradigms and further elucidated its molecular mechanisms via molecular docking analysis. Hesperidin markedly attenuated H₂O₂‐induced cytotoxicity by preserving cell morphology and viability, while also downregulating the expression of key pro‐inflammatory cytokines (TNF‐α, IL‐1β, IL‐6), inflammatory mediators (NF‐κB, COX‐2), and matrix metalloproteinases (MMP‐2 and MMP‐9). Furthermore, oxidative stress markers were significantly reduced. These in vitro effects were supported by in silico docking results, suggesting strong interactions between Hesperidin and its molecular targets. Collectively, these findings highlight Hesperidin's multifaceted neuroprotective potential through the modulation of oxidative and inflammatory pathways.

Increased levels of H₂O₂ in the brain contribute to elevated oxidative stress, which in turn promotes DNA damage, exacerbates neuroinflammation, and impairs mitochondrial function. These processes collectively lead to neuronal loss and synaptic dysfunctions in neurodegenerative diseases such as AD and PD [41, 42]. In the present study, we demonstrated that H₂O₂ exposure under in vitro conditions significantly reduced cell viability, induced pronounced morphological alterations in d‐SH‐SY5Y cells, and elevated the expression of inflammatory mediators along with total oxidant levels. These findings are consistent with previous reports in the literature and provide a reliable experimental model for investigating the mechanisms of neurotoxicity [43, 44, 45, 46, 47].

One of the key attributes that distinguishes Hesperidin as a promising therapeutic candidate is its ability to cross the BBB, a feature that significantly enhances its relevance as a neuroprotective flavonoid [48, 49, 50]. In the present study, both pre‐treatment and post‐treatment applications of Hesperidin effectively increased cell viability and ameliorated H₂O₂‐induced morphological damage in differentiated SH‐SY5Y cells. These findings are in line with previous studies demonstrating the protective role of Hesperidin against a range of neurotoxic agents, including Aβ₁–₄₂, lipopolysaccharide (LPS), bupivacaine, and 6‐hydroxydopamine (6‐OHDA). Importantly, these studies consistently reported that Hesperidin alone exhibited minimal cytotoxicity while enhancing cell survival in the presence of neurotoxic stimuli [26, 27, 40, 47, 51]. The increased cell viability observed in our study further supports Hesperidin's neuroprotective profile and underscores its potential as a therapeutic agent in the context of neurodegenerative diseases.

Neuronal cells exposed to oxidative stress activate immune system components via NF–κB–mediated signaling pathways, leading to the production and release of various pro‐inflammatory cytokines and mediators, including TNF‐α, IL‐1β, IL‐6, and COX‐2 [29, 52, 53]. Among these, TNF‐α plays a particularly pivotal role by further increasing ROS production, which in turn sustains NF‐κB activation, creating a self‐amplifying inflammatory loop [54]. Several studies have shown that downregulation of the NF‐κB pathway and inhibition of pro‐inflammatory cytokines under oxidative stress conditions contribute significantly to neuroprotection [23, 48, 51]. Notably, an in vivo study by Muhammad et al. (2019) demonstrated that hesperetin, the aglycone form of Hesperidin, attenuated LPS‐induced neuroinflammation by modulating the TLR4/NF‐κB signaling pathway, resulting in a marked reduction in inflammatory cytokine expression [49]. Similarly, in an in vivo Alzheimer's disease model, Hesperidin treatment was shown to suppress oxidative stress and inhibit inflammation by reducing TNF‐α, C‐reactive protein, and MCP‐1 levels, alongside the inhibition of NF‐κB activation [55]. Furthermore, NF‐κB activation and increased pro‐inflammatory cytokine levels are known to upregulate COX‐2 expression, thereby reinforcing the inflammatory cascade [15, 29, 56]. In the present study, molecular docking analyses revealed that Hesperidin exhibited strong binding affinities to multiple inflammatory mediators, including COX‐2 (–12.2 kcal/mol), TNF‐α (–11.6 kcal/mol), IL‐1β (–8.3 kcal/mol), IL‐6 (–7.9 kcal/mol), and NF‐κB (–8.0 kcal/mol). Particularly high affinities were observed for COX‐2 and TNF‐α, suggesting these molecules as key targets. These computational findings corroborated by our in vitro results, which showed a marked downregulation of these inflammatory mediators at both the mRNA and protein levels in Hesperidin‐treated groups. It is plausible that the suppression of the inflammatory response is primarily initiated through the modulation of COX‐2 and TNF‐α, subsequently leading to decreased expression of IL‐1β and IL‐6. The amplification of inflammatory signaling involves a complex network of interdependent molecular interactions; therefore, inhibiting key nodes within this pathway may contribute to the regulation of chronic neuroinflammation [57, 58, 59]. Collectively, our findings support existing literature and provide evidence that Hesperidin exerts a neuroprotective effect against H₂O₂induced toxicity by mitigating inflammation through both in vitro and in silico approaches.

MMPs have been shown to disrupt the BBB by degrading components of the basal lamina, thereby contributing to neuroinflammatory responses observed in various neurological disorders [16]. Among them, MMP‐2 and MMP‐9 are key collagenases that facilitate the degradation of the extracellular matrix in inflammatory diseases [53]. Elevated expression levels of MMP‐2 and MMP‐9 have been reported in both clinical and in vivo studies involving ALS and AD [18, 19, 60, 61]. Given the pathological upregulation of these MMPs in several neurological diseases, they are thought to be important therapeutic targets. Interestingly, as a result of combined treatment with recombinant tissue plasminogen activator and Hesperidin in patients with ischemic stroke, serum MMP‐2 and MMP‐9 levels decreased and patients showed significant improvement [62]. In the current study, it was determined that Hesperidin treatment against H₂O₂ neurotoxicity reduced both MMP‐2 and MMP‐9 mRNA levels. Our findings suggest that Hesperidin may contribute to neuroprotection through the inhibition of these enzymes. Molecular docking analyses further supported this observation, revealing strong binding affinities of Hesperidin for MMP‐2 (–10.5 kcal/mol) and MMP‐9 (–10.1 kcal/mol), indicating a high binding potential. To date, molecular docking studies specifically assessing Hesperidin's interaction with MMP‐2 and MMP‐9 are limited. However, a study by Kumar et al. (2024) reported high binding affinity of Hesperidin to MMP‐9, with the formation of multiple hydrogen bonds [63]. Our results are consistent with these findings and further underscore Hesperidin's potential as a therapeutic agent in mitigating neurodegenerative damage by targeting MMP‐mediated pathways.

To protect the brain from oxidative damage, it is essential to enhancing endogenous antioxidant defense mechanisms [23]. Numerous in vitro and in vivo studies have demonstrated that Hesperidin enhances the activity of antioxidant enzymes and reduces oxidative stress markers induced by various neurodegenerative agents [26, 64]. In another study conducted on RPE‐19 cells, Hesperidin was shown to inhibit H₂O₂‐induced apoptosis and ROS generation [23]. In the present study, we evaluated the oxidative stress response to Hesperidin treatment by measuring TOS, TAS, and OSI in differentiated SH‐SY5Y cells. Notably, post‐treatment with Hesperidin significantly decreased total oxidant levels while increasing total antioxidant capacity in response to H₂O₂‐induced neurotoxicity. The more pronounced effect observed in the post‐treatment group suggests that Hesperidin may more effectively target stress response and cellular repair mechanisms that are activated after oxidative damage has already occurred. These findings underscore the therapeutic relevance of Hesperidin in modulating oxidative stress, particularly in the context of established neuronal injury. This time‐dependent variation warrants further investigation in future dose‐ and time‐course studies.

Taken together, our in vitro and in silico findings provide strong evidence that Hesperidin exerts neuroprotective effects through its multi‐targeted modulation of oxidative stress, inflammatory signaling, and matrix metalloproteinase activity. Bioinformatic profiling further supported this conclusion by showing that H₂O₂ primarily engages pathways related to oxidative stress, impaired cell survival, and mitochondrial apoptosis, whereas Hesperidin is predicted to counteract these disturbances by enhancing antioxidant defenses and suppressing pro‐inflammatory and pro‐apoptotic signaling. Collectively, these complementary computational and experimental observations highlight the therapeutic relevance of Hesperidin in neurodegenerative contexts and underscore its potential for further preclinical and translational investigation.

5. Conclusion

In this study, we demonstrated the neuroprotective effect of Hesperidin against H₂O₂‐induced neuroinflammation and oxidative stress in differentiated SH‐SY5Y cells. Our findings revealed that through both pre‐treatment and post‐treatment paradigms, Hesperidin enhanced cell viability, mitigated morphological damage, and suppressed the expression of key pro‐inflammatory mediators such as TNF‐α, IL‐1β, IL‐6, NF‐κB, COX‐2, MMP‐2, and MMP‐9 and attenuated oxidative stress. These in vitro findings were further supported by molecular docking analyses, which demonstrated high binding affinities of Hesperidin to critical inflammatory and matrix remodeling targets. Taken together, these results highlight Hesperidin's multifaceted mechanism of action and reinforce its therapeutic potential as a modulator of oxidative and inflammatory pathways in neurodegenerative disease models. Future in vivo and clinical investigations are warranted to further elucidate its efficacy and translational relevance.

Author Contributions

Hamiyet Eciroglu‐Sarban: writing – original draft, project administration, methodology, funding acquisition, investigation, formal analysis, conceptualization. Fatma Yildiz: investigation, methodology, conceptualization, writing – review and editing. Fatma Gonca Kocanci: software, methodology, conceptualization, writing – review and editing. Pınar Altin‐Celik: methodology, formal analysis, conceptualization, writing – review and editing. Muazzez Derya Andeden: methodology, formal analysis, conceptualization, writing – review and editing.

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The data that supports the findings of this study are available from the corresponding author upon reasonable request.