Summary
The lysosomal-related protein NPC2 affects the occurrence and development of tumors in terms of stemness, gene mutational burden, and microsatellite instability of tumor cells. Here, combining with our previous scRNA-seq data, we identified the protective role of NPC2 in bone metastasis of lung adenocarcinoma (LUAD). Bone metastases exhibited lower NPC2 expression compared to primary tumors, and low NPC2 expression was associated with poorer LUAD patient survival. NPC2 knockdown LUAD cells exhibited enhanced migration capability, and their supernatant accelerated the osteoclast differentiation and maturation. In vivo, NPC2 knockdown promoted the development of osteolytic lesions induced by PC9 cells, whereas NPC2 overexpression partially rescued these lesions. We also found that these effects might be mediated via the AKT/mTOR signaling pathway and crosstalk between cancer cells and osteoclasts. These findings indicate that NPC2 plays a critical role in the osteolytic metastasis of LUAD and may represent a promising therapeutic target for this disease.
Subject areas: Biological sciences, Cancer
Graphical abstract

Highlights
-
•
NPC2 expression is reduced in LUAD bone metastasis
-
•
NPC2 participates in LUAD cell invasion and migration through the AKT/mTOR pathway
-
•
NPC2 in LUAD cells modulates osteoclast differentiation and maturation
-
•
NPC2 inhibits the osteolytic bone metastasis of LUAD in vivo
Biological sciences; Cancer
Introduction
Lung cancer is one of the most common malignant tumors and the leading cause of cancer-related mortality worldwide.1 The 3-year overall survival rate declines sharply from 71.6% to 46.8% once non-small cell lung cancer (NSCLC) spreads to bone. In addition, skeletal-related events (SREs) have a great impact on patients’ quality of life.2 Bone metastasis in lung cancer is characterized by abnormal osteoclast differentiation and dysfunction. The RANK/RANKL/OPG pathway is a crucial component of osteoclast-mediated bone destruction.3,4 Local and systemic treatments are currently the backbones of metastasis inhibition; however, they frequently fail to eradicate metastatic tumors in bone.5 Bone-targeting agents can reduce the risk of SREs in patients with bone metastases, but they lack direct anti-tumor effects and do not improve overall survival.6 Given these challenges, there is an urgent need to develop innovative therapeutic strategies that simultaneously target tumor progression and bone destruction.
Lysosomes play a critical role in diverse cellular biological functions and have become a focal point of cancer research. Numerous lysosome-associated genes contribute to their complex roles in tumor metastasis.7 NPC2 was officially named in 2000, as it, along with NPC1, is a key gene implicated in Niemann-Pick disease type C (NPC). As a small, ubiquitously expressed lysosomal glycoprotein, NPC2 is best known for its role in regulating intracellular cholesterol homeostasis.8 In recent years, NPC2 has attracted growing interest in cancer research because of its involvement in lysosomal function, autophagy, apoptosis, and immune responses. It also influences tumor cell stemness, genomic instability, and the immune microenvironment, thereby playing an important role in tumor initiation and progression.9,10,11,12 However, studies on NPC2 and lung cancer have yielded conflicting results. For instance, NPC2 expression was strongly correlated with oncogene/transcription factor TITF1/NKX2-1.13 Conversely, NPC2 has been reported to show negative correlations with cancer stemness, tumor mutation load, microsatellite instability, and the maintenance of pre-lung cancer microenvironment.12,14 Moreover, research specifically examining the role of NPC2 in tumor bone metastasis remains scarce. Accumulating evidence indicates that dysregulated cholesterol metabolism is closely associated with bone metastasis.15 Given that NPC2 is essential for cellular cholesterol homeostasis, further investigation of its biological functions and its role in lung cancer bone metastasis is clearly warranted.
To address this issue, we identified the NPC2 gene through an analysis of prior single-cell RNA sequencing (scRNA-seq) data derived from primary tumors and bone metastases from the perspective of lysosome function. We then examined its role in the biological behavior of tumor cells and in lung cancer bone metastasis, and initially explored the underlying mechanism to provide new insights into potential therapeutic strategies for LUAD with bone metastasis.
Results
NPC2 was likely to play a protective role during the bone metastases of lung cancer
NPC2 was low-expressed in the possible metastasis-initiating cell subset
The scRNA-seq data used in this study were obtained from Hou J B et al.16 These data encompass nine lung cancer specimens, including both primary and bone metastatic lesions (Table S1). A total of eleven epithelial cell subsets were identified: of which ten were classified as tumor cells and one as alveolar type II (AT2) epithelial cells (Figure 1A). Compared with primary tumors without metastasis (PT), genes downregulated in epithelial cells of primary tumors from patients with bone metastatic (PMTs) were significantly enriched in the lysosomal membrane. In contrast, relative to primary tumors, the epithelial cells in bone metastases (MT) presented upregulated genes that were enriched in lysosomal lumen (Figures 1B and 1C).16 These findings suggest that lysosomes may play a crucial role in lung cancer bone metastasis. We then performed unsupervised pseudotime analysis of these epithelial cells and identified Cancer Cells 1 as a potential metastasis-initiating cell subset, because this subset was present in both the MPT and MT groups and appeared at the early stages of epithelial cell evolution (Figures 1D and 1E).16 Alignment with the lysosomal gene set in the GSEA database (Data S1), we revealed that the lysosome-related NPC2 was low expressed in this cancer cell subset (Table S2).
Figure 1.
Screening for target gene NPC2 with scRNA-seq analysis
(A) Heatmap of TOP 10 differential genes in each subset of epithelial cells.
(B) GO enrichment analysis for differentially expressed genes in epithelial cells of PT, MPT and MT groups. Compared with PT group, these genes enriched in lysosomal membrane were significantly declined in epithelial cells of MPT group.16
(C) Contrast to PT group, the epithelial cells in MT group presented upregulated genes that were enriched in lysosomal lumen.16
(D) Uniform manifold approximation and projection (UMAP) was utilized for unsupervised clustering and unbiasedly visualizing cell subsets of epithelial cells by groups on a two-dimensional map.
(E) Unsupervised pseudotime analysis was conducted for epithelial cells across all three groups.16
(F) Copy number variation (CNV) analysis of epithelial cells was performed using macrophages as a reference. A hierarchical heatmap displays CNVs for individual cells (rows) from NPC2 expressing tumor cells, inferred from the average expression of 101 genes around each chromosomal position (columns). Red: amplifications; Blue: deletions.
(G) Boxplot of CNV scores for each cell group. Data are presented as the mean ± SEM, ∗∗∗∗p < 0.0001.
High copy number variations were found in NPC2 low-expression tumor cells
Tumor cells were divided into an NPC2 low-expression group (including cancer cells subset 1, 2, 3, 5, 6, 8, 9) and an NPC2 high-expression group (including cancer cells subset 4, 7, 10) according to the transcript levels for further analysis. The hierarchical CNV heatmap revealed that genome reprogramming was more pronounced in the NPC2 low-expression group than in the NPC2 high-expression group (Figure 1F). Specifically, while most CNVs displayed heterogeneity among NPC2 low-expression tumor cells, chromosome 8 amplification and chromosome 15 deletion were exhibited together in all the NPC2 low-expression tumor cell subsets. The oncogene MYC, located on chromosome 8, and the CHRNA gene, located on chromosome 15, have been strongly associated with lung cancer.17,18 In addition, CNV scores were significantly higher in the NPC2 low-expression group compared with the NPC2 high-expression group, supporting the notion that NPC2 low-expression lung cancer cells possess more malignant characteristics (Figure 1G).
Low expression of NPC2 was found in bone metastases tissues of lung adenocarcinoma and predicted a poor survival
Immunohistochemical (IHC) staining of NPC2 was performed on pathological sections of patients with LUAD. IHC score for NPC2 expression in tumor tissues, along with detailed patient information, is summarized in Table S3. Compared with primary tumors and brain metastases, bone metastases exhibited the lowest levels of NPC2 expression (Figures 2A and 2B). Analysis of public datasets further demonstrated that the low expression of NPC2 predicted poor prognosis in LUAD (Figure 2C). In addition, we monitored 40 patients with metastatic LUAD (Table 1) over a two-year period. Kaplan-Meier survival analysis revealed that patients with low NPC2 expression had shorter overall survival (OS) compared with those exhibiting high NPC2 expression. a trend that was also observed in patients with bone metastatic LUAD (Figure 2D). However, the statistical significance was limited due to the small sample size.
Figure 2.
Clinical research about NPC2 and bone metastasis in LUAD
(A) H&E and NPC2 staining of pathological sections from patients with LUAD at various sites. For NPC2 staining, the brown-yellow color resided in the cytoplasm is the positive result; scale bars, 200 μm.
(B) IHC scores for NPC2 staining categorized by pathological sections from different sites; Data are expressed as the mean ± SEM (n = 5); ns: not significant, ∗p < 0.05, ∗∗p < 0.01.
(C) KM survival curves for overall survival in patients with LUAD with varying NPC2 expression levels obtained from public databases (left: GEPIA2; right: LinkedOmics).
(D) KM curves of metastatic LUAD (left) and LUAD bone metastasis (right) based on different serum NPC2 levels. Patients were categorized into high-expression (NPC2 concentration >32.27 ng/mL) and low-expression groups (NPC2 concentration ≤32.27 ng/mL), based on the median concentration of 32.27 ng/mL (range: 8.29 to 152.28 ng/mL), with 20 patients in each group.
Table 1.
Clinicopathological information of patients with LUAD
| Parameters | All (n = 40) | NPC2 Low-expression group (n = 20) |
NPC2 High-expression group (n = 20) |
p-value |
|---|---|---|---|---|
| Concentration of NPC2 (ng/mL) | 32.27 (8.29,152.28) | ≤32.27 | >32.27 | |
| Age (year) | 57.1 ± 8.61 | 56.05 ± 7.54 | 57.57 ± 10.53 | 0.483 |
| Sex | 0.525 | |||
| Male | 22 (55%) | 12 (60%) | 10 (50%) | |
| Female | 18 (45%) | 8 (40%) | 10 (50%) | |
| Site of metastasis | ||||
| bone | 29 (72.5%) | 15 (75%) | 14 (70%) | 0.723 |
| brain | 21 (52.5%) | 11 (55%) | 11 (50%) | 0.752 |
| Other sites | 14 (35%) | 5 (25%) | 9 (45%) | 0.185 |
| EGFR mutation | 28 (70%) | 13 (65%) | 15 (75%) | 0.49 |
| ECOG PS | ||||
| 0 | 17 (42.5%) | 8 (40%) | 9 (45%) | 0.749 |
| ≥1 | 23 (57.5%) | 12 (60%) | 11 (55%) |
LUAD: Lung Adenocarcinoma; EGFR: Epidermal Growth Factor Receptor. ECOG: Eastern Cooperative Oncology Group; PS: Performance Status.
NPC2 knockdown prompted the malignant biological behaviors of lung adenocarcinoma cells
CCK-8 assay showed that NPC2 knockdown (shR) significantly enhanced the proliferative capacity of PC9 cells after 24 h compared with the corresponding negative control (shR-NC) group. However, NPC2 knockdown in A549 cells had minimal effect on proliferation (Figures 3C and 3D). Similarly, colony formation was markedly increased in NPC2-deficient PC9 cells, whereas no obvious changes were observed in A549 cells (Figures 3F and 3G).
Figure 3.
The malignant biological behaviors of LUAD cells affected by NPC2
(A) The level of NPC2 mRNA relative to GAPDH declined in shR groups (n = 3). (B) NPC2 expression was reduced in the shR groups, as detected by Western blot.
(C–E) CCK-8 assay examined the effect of NPC2 knockdown on LUAD cell growth (left: A549 cells; middle: PC9 cells; right: H1975 cells), OD values were significantly higher in the shR group of PC9 cells after 24 h compared to the NC group. n = 5. (F) The colony-forming efficiency of each group is shown by the percentage of colony numbers. n = 3.
(G) Representative images of colony formation assay of A549 and PC9 cells, cells were seeded in six-well plate and photographed after 7–10 days.
(H) Micrographs were acquired immediately after wounding and at 24 and 48 h post wounding. Scale bars, 200 μm.
(I) Bar graph shows the wound closure distance at 48 h n = 3.
(J and K) Representative images from Transwell assays assessing migration and invasion. Scale bars,100 μm
(L and M) Bar graphs show that the migration and invasion abilities of LUAD cells were increased in the shR groups. n = 3.
Data are presented as the mean ± SEM; ns: not significant, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
Considering that different gene mutations harbored in A549 and PC9 might influence these results, we included another EGFR-mutated lung cancer cell line, H1975, which is similar to PC9, for the replication of the CCK-8 assay.19 However, NPC2 knockdown in H1975 cells did not significantly alter their proliferative capacity (Figure 3E).
NPC2 knockdown in lung adenocarcinoma cells was conducive to their metastasis
The wound healing assay demonstrated that the scratch widths in shR-NC groups were significantly wider than those in shR groups (Figures 3H and 3I). Consistently, the number of cells that migrated through the PC membrane was significantly higher in shR groups compared with shR-NC groups in both migration and invasion assays (Figures 3J–3M). These results indicate that NPC2 downregulation enhances the migratory and invasive capabilities of LUAD cells.
NPC2 knockdown in lung adenocarcinoma cells promoted osteolytic bone metastasis
In the tumor micro-environment of both primary tumors and bone metastases in lung cancer, macrophages represented the second most abundant cell lineage after tumor cells (Table S4 and Figure 4A). Osteoclasts, a specialized subset of macrophages, play a critical role in the “Tumor-osteoclast vicious cycle” and the development of osteolytic bone metastases in lung cancer.4 We therefore investigated the role of NPC2 in modulating the interaction between LUAD cells and osteoclasts.
Figure 4.
NPC2 knockdown in LUAD cells promoted osteoclast-mediated bone destruction
(A) The micro-environment constituent of the PT, MPT and MT groups showed by bar graph.
(B) TRAP staining on day 10 during osteoclast induction. All experimental groups had mature TRAP-positive osteoclasts except the negative control group. TRAP-positive osteoclast: Red violet cell containing >3 nuclei. Scale bars, 50 μm.
(C) The proportions of TRAP-positive osteoclast area were quantified in each well (12-well plate), n = 3.
(D and E) qRT-PCR analysis of the relative expression level of specific osteoclastogenic genes after 10 days of osteoclast induction. n = 3.
(F) Fluorescence microscopy of F-actin ring (green) stain. Scale bars, 50 μm.
(G) F-actin ring counting in each well (12-well plate), n = 3.
(H and I) The levels of phosphorylated NF-kB and NF-kB were determined by immunoblotting analysis (n = 3).
(J) Mouse models with osteolytic lesions of LUAD were detected by X-ray at the second week after being injected with PC9 cells. Number of lesions (marked by red arrows) in the shR group was more than that in the NC group. Scale bars, 2 mm.
(K) The increase in osteolytic lesion area grew faster in the shR group compared to the NC group (n = 5).
(L) Mouse models with osteolytic lesions of LUAD were detected by X-ray at the third week after being injected with PC9 cells. Lesions were marked by a red arrow. Scale bars, 2 mm; H&E, NPC2, and TRAP staining of the osteolytic lesions. Scale bars, 200 μm.
(M) The area of osteolytic lesions was larger in the shR than the shR-NC group (n = 5), smaller in OE than the OE-NC group (n = 4).
(N) The percentages of TRAP-positive staining area are shown by a bar graph.
Data are presented as the mean ± SEM; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
The supernatant of NPC2 knockdown lung adenocarcinoma cells promoted osteoclastogenesis
The RAW264.7 cell line has been reported to be able to differentiate into mature, multinucleated osteoclasts, as indicated by positive tartrate-resistant acid phosphatase (TRAP) staining.20 When the supernatant from NPC2-knockdown LUAD cells was used for cell culture, osteoclasts in shR-NPC2 groups covered a larger area compared with the corresponding NC groups (Figures 4B and 4C), which was further confirmed by the upregulated mRNA expression of osteoclast differentiation markers Trap and Ctsk (Figures 4D and 4E). Osteoclasts form actin “sealing rings” to isolate and concentrate demineralized enzymes, thereby promoting bone resorption.21 Consistently, the number of F-actin rings was significantly higher in shR-NPC2 groups compared with NC groups (Figures 4F and 4G). Furthermore, NF-κB signaling, which plays a key role in osteoclast differentiation and maturation, was activated in shR-NPC2 groups relative to NC groups (Figures 4H and 4I).
NPC2 weakened PC9 cells induced bone osteolysis in vivo
In the mouse model, osteolytic lesions in the shR group developed more rapidly and were significantly larger than those in the shR-NC group (Figures 4J and 4K). Tumor tissues in the lesion areas were confirmed by H&E staining, and NPC2 expression was evaluated by IHC (Figure 4L). TRAP staining further demonstrated that osteoclasts were more active in the shR-NPC2 group compared with the NC group (Figures 4L and 4N). Subsequently, we repeated the animal experiment using NPC2 overexpression PC9 cells (OE group), and the inhibitory effect of NPC2 on the development of osteolytic lesions in LUAD was further confirmed (Figures 4L and 4M).
Potential biological mechanisms implicated in NPC2-mediated lung adenocarcinoma osteolytic metastasis
NPC2 low-expression related to the cell cycle progression of lung cancer cells
Genes upregulated in the NPC2 low-expression group were primarily enriched in biological processes related to chromosome segregation and in cellular components associated with the chromosomal region and ribosome. The functions of these up-regulation genes were mainly associated with the spliceosome, cell cycle, ribosome, and DNA replication signaling pathway (Figures 5A and 5B). Consistently, E2F and MYC target genes, which positively regulate cell cycle progression, were activated in the NPC2 low-expression group (Figure 5C).
Figure 5.
Potential biological mechanisms implicated in NPC2-mediated LUAD osteolytic metastasis
(A) GO enrichment analysis for the highly expressed genes in NPC2 low-expression tumor cells.
(B) KEEG pathway analysis for the highly expressed genes in NPC2 low-expression tumor cells.
(C) The heatmap of hallmark gene set enrichment score between NPC2 low-expression and high-expression tumor cell populations.
(D) Immunoblotting analysis to detect the phosphorylation levels of AKT and mTOR in shR and OE groups.
(E and F) Cell-free cholesterol (FC) was measured by ELISA. n = 3. (G) Mitochondrial membrane potential (Δψm) was detected by the orange-red cationic fluorescent probe TMRE. Cells were treated with Carbonyl Cyanide m-Chlorophenylhydrazone (CCCP) as Positive Control. Scale bars, 20 μm
(H) Changes in Δψm for each group were analyzed by flow cytometry.
(I and J) Colocalization of LAMP1 and CTSB. Yellow or orange fluorescence indicates colocalization of CTSB (red) and LAMP1 (green). Representative images are shown, and the degree of colocalization was quantified using the correlation coefficient (Rr) (For A549 cells, the biological replicates was n = 3, and for PC9 cells n = 5). Colocalization of CTSB and LAMP1 was significantly increased in shR groups. Scale bars, 20 μm.
(K) Western blot analysis showing reduced expression levels of lysosomal enzymes CTSB and CTSD in shR groups.
(L) Uniform manifold approximation and projection (UMAP) was utilized after principal component analysis (PCA) for unsupervised clustering and unbiasedly visualizing cell subsets of mononuclear/macrophage on a two-dimensional map.
(M) The histogram of mononuclear/macrophage cell composition in each sample. “Osteoclasts-like cell” were found in samples L-00、 L-03, and L-09 from primary lung tumors.
(N) Ligand-receptor interactions between NPC2 Low-expression tumor cells and “osteoclast-like cell.”
Data are presented as the mean ± SEM; ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.
NPC2 influenced the activity of the AKT/mammalian target of rapamycin signaling pathway and the cellular free cholesterol content of lung adenocarcinoma cells
Pathway enrichment analysis using the Hallmark gene set revealed that PI3K/AKT/mTOR and mTORC1 signaling were upregulated in NPC2 low-expression tumor cells (Figure 5C). Phosphorylation of AKT at Ser473 has been reported to promote tumor proliferation by regulating the cell cycle22 and to facilitate tumor metastasis through modulation of microtubule stability and cell polarity.23 Therefore, we analyzed the activities of AKT and mTOR, and found that their phosphorylation levels were increased in shR groups and decreased in OE groups (Figure 5D). Meanwhile, after treatment with the mTOR inhibitor Torin2, the level of mTOR and AKT phosphorylation was reduced, however, the expression level of NPC2 was less affected. The growth, migration, and invasion ability of PC9 cells in the shR group were markedly inhibited (Figure S1).
Previous studies have shown that cholesterol facilitates mTORC1 recruitment and activation at the lysosomal surface.24 In addition, NPC2 binds free cholesterol (FC) and transports it out of lysosomes for further processing.8 The elevated activity of the AKT/mTOR signaling pathway in NPC2 knockdown cells may be closely related to NPC2’s role in exogenous cholesterol transport. Indeed, our results demonstrated that cells in shR groups contained higher levels of FC compared with the corresponding control groups, whereas NPC2 overexpression led to decreased FC content (Figures 5E and 5F). Collectively, these findings support the notion that NPC2 regulates intracellular FC levels in LUAD cells.
NPC2 knockdown breaks mitochondrial membrane potential (Δψm) and would accelerate apoptosis
The anticipated increase in proliferation due to accelerated cell cycling was not observed in all the LUAD cells. We speculated that the cell proliferation may be inhibited by cell death. Since a reduction in Δψm serves as an indicator of early-stage apoptosis,25 we analyzed Δψm using fluorescent staining and flow cytometry. Results showed that Δψm was decreased in shR groups but increased in OE groups (Figures 5G and 5H), suggesting that apoptosis may contribute to the reduced viability of NPC2 knockdown cells.
NPC2 knockdown protected the integrity of the lysosome membrane and influenced the lysosome enzymes
What drives apoptosis in NPC2 knockdown cells? Previous studies have shown that the accumulation of lysosome lipid due to NPC2 deficiency disrupts lysosomal membrane integrity, leading to leakage of cathepsins and sphingolipids and triggering lysosome-dependent apoptosis.26 We evaluated the leakage of cathepsin B (CSTB) in different groups, as CSTB is one of the most abundant lysosomal cathepsins and plays a key role in executing programmed cell death.27 Lysosome-associated membrane protein 1 (LAMP1) serves as a specific marker of the lysosome membrane, and co-localization of LAMP1 and CSTB reflects lysosomal membrane integrity.28 Our results revealed that the co-localization of these two proteins was more pronounced in shR groups compared with NC groups (Figures 5I and 5J), indicating that NPC2 knockdown did not cause lysosomal content release, and lysosome-dependent apoptosis was unlikely to occur. However, lysosomal function was affected by NPC2, as evidenced by the decreased expression of CTSB and CTSD in shR groups (Figure 5K). This was agreed with previous findings that low NPC2 expression can result in lysosomal dysfunction in fibroblasts.10 Therefore, the accumulation of abnormal metabolic products, which cannot be efficiently degraded by lysosomal enzymes, may contribute to apoptosis in NPC2 knockdown LUAD cells.
The role of NPC2 downregulation in “tumor-osteoclast vicious cycle”
We isolated a cluster from the mononuclear/macrophage cell subset that exhibited elevated mRNA levels of mature osteoclast markers, including ACP5, MMP9, and CTSK (Figure 5L). Interestingly, these genes are essential for the differentiation of macrophages into osteoclasts, and this “osteoclast-like cell” cluster was detected in primary lung tumor sites of patients L-00, L-03, and L-09 (Table S5 and Figure 5M). We therefore utilized this “osteoclast-like cell” to cluster to investigate the impact of NPC2 on the communication between tumor cells and osteoclasts.
Among the top 30 ligand-receptor interactions, the interactions between APP and CD74, as well as ANXA1 and FPR1/FPR3, were more pronounced when tumor cells acted as ligands, whereas interactions between CCL3L1/CXCL2 and DPP4, SPP1 and CD44, and LGALS9 and CD47 were stronger when tumor cells served as receptors (Figure 5N).
Discussion
In this study, we identified the anti-tumor role of NPC2 in LUAD bone metastasis through scRNA-seq analysis and public database mining. We found that lower NPC2 expression in tumor cells was associated with increased CNVs and correlated with poor prognosis in LUAD. NPC2 downregulation enhanced LUAD cell migration and invasion in vitro and accelerated the development of osteolytic metastases in nude mice. These findings suggest that NPC2 represents a promising therapeutic target for bone metastatic LUAD, as it influences both osteoclast activation and the dissemination of LUAD cells into bone tissue.
NPC2 expression has been reported to be negatively correlated with tumor mutation load and microsatellite instability, and patients with high NPC2 levels exhibited prolonged OS in LUAD.12 Besides, NPC2 overexpression remarkably reduces tumor-associated M2 macrophage infiltration and the secretion of pro-tumor cytokines.29 It impedes the chemotaxis of pro-tumor macrophage-lineage cells, partly by facilitating the lysosome degradation of the chemokine CCL6, thereby inhibiting early LUAD progression.14 Similarly, NPC2 inhibits the growth of mice breast cancer cell by promoting autophagy through the AKT/mTOR/S6K signaling pathway.30 Studies also reported that NPC2 suppresses proliferation and migration of hepatocellular carcinoma cells, some researchers suggested that it was associated with the cholesterol regulation role of NPC2, while others explained it by the inhibition role of it in ERK1/2 pathway and the expression of downstream oncogene c-MYC and cyclin D1, without relying on cholesterol regulation.31 Conversely, NPC2 overexpression promotes proliferation in gastric cancers and glioblastoma cells.32,33 Although the mechanism was not specified, previous research has shown that NPC2-mediated lipid droplet lipophagy supports glioblastoma cell growth.34 The heterogeneity of NPC2’s role among different cancers indicates the complexity of its function and the necessity of conducting research on it. Unlike the above studies, our work specifically elucidates the anti-tumor role of NPC2 in LUAD bone metastasis through the AKT/mTOR pathway and highlights its impact on the interaction between tumor cells and osteoclasts within the bone microenvironment, which might be related to the regulatory role of NPC2 in lipid metabolism and autophagy Figures 6.
Figure 6.
Proposed model of NPC2 deficiency-induced LUAD bone metastasis
NPC2 low-expression caused accumulation of FC in the lysosomal lumen, promoting the recruitment and activation of mTORC1 via SLC38A9. AKT kinase and mTORC1 are activated by phosphorylation, accelerating the cell cycle by up-regulation of transcription factors such as MYC, E2F …, and elevating the migration and invasion of LUAD cells. RANKL, a critical cytokine that promotes the maturation of osteoclasts, can also be upregulated by mTORC1. Besides, NPC2 low-expression inhibits lysosomal cathepsins and weakens the mitochondrial membrane potential (Δψm). The abnormal accumulation of metabolic products of tumor cells failing to be promptly degraded by lysosome enzymes leads to the apoptosis of NPC2 knockdown LUAD cells. Meanwhile, mitochondrial damage and mitophagy deficiency generate the accumulation of abnormal mitochondria leads to the release of inflammation-associated cytokines such as ANXA1 and the expression of APP on the cell membrane. Then ANXA1 and proteolytic fragments of APP interact with FPR1/3 and CD74 of pre-osteoclast and promote the differentiation of osteoclast. Together, these render NPC2 knockdown LUAD cells susceptible to osteolytic bone metastasis. Red arrows denote stimulatory effects, while blue arrows indicate inhibitory effects. Abbreviations: LUAD, lung adenocarcinoma; Aβ, amyloid beta peptide; APP, amyloid precursor protein; FC, free cholesterol.
Firstly, NPC2 affects the AKT/mTOR pathway in LUAD cells. Depletion of NPC2 has been reported to enhance the phosphorylation of p38, JNK, and AKT in hepatic stellate cells.9 Protein kinase B (AKT) and mammalian target of rapamycin complex 1 (mTORC1) have been shown to regulate cell migration in multiple studies.22 Meanwhile, mTORC1 increases the expression of RANKL in the bone microenvironment, thereby promoting the invasion of malignant cells into bone tissue.35 Recent findings indicate that elevated cholesterol levels in the lysosomal lumen, sensed by SLC38A9, facilitate mTORC1 recruitment and activation at the lysosome.24 Since high levels of FC were observed in NPC2 knockdown LUAD cells in our study, we speculate that mTOR pathway activation in NPC2-deficient lung cancer cells is likely linked to intracellular FC accumulation.
On the other hand, NPC2 depletion not only impairs lysosomal activity but also induces mitochondrial damage in LUAD cells. The combination of these defects may potentially block mitophagy. Mitophagy is the primary pathway for removing damaged mitochondria, which is essential for maintaining cellular energy homeostasis and protecting tumor cells from apoptosis.36 Defective mitophagy and impaired mitochondrial function have been observed in multiple cell types with NPC2 knockout.9,37 Dysregulation of mitophagy leads to the accumulation of dysfunctional mitochondria, which activate the inflammasome and thereby promote tumorigenesis and metastasis.38 For example, defective mitophagy contributes to bone metastasis in breast cancer through NLRP3 inflammasome activation by accumulated damaged mitochondria, resulting in increased IL6 and IL1B secretion by cancer cells.39
Notably, the observation that the supernatant of NPC2 knockdown LUAD cells facilitates osteoclast differentiation and activation, as found in this study, has not been previously reported. This highlights the potential role of NPC2 in mediating the interaction between LUAD cells and osteoclasts. Previous studies have shown that NPC2 knockdown activates the NF-κB pathway and increases IL-6 and IL-1β expression in fibroblasts.40 These cytokines can substitute for TNFSF11/RANKL to promote osteoclastogenesis. In LUAD, based on cell-cell interaction analysis of scRNA-seq data, cancer cells with low NPC2 expression exhibited ligand-receptor interactions of ANXA1 and FPR1/3, APP, and CD74 with osteoclasts, which may partially explain how NPC2 knockdown in LUAD cells contributes to osteoclastogenesis. As an important regulator of inflammation, ANXA1 has been shown to activate the NF-κB signaling pathway in various cell types through interaction with FPR1.41,42 Accordingly, these molecular interactions within the bone microenvironment warrant further validation and may provide insights into the mechanisms of bone-metastatic cancers.
Last but not least, the effects of NPC2 knockdown on cell viability varied among PC9, H1975, and A549 cells. In the literature on the mechanism of epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKI) resistance, it is recorded that compared with PC9 (EGFR exon 19-frame deletion mutation, EGFR-TKI sensitive) cells, H1975 (EGFR L858R/T790M mutation, EGFR-TKI resistant) and A549 (KRAS G12S mutation and EGFR wild type, EGFR-TKI resistant) cells developed resistance to erlotinib due to the enhanced autophagy and activation of the mTOR pathway.43,44 The enhanced autophagy in these two cell types may be impaired due to the lysosomal dysfunction caused by NPC2 knockdown, resulting in more pronounced apoptosis of these cells compared to PC9 cells. Therefore, we speculated that even if the mTOR/AKT pathway is activated in all NPC2-knockdown cells, cell proliferation will be severely affected by autophagy inhibition in H1975 and A549 cells.
In conclusion, our data demonstrate that low NPC2 expression promotes migration and invasion of lung cancer cells and enhances the capacity of their supernatant to stimulate osteoclast differentiation and maturation, ultimately driving osteolytic bone metastasis in LUAD. NPC2 represents a promising therapeutic target for the treatment of LUAD bone metastasis. Unlike existing therapies that target either tumor cells or osteoclasts, NPC2 simultaneously regulates both tumor cell invasion and osteoclast activation. Additionally, our findings suggest that NPC2 modulates lysosomal enzyme activity, highlighting its potential as a candidate for lysosome-dependent drug-delivery nanosystems to improve therapeutic efficacy in bone-metastatic cancers. These results encourage further investigations and potential clinical adoption of NPC2-targeted strategies in LUAD bone metastasis management.
Limitations of the study
This study has several limitations. First, the sample size of the clinical cohort was relatively small, making it difficult to perform subgroup analyses to fully elucidate the relationship between NPC2 expression and clinical characteristics of patients with LUAD. Second, since many evidences indicated that NPC2 may be involved in immune regulation,12,29 immunodeficient mice in this study cannot fully replicate the complexity of the human tumor immune microenvironment and may cause certain bias in the experimental results. Third, the study did not comprehensively explore the underlying molecular mechanisms. Although in vitro and in vivo experiments demonstrated that NPC2 may serve as a valuable prognostic marker and therapeutic target for LUAD bone metastasis, its clinical feasibility in humans requires further validation through well-designed preclinical and clinical studies.
Resource availability
Lead contact
Further information and requests for resources should be directed to the lead contact, Qiming Wang (qimingwang1006@126.com).
Materials availability
This study did not generate new, unique reagents.
Data and code availability
-
•
Raw sequence data were obtained from the study of Hou J B et al.16 Raw data of this article were deposited on Mendeley at https://doi.org/10.17632/mdyvs8pzfc.1.
-
•
This article does not report the original code.
-
•
Any additional information required to reanalyze the data reported in this article is available from the lead contact upon request.
Star★Methods
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-Niemann Pick C2 antibody | Abcam | RRID:AB_2941808 |
| D107/LAMP1 Monoclonal antibody | Proteintech | Cat# 67300-1-lg |
| Cathepsin B Polyclonal antibody | Proteintech | RRID:AB_2086929 |
| Cathepsin D Polyclonal antibody | Proteintech | RRID:AB_10733646 |
| Anti-NF-kB p65 antibody | Abcam | RRID:AB_776751 |
| Anti-NF-kB p65 (phospho S536) antibody | Abcam | RRID:AB_1524028 |
| mTOR(7C10) Rabbit mAb | Cell Signaling Technology | RRID:AB_2105622 |
| Phospho-mTOR (Ser2448) (D9C2) XP® Rabbit mAb | Cell Signaling Technology | RRID:AB_10691552 |
| Akt (pan) (11E7) Rabbit mAb | Cell Signaling Technology | RRID:AB_2225340 |
| Phospho-Akt (Ser473) (D9E) XP® Rabbit mAb | Cell Signaling Technology | RRID:AB_2315049 |
| Biological samples | ||
| Patient-derived primary and metastatic tumor tissues | Hena Cancer Hospital | – |
| Patient-derived blood sample | Hena Cancer Hospital | – |
| Chemicals, peptides, and recombinant proteins | ||
| FBS | Moregate bitech | FBS500 |
| Recombinant Murine M-CSF | PEPROTECH | #315-2 |
| Recombinant Murine sRANK Ligand | PEPROTECH | #315-11 |
| Torin 2 | MCE | HY-13002 |
| TRIeasyTM Total RNA extraction reagent | YEASEN | 10606ES60 |
| Hifair® III 1st Strand cDNA Synthesis SuperMix for qPCR | YEASEN | 11141ES60 |
| Hieff® qPCR SYBR® Green Master Mix (Low Rox Plus) | YEASEN | 11202ES08 |
| Critical commercial assays | ||
| Cell Counting Kit-8 | US EVERBRIGHT | C6005M |
| TRAP Stain Kit | Solarbio | G1492 |
| FITC Phalloidin | YEASEN | 40735ES75 |
| TRME | Beyotime | C2001S |
| Free Cholesterol(FC)Content Assay Kit | Applygen | E1016 |
| NPC2 ELISA Kit | MEIMIAN | MM-62563H1 |
| Deposited data | ||
| Raw sequence data | Hou J B et al.16 | – |
| Raw data | This paper | Mendeley Data: https://doi.org/10.17632/mdyvs8pzfc.1 |
| Experimental models: Cell lines | ||
| A549 | National Collection of Authenticated Cell Cultures | SCSP-503 |
| PC9 | National Collection of Authenticated Cell Cultures | SCSP-5085 |
| H1975 | National Collection of Authenticated Cell Cultures | SCSP-597 |
| RAW264.7 | ATCC | TIB-71 |
| Experimental models: Organisms/strains | ||
| BALB/cA-nu Mice | BEIJING HFK BIOSCIENCE | – |
| Oligonucleotides | ||
| Human NPC2 qPCR primer Forward | CAAAGGACAGTCTTACAGCGT | – |
| Human NPC2 qPCR primer Reverse | GGATAGGGCAGTTAATTCCACTC | – |
| Mouse Actb qPCR primer Forward | TGTGATGGTGGGAATGGGTCAG | – |
| Mouse Actb qPCR primer Reverse | TTTGATGTCACGCACGATTTCC | – |
| Mouse Trap qPCR primer Forward | GCTGGAAACCATGATCACCT | – |
| Mouse Trap qPCR primer Reverse | GAGTTGCCACACAGCATCAC | – |
| Mouse Ctsk qPCR primer Forward | GAAGAAGACTCACCAGAAGCAG | – |
| Mouse Ctsk qPCR primer Reverse | TCCAGGTTATGGGCAGAGATT | – |
| NPC2 shRNA | OBIO | – |
| shRNA targeting sequence: NPC2: AGTGGCAACTTCAGGATGA | This paper | – |
| Recombinant DNA | ||
| LV-NPC2 | Genechem | 31539–1 |
| Software and algorithms | ||
| ImageJ | Open source | – |
| GraphPad Prism | GraphPad | – |
| GEPIA2 | GEPIA 2 | – |
| LinkedOmics | LinkedOmics | – |
| CeleScope v1.9.0 | https://github.com/singleron-RD/CeleScope | – |
| RStudio | RStudio Inc. | RStudio Desktop - Posit |
| FeatureCounts v2.0.1 | Subread | http://subread.sourceforge.net |
| clusterProfiler | Yu G et al.45 | http://bioconductor.org/packages/release/bioc/html/clusterProfiler.html |
| Molecular signature database (MsigDB v7.3) | GSEA | MSigDB46 | – |
| InferCNV package | Kumar M et al.47 | https://github.com/broadinstitute/InferCNV |
| CellPhoneDB v2.1.0 | Efremova M et al.48 | https://github.com/Teichlab/cellphonedb. |
Experimental model and study participant details
Samples for scRNA-seq analysis
The ScRNA-seq data, obtained from the study by Hou J B et al.,16 were derived from primary tumor tissues or bone metastatic tissues of six patients (No. L-00, L-03, L-05, L-07, L-08, L-09) in the respiratory department of the Affiliated Cancer Hospital of Zhengzhou University. All patients were pathologically diagnosed as lung cancer. PT group was the primary tumor tissues of lung cancer without metastasis; MPT group was primary tumor tissues of lung cancer with bone metastasis; MT group was the bone metastatic tissues. The information of the samples was detailed in Table S1. The study protocol was approved by the Ethical Review Committee of the Affiliated Cancer Hospital of Zhengzhou University (Grant No.2022-KY-0069-001).
Clinical samples
15 cases of tissues specimens (5 cases of primary lesions, 5 cases of bone metastasis tissue and 5 cases of other metastasis tissue) for IHC staining and blood specimens of LUAD (lung adenocarcinoma) for ELISA were obtained from an existing collection. For Survival analysis, blood samples of metastatic LUAD received initial treatment in our hospital from September 1st to 30th, 2022 were collected. We tested NPC2 concentration in the serum of LUAD patients in our hospital by ELISA and investigated their prognoses with NPC2. Screening criteria: patients who informed consent with complete clinical data and pathological diagnosis as LUAD; without other tumors, the life expectancy was no less than 3 months; No serious cardiovascular, cerebrovascular and other diseases, ECOG score no more than 1. Exclusion Criteria: patients who lost to follow-up and died from other reasons. The experimental protocol and procedures were approved by the Ethics Committee of the Hena Tumor Hospital, Zhengzhou, China (Grant No. 2021-KY-0233).
Animal model
Female 4- to 5-week-old BALB/cA-nude mice (BEIJING HFK BIOSCIENCE, China) were housed under pathogen-free environment. All animal procedures were approved by and performed in accordance with the guidelines of the Experimental Animal Welfare Ethics Committee, School of Medical Sciences, Zhengzhou University (Grant No. ZZU-LAC20230804[22]).
Method details
Raw scRNA-seq data processing
We utilized Seurat v3.1.2 for dimensionality reduction and clustering with the raw sequence data. Gene expression data were normalized and scaled using the NormalizeData and ScaleData functions. A subset of the top 2000 highly variable genes was selected for principal component analysis using the FindVariableFeatures function. Based on the top 20 principal components, we applied the FindClusters function and UMAP algorithm to cluster and visualize the cells in two-dimensional space, respectively.
Differentially expressed gene (DEG) analysis and cell type annotation
Based on Wilcox likelihood ratio test, we filtered out genes below a minimum log-fold change threshold of 0.25 and infrequently (10% of cells) expressed genes via the FindMarkers function of Seurat. The annotations of cell identity on each cluster were defined by combining the SynEcoSys database and literatures.
Pathway enrichment analysis
We conducted the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis with “clusterProfiler” R package 3.16.1.45 Pathways with p_adj value less than 0.05 were considered as significantly enriched. We performed pathway analysis of Hallmark gene set described in Molecular signature database (MsigDB v7.3)46 between NPC2 low-expression and high-expression groups. The gene set enrichment score (UCell) based on the ranking of gene expression by single cells was calculated using Mann-Whitney U statistics.
Pseudo-time trajectory analysis
To investigate tumor cell development, we utilized Monocle 2 to reconstruct the cell differentiation trajectory based on highly variable genes. We utilized DDRTree to perform FindVairableFeatures and dimension-reduction analysis and the plot_cell_trajectory function to visualize the trajectory.
Copy number variations (CNVs) analysis
We utilized the InferCNV package47 to depict the patterns of chromosomal CNVs in distinct groups of tumor epithelial cells, using macrophages as the reference. The initial matrix of cellular gene expression was normalized, and the differential gene expression between tumor cells and reference cells was computed. A slide window size of 101 genes was used to smoothen the relative expression on each chromosome, to remove the effect of gene-specific expression. Relative expression values were centered at 1, with 1.5 standard deviations from the mean of the normalized expression values serving as the upper threshold.
Cell-cell interaction analysis
The cell-cell interaction analysis was performed by CellPhoneDB v2.1.047,48 based on known receptor-ligand interactions between subsets of tumor cells and macrophages. Cluster labels of all cells were randomly permuted 1000 times to calculate the null distribution of average ligand-receptor expression levels of the interacting clusters. Individual ligand or receptor expression was filtered using a cutoff derived from the average log gene expression distribution across all cell types. The significant cell-cell interactions were considered significant if the p value <0.05 and the average log expression exceeded 0.1, visualized using the circlize v0.4.10 R package.
Public databases for gene screening and prognostic analysis
The GSEA database was used to inquire the lysosomal gene set (https://www.gsea-msigdb.org/gsea/msigdb/cards/LYSOSOME). Public databases GEPIA2 (Gene Expression Profiling Interactive Analysis) (http://gepia2.cancer-pku.cn/) and LinkedOmics (http://www.linkedomics.org) are utilized to search for the prognostic significance of NPC2 expression in NSCLC.
Immunohistochemical (IHC) staining
Fifteen tissue specimens (five primary lesions, five bone metastases, and five other metastatic tissues) for IHC staining were obtained from an existing collection approved by the Ethics Committee of the Hena Tumor Hospital. Paraffin-embedded pathological tissues were sectioned at a thickness of 4 μm. Tissue sections were deparaffinized in xylene, rehydrated through a graded ethanol series, and treated with 3% H2O2 to block endogenous peroxidase activity. Hematoxylin and eosin (H&E) and immunoenzyme labeling were performed following standard protocols. The primary antibody was Anti-Niemann Pick C2 antibody (ab218192, Abcam, UK). Immunohistochemistry (IHC) scores for tumor NPC2 staining were obtained by multiplying the percentage of positive cells (p = 0, no positive cells; p = 1, 1%–25% positive cells; p = 2, 25%–50% positive cells; p = 3, 50%–75% positive cells; p = 4, >75% positive cells) by the staining intensity (I = 0–3). Two pathologists independently evaluated the sections in a blinded manner, and the scores were averaged.
ELISA
The blood samples were centrifugated to obtain serum. Then the levels of NPC2 in the serum specimen were detected using ELISA kit (Meimian Industrial, Yancheng, China) according to the manufacturer’s instructions. The optical density (OD) at 450 nm was measured by the absorbance microplate reader (Tecan Sunrise, Männedorf, Switzerland).
Survival analysis
We investigated the role of serum NPC2 in the prognosis of LUAD patients. After screening the clinical data, 40 patients were eligible for this study. A 2-year follow-up was implemented, with subsequent contact via telephone every six months to gather data on subsequent therapies and survival status until either loss to follow-up or death. Overall survival of the LUAD patients was the endpoint of this study. By generating Kaplan-Meier survival curves, we compared the survival outcomes of different groups of patients.
Cell culture and transfection
Human LUAD cell lines A549, PC9, and H1975 were purchased from the Cell Resource Center of Shanghai Institutes for Biological Sciences, China, and cultured in the RPMI 1640 medium (BasalMedia, Shanghai, China) supplemented with 10% FBS (Moregate bitech, BNE, Australia) 100 U/mL penicillin and 0.1 mg/mL streptomycin. Mouse RAW264.7 cells were purchased from China Center for Type Culture Collection and cultured in DMEM medium (Gibco, USA) supplemented with 10% FBS, 100 U/mL penicillin, and 0.1 mg/mL streptomycin. Cells were transfected with lentivirus carrying the pcSLenti-U6-shRNA-EF1-Luc2-F2A-Puro-WPRE (OBiO, China) and Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin plasmids respectively (Genechem, China). The sequence of shRNA was: sh-NPC2: AGTGGCAACTTCAGGATGA; the negative control sequence (NC) was: CCTAAGGTTAAGTCGCCCTCG. Then cell lines were selected by adding puromycin to the culture medium to establish the stable polyclonal LUAD cell lines with NPC2 silencing (shR) and overexpression (OE), and their corresponding controls (shR-NC, OE-NC).
CCK-8 assay
To evaluate the proliferation ability of A549/PC9/H1975 cells with NPC2 knockdown and overexpression. We used CCK-8 reagent (US EVERBRIGHT, Suzhou, China) to detect the OD (absorbance) of each well at 450 nm between shR and shR-NC groups at 0 h (8 h post cell seeding in the 96well plate), 24 h, 48 h, 72 h, and 96 h, at these time points.
Clone formation assay
Cells in shR, shR-NC groups were plated into 6 well plates (800 cells/well) and incubated at 37°C for 7–9 days. Clones were stained with 0.4% crystal violet. Colony areas were measured and quantified.
Wound-healing assay
Cells in shR, shR-NC groups were seeded into 6 well plates at 80% confluence. After 24 h, we used 200 μL pipette tip to create scratch wounds and captured image marked as 0 h. Cells were continued to culture with serum-free medium and recoded with images at 24 h, 48 h and 72 h, respectively.
Transwell assay
5×104 lung cancer cells in shR, shR-NC groups resuspend in 200 μL 0.1% serum medium were placed into upper chamber with 8 μm pores of 24-well plate (Corning, NY, USA). The lower chamber was filled with 600 μL of cell culture medium containing 20% FBS. After 24 h, the cells were fixed with 4% paraformaldehyde and stained with 0.4% crystal violet. For cancer cell invasion assay, the upper chamber was plated with 80 μL Matrigel (1:5 diluted with serum-free medium) (Corning, 356234) and the remaining unchanged.
Cell free cholesterol testing
To find whether the change of NPC2 in cancer cells led to the abnormal transport of free cholesterol, we measured the cellular free cholesterol concentrations in shR, shR-NC, OE, OE-NC groups respectively according to the manufacturer’s instructions (Applygen, China). Specifically, the cells in 6-well culture plate were washed with PBS and then added with lysis buffer. Prepared the working solution and serially diluted the cholesterol standard. Incubated 10 μL the supernatant of the lysate with 190 μL working solution in 96-well culture plate for 37°C. After 20 min, the OD values were measured at 550 nm using a multimode microplate reader (Thermo Fisher, Waltham, MA, USA). Normalized to the protein concentration and compared among the groups.
Immunofluorescence staining
To assess cathepsin localization, cells were fixed with 4% paraformaldehyde and permeabilized using Triton X-100 (Beyotime, shanghai, China). The cells were incubated with LAMP1 Monoclonal antibody and Cathepsin B Polyclonal antibody (Proteintech, China), Cy3-labeled Goat Anti-Rabbit IgG (Beyotime) and Cy5 goat-anti-rat-IgG (Invitrogen, Carlsbad, USA) were used as the fluorescent dye for detecting. And Nuclei were counterstained with DAPI (YEASEN, China). Images were captured using a laser confocal microscope (Nikon, Japan).
Mitochondrial membrane potential (Δψm) assay
For Δψm assay, cells of each group were loaded with the potentiometric dye 500 nM TMRE (Beyotime) at 37°C for 30 min and cells were treated with Carbonyl Cyanide m-Chlorophenylhydrazone (CCCP) ahead for positive control group. Staining was observed using a fluorescence microscope (Olympus, Japan) and analyzed by flow cytometry (Agilent NOVOCYTE 3080, Agilent, USA; BD FACSCalibur, Franklin Lakes, USA) following washing. The excitation wavelength for detection was 550 nm. Flow cytometry data were processed using FlowJo V10.
Quantitative real-time PCR
TRIeasyTM total RNA extraction reagent, Hifair Ⅲ 1st strand cDNA synthesis
SuperMix for qPCR, and Hieff qPCR SYBR Green Master Mix were purchased from YEASEN Biotechnology (Shanghai, China). We performed RNA expression analysis according to the manufacturer’s instructions. The following primer sequenceswere used: Human GAPDH: forward, 5′-TGAGATCCAGAGTTGTCGTACA-3′, reverse, 5′-CACCCTGTTGCTGTAGCCAAA-3’; Human NPC2: forward, 5′-CAAAGGACAGTCTTACAGCGT-3′, reverse, 5′-GGATAGGGCAGTTAATTCCACTC-3’; Mouse Actb: forward, 5′-TGTGATGGTGGGAATGGGTCAG-3′, reverse, 5′-TTTGATGTCACGCACGATTTCC-3’; Mouse Ctsk: forward, 5′-GAAGAAGACTCACCAGAAGCAG-3′, reverse, 5′-TCCAGGTTATGGGCAGAGATT-3’; Mouse Trap: forward, 5′-GCTGGAAACCATGATCACCT-3′, reverse, 5′-GAGTTGCCACACAGCATCAC-3’.The expression of each gene was calculated based on the cycle threshold (CT), relative quantitative analysis F = 2ˆ - ΔΔCt; ΔCT = CT value of target gene -CT value of internal reference gene; 2ˆ - ΔΔCt reflected the relative expression level of target gene in each sample compared with that in NC group.
Western blot analysis
Total protein was extracted from cells using RIPA lysis buffer supplemented with PMSF, phosphatase, and protease inhibitors (Beijing leagene biotech, China). Subsequently, the protein concentration was measured using a BCA protein assay kit following the standard protocol. loading buffer was added to the protein samples, and the mixtures were boiled for 5 min. A total of 30 μg of protein was separated by 10% SDS-PAGE, transferred to PVDF membrane (Millipore, Burlington, USA), and blocked with 5% nonfat milk for 2 h at room temperature. After that, the PVDF membranes were incubated with primary antibodies overnight at 4°C followed by probing with horseradish peroxidase (HRP)-conjugated secondary antibodies for 2 h at room temperature. Protein bands were detected by enhanced ECL detection reagent (Applygen) and the Ultra-sensitive automatic imaging analysis system (Biolight Biotechnology, Guangzhou, China). ImageJ software was used to compare the gray values of the protein bands across different groups. The primary antibodies used were as follows: NPC2, Cathepsin B and D Polyclonal antibodies GAPDH Monoclonal antibody (Proteintech); Anti-NF-kB P65 and Anti-NF-kB P65 (phospho S536) antibodies (Abcam); mTOR(7C10) and Phospho-mTOR Rabbit (ser2448) mAb, AKT Rabbit mAb and Phospho-Akt (Ser473) Rabbit mAb (CST, Danvers, USA).
Osteoclast differentiation and function assay
In order to observe the influence of NPC2 knockdown cancer cell on osteoclast differentiation, we used conditioned medium that added 20 ng/mL RANKL (PEPROTECH, Cranbury, USA) and 20 ng/mL M-CSF (PEPROTECH) to culture RAW264.7 cells. The conditioned medium (CM) was prepared as follow: A549 and PC9 (2×106) were seed in 10 cm cell-culture dishes, after 24 h, changed with 7 mL serum-free medium and continued to culture another 24 h. Then, we collected the supernatant, which was centrifuged at 2500 rpm for 10 min and filtered through a 0.22 μm filter. 800 μL DMEM+12.5% FBS mixed with 200 μL cancer cell (with or without NPC2 knock-down) supernatant was used as CM to culture RAW264.7 cells (2×105 per well) in the 12-well culture plate. For the positive control, RAW264.7 cells were cultured with 800 μL of DMEM containing 12.5% FBS mixed with 200 μL of RPMI 1640 medium.
On day 10, the medium was removed. Then, the cells in 12-well culture plate stained for TRAP kit (Solarbio, China) according to manufacturer protocol. TRAP-positive multinucleated cells containing three or more nuclei were counted as osteoclasts under a light microscope. Besides, we performed fibrous actin (F-actin) immunofluorescence assay for osteoclast function test. The cells were fixed with 4% paraformaldehyde for 15 min. Following this, 0.1% Triton X-100 was added to enhance cell permeability for 20 min before cell incubation with FITC Phalloidin (YEASEN) in a light-blocked space for 30 min. The cells were counterstained with Hoechst for 5 min in the dark at room temperature. Images were acquired using a fluorescence microscope (Olympus, Japan).
Animal experiment
Female 4- to 5-week-old BALB/cA-nude mice were housed under pathogen-free environment. After a week of acclimatization, mice were randomly assigned to different groups for tibial implantation of PC9 cells. Each mouse received 1 × 106 cells suspended in 30 μL of PBS. Specifically, the right hindlimb was flexed at 90°. Following local sterilization, a 1 mL syringe needle was inserted through the proximal tibial plateau into the proximal tibia. The cell suspension was then slowly injected, and the needle was withdrawn shortly afterward. The contralateral tibia of each mouse served as a negative control and was injected with 30 μL of PBS.
Mice were radiographically imaged weekly by panoramic X-ray imaging analyzer (PINGSENG SCIENTIFIC, Shanghai, China) to evaluate the bone metastases in the whole tibia. The lytic bone lesions were quantified blinded using ImageJ software to measure their areas. Surgically harvested tibia tissues were fixed in 4% paraformaldehyde for 7 days, decalcified in 10% EDTA for 2 weeks, and embedded in paraffin. Specimens were sectioned at 5 μm thickness. Sections were stained with H&E for histomorphometric analysis of tumor burden and with TRAP for osteoclast detection. IHC staining was used to evaluate NPC2 expression in bone metastases across all groups.
Quantification and statistical analysis
ImageJ software was utilized for image processing; GraphPad Prism 10.4 and SPSS 22.0 were employed for generating graphs and conducting statistical analyses. Quantitative data were presented as mean ± SD or median (minimum, maximum) if the data did not follow a normal distribution. Statistical significance was assessed using Student’s t tests or the Wilcoxon rank-sum test for two group comparisons and ANOVA for multiple comparisons. Kaplan-Meier log rank test were used to perform survival analysis. All tests were two-sided, and statistical significance was defined as a p value less than 0.05 (∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001).
Acknowledgments
This research project was supported by the following funding sources: 1. Henan provincial Medical Science and Technology Research Project (LHGJ20210194); 2. Overseas training program of Henan Medical Science and Technology Talents (HNMOT2024065); 3. Henan Province Health and Youth Subject Leader Training Project ([2020]60); 4. Leading Talent Cultivation Project of Henan Health Science and Technology Innovation Talents (YXKC2020009); 5. ZHONGYUAN QIANREN JIHUA (ZYQR201912118); 6. Henan International Joint Laboratory of drug resistance and reversal of targeted therapy for lung cancer ([2021]10); 7. Henan Medical Key Laboratory of Refractory Lung Cancer ([2020]27); 8. Henan Refractory Lung Cancer Drug Treatment Engineering Technology Research Center ([2020]4); 9. Key Research and Development Projects of Henan Province in 2023 (Project No. 231111313300).
Author contributions
Conceptualization, Q.W. and S.Z.; data curation: S.Z. and N.L.; methodology, N.L., S.Z., and Y. Zhu.; formal analysis, N.L., Y.P., and R.L.; writing – original draft, S.Z. and R.L.; writing – review and editing, Y.D. and Q.W.; resources, Q.W. and H.Y.; visualization, Y.L. and Y.Z.; supervision, Q.W. and H.Y.; funding acquisition, Q.W., H.Y., and S.Z. H.Y. and Q.W. had unrestricted access to all data. All authors approved the final article and take full responsibility for its content.
Declaration of interests
The authors declare no competing interests.
Published: February 13, 2026
Footnotes
Supplemental information can be found online at https://doi.org/10.1016/j.isci.2026.115017.
Contributor Information
Hui Yang, Email: zlyyyanghui0495@zzu.edu.cn.
Qiming Wang, Email: qimingwang1006@126.com.
Supplemental information
References
- 1.Siegel R.L., Giaquinto A.N., Jemal A. Cancer statistics, 2024. CA Cancer J. Clin. 2024;74:12–49. doi: 10.3322/caac.21820. [DOI] [PubMed] [Google Scholar]
- 2.Meyer M.L., Fitzgerald B.G., Paz-Ares L., Cappuzzo F., Jänne P.A., Peters S., Hirsch F.R. New promises and challenges in the treatment of advanced non-small-cell lung cancer. Lancet. 2024;404:803–822. doi: 10.1016/S0140-6736(24)01029-8. [DOI] [PubMed] [Google Scholar]
- 3.Niu Y., Yang H., Yu Z., Gao C., Ji S., Yan J., Han L., Huo Q., Xu M., Liu Y. Intervention with the Bone-Associated Tumor Vicious Cycle through Dual-Protein Therapeutics for Treatment of Skeletal-Related Events and Bone Metastases. ACS Nano. 2022;16:2209–2223. doi: 10.1021/acsnano.1c08269. [DOI] [PubMed] [Google Scholar]
- 4.Xue M., Ma L., Zhang P., Yang H., Wang Z. New insights into non-small cell lung cancer bone metastasis: mechanisms and therapies. Int. J. Biol. Sci. 2024;20:5747–5763. doi: 10.7150/ijbs.100960. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Hu J., Zhang J., Wan S., Zhang P. Neoadjuvant immunotherapy for non-small cell lung cancer: Opportunities and challenges. Chin. Med. J. Pulm. Crit. Care Med. 2024;2:224–239. doi: 10.1016/j.pccm.2024.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Lan H., Wu B., Jin K., Chen Y. Beyond boundaries: unraveling innovative approaches to combat bone-metastatic cancers. Front. Endocrinol. 2023;14 doi: 10.3389/fendo.2023.1260491. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Trybus W., Trybus E., Król T. Lysosomes as a Target of Anticancer Therapy. Int. J. Mol. Sci. 2023;24 doi: 10.3390/ijms24032176. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Meng Y., Heybrock S., Neculai D., Saftig P. Cholesterol Handling in Lysosomes and Beyond. Trends Cell Biol. 2020;30:452–466. doi: 10.1016/j.tcb.2020.02.007. [DOI] [PubMed] [Google Scholar]
- 9.Wang Y.H., Twu Y.C., Wang C.K., Lin F.Z., Lee C.Y., Liao Y.J. Niemann-Pick Type C2 Protein Regulates Free Cholesterol Accumulation and Influences Hepatic Stellate Cell Proliferation and Mitochondrial Respiration Function. Int. J. Mol. Sci. 2018;19 doi: 10.3390/ijms19061678. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Liedtke M., Völkner C., Hermann A., Frech M.J. Impact of Organelle Transport Deficits on Mitophagy and Autophagy in Niemann-Pick Disease Type C. Cells. 2022;11:507. doi: 10.3390/cells11030507. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Schrantz N., Sagiv Y., Liu Y., Savage P.B., Bendelac A., Teyton L. The Niemann-Pick type C2 protein loads isoglobotrihexosylceramide onto CD1d molecules and contributes to the thymic selection of NKT cells. J. Exp. Med. 2007;204:841–852. doi: 10.1084/jem.20061562. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Lu W., Li D., Tao F., Chen Q., Fan S., Ma Y., Dong H., Hu Y., Yue C. Exploration of NPC2 as a Potential Biomarker for Immunotherapy Using RNA-seq and Protein Data - A New Hypothesis. Endocr., Metab. Immune Disord.: Drug Targets. 2023;23:1340–1353. doi: 10.2174/1871530323666230413112614. [DOI] [PubMed] [Google Scholar]
- 13.Taguchi A., Politi K., Pitteri S.J., Lockwood W.W., Faça V.M., Kelly-Spratt K., Wong C.H., Zhang Q., Chin A., Park K.S., et al. Lung cancer signatures in plasma based on proteome profiling of mouse tumor models. Cancer Cell. 2011;20:289–299. doi: 10.1016/j.ccr.2011.08.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Kamata T., Jin H., Giblett S., Patel B., Patel F., Foster C., Pritchard C. The cholesterol-binding protein NPC2 restrains recruitment of stromal macrophage-lineage cells to early-stage lung tumours. EMBO Mol. Med. 2015;7:1119–1137. doi: 10.15252/emmm.201404838. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Liu X., Lv M., Zhang W., Zhan Q. Dysregulation of cholesterol metabolism in cancer progression. Oncogene. 2023;42:3289–3302. doi: 10.1038/s41388-023-02836-x. [DOI] [PubMed] [Google Scholar]
- 16.Hou J B. The Single-Cell Landscape of the Tumor Microenvironment in Bone Metastasis of Lung Cancer [D]. Henan: Zhengzhou University,2023
- 17.Wallbillich N.J., Lu H. Role of c-Myc in lung cancer: Progress, challenges, and prospects. Chin. Med. J. Pulm. Crit. Care Med. 2023;1:129–138. doi: 10.1016/j.pccm.2023.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Nie M., Chen N., Pang H., Jiang T., Jiang W., Tian P., Yao L., Chen Y., DeBerardinis R.J., Li W., et al. Targeting acetylcholine signaling modulates persistent drug tolerance in EGFR-mutant lung cancer and impedes tumor relapse. J. Clin. Investig. 2022;132 doi: 10.1172/JCI160152. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Tanaka K., Yu H.A., Yang S., Han S., Selcuklu S.D., Kim K., Ramani S., Ganesan Y.T., Moyer A., Sinha S., et al. Targeting Aurora B kinase prevents and overcomes resistance to EGFR inhibitors in lung cancer by enhancing BIM- and PUMA-mediated apoptosis. Cancer Cell. 2021;39:1245–1261.e6. doi: 10.1016/j.ccell.2021.07.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Sethi N., Dai X., Winter C.G., Kang Y. Tumor-derived JAGGED1 promotes osteolytic bone metastasis of breast cancer by engaging notch signaling in bone cells. Cancer Cell. 2011;19:192–205. doi: 10.1016/j.ccr.2010.12.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Garbe A.I., Roscher A., Schüler C., Lutter A.H., Glösmann M., Bernhardt R., Chopin M., Hempel U., Hofbauer L.C., Rammelt S., et al. Regulation of bone mass and osteoclast function depend on the F-actin modulator SWAP-70. J. Bone Miner. Res. 2012;27:2085–2096. doi: 10.1002/jbmr.1670. [DOI] [PubMed] [Google Scholar]
- 22.Wang Y., Engel T., Teng X. Post-translational regulation of the mTORC1 pathway: A switch that regulates metabolism-related gene expression. Biochim. Biophys. Acta. Gene Regul. Mech. 2024;1867 doi: 10.1016/j.bbagrm.2024.195005. [DOI] [PubMed] [Google Scholar]
- 23.Islam M., Jones S., Ellis I. Role of Akt/Protein Kinase B in Cancer Metastasis. Biomedicines. 2023;11 doi: 10.3390/biomedicines11113001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Castellano B.M., Thelen A.M., Moldavski O., Feltes M., van der Welle R.E.N., Mydock-McGrane L., Jiang X., van Eijkeren R.J., Davis O.B., Louie S.M., et al. Lysosomal cholesterol activates mTORC1 via an SLC38A9-Niemann-Pick C1 signaling complex. Science. 2017;355:1306–1311. doi: 10.1126/science.aag1417. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Morse P.T., Arroum T., Wan J., Pham L., Vaishnav A., Bell J., Pavelich L., Malek M.H., Sanderson T.H., Edwards B.F.P., Hüttemann M. Phosphorylations and Acetylations of Cytochrome c Control Mitochondrial Respiration, Mitochondrial Membrane Potential, Energy, ROS, and Apoptosis. Cells. 2024;13:493. doi: 10.3390/cells13060493. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Alvarez-Valadez K., Sauvat A., Diharce J., Leduc M., Stoll G., Guittat L., Lambertucci F., Paillet J., Motiño O., Ferret L., et al. Lysosomal damage due to cholesterol accumulation triggers immunogenic cell death. Autophagy. 2025;21:934–956. doi: 10.1080/15548627.2024.2440842. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kuang F., Liu J., Li C., Kang R., Tang D. Cathepsin B is a mediator of organelle-specific initiation of ferroptosis. Biochem. Biophys. Res. Commun. 2020;533:1464–1469. doi: 10.1016/j.bbrc.2020.10.035. [DOI] [PubMed] [Google Scholar]
- 28.Kreuzaler P.A., Staniszewska A.D., Li W., Omidvar N., Kedjouar B., Turkson J., Poli V., Flavell R.A., Clarkson R.W.E., Watson C.J. Stat3 controls lysosomal-mediated cell death in vivo. Nat. Cell Biol. 2011;13:303–309. doi: 10.1038/ncb2171. [DOI] [PubMed] [Google Scholar]
- 29.Wang Z.M., Ning Z.L., Ma C., Liu T.B., Tao B., Guo L. Low expression of lysosome-related genes KCNE1, NPC2, and SFTPD promote cancer cell proliferation and tumor associated M2 macrophage polarization in lung adenocarcinoma. Heliyon. 2024;10 doi: 10.1016/j.heliyon.2024.e27575. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Adachi T., Matsumoto Y., Inagaki Y., Sekimizu K. Niemann-Pick disease type C2 protein induces autophagy and inhibits growth in FM3A breast cancer cells. Drug Discov. Ther. 2015;9:282–288. doi: 10.5582/ddt.2015.01014. [DOI] [PubMed] [Google Scholar]
- 31.Liao Y.J., Fang C.C., Yen C.H., Hsu S.M., Wang C.K., Huang S.F., Liang Y.C., Lin Y.Y., Chu Y.T., Arthur Chen Y.M. Niemann-Pick type C2 protein regulates liver cancer progression via modulating ERK1/2 pathway: Clinicopathological correlations and therapeutical implications. Int. J. Cancer. 2015;137:1341–1351. doi: 10.1002/ijc.29507. [DOI] [PubMed] [Google Scholar]
- 32.Wei D., Shen S., Lin K., Lu F., Zheng P., Wu S., Kang D. NPC2 as a Prognostic Biomarker for Glioblastoma Based on Integrated Bioinformatics Analysis and Cytological Experiments. Front. Genet. 2021;12 doi: 10.3389/fgene.2021.611442. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Yao Y., Ren J., Lu J., Sui Y., Gong J., Chen X. Prognostic significance of high NPC2 expression in gastric cancer. Sci. Rep. 2023;13 doi: 10.1038/s41598-023-47882-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Geng F., Zhong Y., Su H., Lefai E., Magaki S., Cloughesy T.F., Yong W.H., Chakravarti A., Guo D. SREBP-1 upregulates lipophagy to maintain cholesterol homeostasis in brain tumor cells. Cell Rep. 2023;42 doi: 10.1016/j.celrep.2023.112790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Zheng H., Cheng Z.J., Liang B., Wang Z.G., Tao Y.P., Huang S.Y., Ni J.S., Li H.F., Yang L., Yuan S.X., et al. N6-Methyladenosine Modification of ANLN Enhances Hepatocellular Carcinoma Bone Metastasis. Int. J. Biol. Sci. 2023;19:1009–1023. doi: 10.7150/ijbs.73570. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Praharaj P.P., Patra S., Singh A., Panigrahi D.P., Lee H.Y., Kabir M.F., Hossain M.K., Patra S.K., Patro B.S., Patil S., et al. CLU (clusterin) and PPARGC1A/PGC1α coordinately control mitophagy and mitochondrial biogenesis for oral cancer cell survival. Autophagy. 2024;20:1359–1382. doi: 10.1080/15548627.2024.2309904. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Guo H., Zhao M., Qiu X., Deis J.A., Huang H., Tang Q.Q., Chen X. Niemann-Pick type C2 deficiency impairs autophagy-lysosomal activity, mitochondrial function, and TLR signaling in adipocytes. J. Lipid Res. 2016;57:1644–1658. doi: 10.1194/jlr.M066522. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Chen F., Xue Y., Zhang W., Zhou H., Zhou Z., Chen T., YinWang E., Li H., Ye Z., Gao J., Wang S. The role of mitochondria in tumor metastasis and advances in mitochondria-targeted cancer therapy. Cancer Metastasis Rev. 2024;43:1419–1443. doi: 10.1007/s10555-024-10211-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Deng R., Zhang H.L., Huang J.H., Cai R.Z., Wang Y., Chen Y.H., Hu B.X., Ye Z.P., Li Z.L., Mai J., et al. MAPK1/3 kinase-dependent ULK1 degradation attenuates mitophagy and promotes breast cancer bone metastasis. Autophagy. 2021;17:3011–3029. doi: 10.1080/15548627.2020.1850609. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Csepeggi C., Jiang M., Kojima F., Crofford L.J., Frolov A. Somatic cell plasticity and Niemann-Pick type C2 protein: fibroblast activation. J. Biol. Chem. 2011;286:2078–2087. doi: 10.1074/jbc.M110.135897. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Han P.F., Che X.D., Li H.Z., Gao Y.Y., Wei X.C., Li P.C. Annexin A1 involved in the regulation of inflammation and cell signaling pathways. Chin. J. Traumatol. (Engl. Ed.) 2020;23:96–101. doi: 10.1016/j.cjtee.2020.02.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Araújo T.G., Mota S.T.S., Ferreira H.S.V., Ribeiro M.A., Goulart L.R., Vecchi L. Annexin A1 as a Regulator of Immune Response in Cancer. Cells. 2021;10 doi: 10.3390/cells10092245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Hu Y., Zhang J., Liu Q., Ke M., Li J., Suo W., Guo W., Ma A. Torin2 inhibits the EGFR-TKI resistant Non-Small Lung Cancer cell proliferation through negative feedback regulation of Akt/mTOR signaling. J. Cancer. 2020;11:5746–5757. doi: 10.7150/jca.37417. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Wang Z., Du T., Dong X., Li Z., Wu G., Zhang R. Autophagy inhibition facilitates erlotinib cytotoxicity in lung cancer cells through modulation of endoplasmic reticulum stress. Int. J. Oncol. 2016;48:2558–2566. doi: 10.3892/ijo.2016.3468. [DOI] [PubMed] [Google Scholar]
- 45.Yu G., Wang L.G., Han Y., He Q.Y. clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS. 2012;16:284–287. doi: 10.1089/omi.2011.0118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Liberzon A., Birger C., Thorvaldsdóttir H., Ghandi M., Mesirov J.P., Tamayo P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 2015;1:417–425. doi: 10.1016/j.cels.2015.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Kumar M., Bowers R.R., Delaney J.R. Single-cell analysis of copy-number alterations in serous ovarian cancer reveals substantial heterogeneity in both low- and high-grade tumors. Cell Cycle. 2020;19:3154–3166. doi: 10.1080/15384101.2020.1836439. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Efremova M., Vento-Tormo M., Teichmann S.A., Vento-Tormo R. CellPhoneDB: inferring cell-cell communication from combined expression of multi-subunit ligand-receptor complexes. Nat. Protoc. 2020;15:1484–1506. doi: 10.1038/s41596-020-0292-x. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
-
•
Raw sequence data were obtained from the study of Hou J B et al.16 Raw data of this article were deposited on Mendeley at https://doi.org/10.17632/mdyvs8pzfc.1.
-
•
This article does not report the original code.
-
•
Any additional information required to reanalyze the data reported in this article is available from the lead contact upon request.






