Discovery of Cetaben as a Novel Antiviral Agent Against Porcine Epidemic Diarrhea Virus From a Cholesterol‐Lowering Compound Library

Abstract

The devastating impact of porcine epidemic diarrhea virus (PEDV) on the global swine industry underscores an urgent need for effective antiviral therapies. Drug repurposing presents a promising strategy to accelerate the development of such treatments. In this study, we screened a custom‐designed library of 117 cholesterol‐lowering compounds for anti‐PEDV activity using a recombinant PEDV expressing enhanced green fluorescent protein (EGFP). Following two rounds of screening, four compounds exhibiting significant antiviral activity were identified. Among these, cetaben and digitonin displayed superior antiviral efficacy and higher selectivity indices. Subsequent dose–response analyses further confirmed that cetaben effectively suppresses viral replication in both classical and variant strains of PEDV. Time‐of‐addition assays revealed that cetaben exerts potent antiviral effects primarily at the preinfection stage by inhibiting viral internalization and syncytium formation. Notably, supplementation with exogenous cholesterol in infected cells completely abolished cetaben’s antiviral activity and restored viral infectivity, demonstrating that its anti‐PEDV mechanism is mediated through disruption of cellular cholesterol metabolism. Collectively, our findings identify cetaben, a cholesterol‐lowering agent, as a novel broad‐acting antiviral against PEDV with a host‐targeted mechanism of action. This study establishes a foundation for developing antiviral strategies that target cholesterol metabolism to combat PEDV and related coronaviruses.

1. Introduction

Coronaviruses are enveloped viruses characterized by nonsegmented, single‐stranded, positive‐sense RNA genomes. They infect a wide range of hosts, including humans, mammals, and birds, posing significant challenges to public health, veterinary medicine, and the global economy. To date, at least seven coronaviruses are known to infect humans: human coronavirus OC43 (HCoV‐OC43), NL63 (HCoV‐NL63), 229E (HCoV‐229E), HKU1 (HCoV‐HKU1), severe acute respiratory syndrome coronavirus (SARS‐CoV), Middle East respiratory syndrome coronavirus (MERS‐CoV), and the currently circulating SARS‐CoV‐2 [1]. In pigs, four major enteric coronaviruses cause diarrheal disease: porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV), and swine acute diarrhea syndrome coronavirus (SADS‐CoV) [1]. Among these, PEDV is the most prevalent enteric coronavirus in swine and remains the most detrimental to the pig industry [2]. Current PEDV strains are largely divided into classical (GI genotype) and variant (GII genotype) strains, which differ in molecular characteristics and pathogenic profiles [3]. It is noteworthy that the GII variant has emerged as a predominant circulating strain on a global scale since 2010 [3]. Critical mutations in the S protein mediate significant antigenic alterations, which not only strengthen the virus’s tropism for intestinal epithelial cells but also markedly diminish the protective efficacy of current vaccines [4]. Furthermore, the continuous recombination and evolution of these mutant strains introduce unprecedented complexity into outbreak control efforts. As a result, conventional intervention strategies are increasingly falling short in addressing the dynamically shifting viral landscape.

Currently, PEDV control primarily relies on the immunization of sows with inactivated or live attenuated vaccines to confer passive immunity to piglets. However, most currently available conventional inactivated and attenuated vaccines are not sufficiently effective at controlling PEDV or have an inadequate safety profile [5]. This challenge, compounded by the absence of highly effective antiviral drugs, substantially undermines our capacity to manage outbreaks effectively. The coronavirus replication cycle comprises multiple stages: cell entry, subgenomic RNA transcription, genome replication, translation of viral proteins, and progeny virion release [6]. A critical initial step is viral entry, which involves attachment to and penetration into host cells—processes essential for infectivity and pathogenesis [7]. The spike (S) protein embedded in the viral envelope mediates infection by binding to host‐specific receptors. Subsequent adsorption is followed by S protein priming through cleavage by host proteases, such as transmembrane serine protease 2 (TMPRSS2) at the cell surface or cathepsins B/L (CTSB/L) within endosomal/lysosomal compartments. This cleavage enables viral fusion and the release of genomic RNA into the cytoplasm [8]. The life cycle concludes with the egress of newly assembled virions via exocytosis or syncytia formation resulting from cell–cell fusion, ultimately leading to cell death [9]. Despite considerable research into coronavirus pathogenesis, the detailed mechanisms underlying productive infection remain incompletely elucidated.

As obligate intracellular parasites, viruses exploit host cellular machinery to complete their life cycles. Cholesterol, a key structural component of mammalian membranes, plays vital roles in regulating membrane rigidity, fluidity, permeability, and overall cellular function [10]. Viruses often disrupt cholesterol homeostasis and exploit cholesterol to facilitate various stages of infection [11]. This dependence is observed across diverse virus families, including both enveloped and nonenveloped viruses, as well as DNA and RNA viruses [12]. Numerous studies indicate that members of the Flaviviridae and Coronaviridae families rely heavily on cellular cholesterol for entry, replication, egress, and—in coronaviruses—pathological syncytia formation [13]. Moreover, cholesterol metabolism is intricately linked to the host antiviral innate immune response [14]. These insights have established targeting host cholesterol homeostasis as a promising broad‐spectrum antiviral strategy.

In light of the aforementioned challenges, the development of antiviral strategies that target critical host factors is anticipated to mitigate the risk of drug resistance arising from viral mutations. Cholesterol metabolism, as a crucial pathway for coronavirus infection, presents an optimal entry point for host‐directed therapies. Nevertheless, the development of cholesterol‐targeting inhibitors specifically against PEDV remains largely unexplored. To address this gap, we adopted a drug repurposing strategy by screening a library of clinically approved cholesterol‐lowering compounds for anti‐PEDV activity. This approach aimed to rapidly identify novel inhibitors capable of disrupting PEDV replication via modulation of cholesterol‐related pathways, thereby providing a foundation for host‐directed antiviral therapies against PEDV and related coronaviral infections.

2. Materials and Methods

2.1. Cell Culture and Virus

Vero and IPEC‐J2 cells, both within six passages, were maintained in our laboratory. All cells were cultured at 37°C under 5% CO₂ in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Rockville, USA) supplemented with 10% fetal bovine serum and 100 U/mL penicillin‐streptomycin. The PEDV strains DR13‐GFP, PEDV‐HW, PEDV‐CV777, and PEDV‐GDU were also maintained in our laboratory. All viruses, except DR13‐GFP, were propagated in Vero cells in the presence of 5 μg/mL trypsin (Lot#SLCK7359, Sigma–Aldrich).

2.2. Antiviral Drug Screening

Vero cells were seeded into 24‐well plates at a density of 1 × 10⁵ cells per well and incubated at 37°C for 24 h until a confluent monolayer formed. The cells were washed three times with sterile PBS. A library of 117 cholesterol‐lowering compounds was prepared at 10 μM in DMEM containing 100 U/mL penicillin‐streptomycin (TargetMol). Cells were treated with these compound mixtures and incubated for 12 h at 37°C under 5% CO₂. After washing with PBS, the cells were infected with 0.1 multiplicity of infection (MOI) of DR13‐GFP in the presence of 10 μM of each compound for 2 h. Following infection, the inoculum was removed, cells were washed, and treatment was continued with the corresponding compounds for an additional 12 h. Fluorescence images were acquired, and fluorescence intensity was quantified using ImageJ software. Compounds showing >60% inhibition were selected for a second round of screening at 2 μM. In the second round of screening, small molecules with inhibition rates greater than or equal to 80% were selected as screening targets.

2.3. Cell Viability Assay

Cytotoxicity of cetaben, aloe emodin, digitonin, and tert‐butyl pitavastatin on Vero and IPEC‐J2 cells was assessed using a cell counting kit‐8 (CCK‐8; Beyotime). Cells were seeded into 96‐well plates and cultured to confluence. Serial dilutions of each compound were applied in maintenance medium. After 48 h, the medium was replaced with fresh DMEM containing 10% CCK‐8 solution and incubated for 2 h. Absorbance was measured at 450 nm using a BMG LabTech PolarStar Omega microplate reader. Cell viability was calculated as follows: viability (%) = [(OD_sample – OD_blank)/(OD_control – OD_blank)] × 100.

2.4. Cytopathic Effect Reduction Assay

Vero or IPEC‐J2 cells were seeded into 24‐well plates at 1 × 10⁵ cells per well and cultured for 24 h. Cells were treated with cetaben or digitonin at concentrations of 0, 0.5, 1, 2, and 3 μM for 12 h and then infected with 0.1 MOI PEDV in the presence of the compounds. After 2 h, the inoculum was removed, cells were washed with PBS, and compound‐containing medium was replenished. After 12 h, cytopathic effects were observed under a fluorescence microscope.

2.5. Time‐of‐Addition Assay

Vero cells were seeded into 24‐well plates at 1.5 × 10⁵ cells per well and cultured for 24 h. Cells were infected with 0.1 MOI PEDV‐HW and treated with cetaben at different time points: 3 and 6 h preinfection and 3, 6, 9, 12, 18, and 21 h postinfection. After 24 h, cells were washed with PBS, and samples were collected to assess viral proliferation.

2.6. Immunofluorescence Assay (IFA)

Vero cells were seeded into 12‐well plates at 1 × 10⁶ cells/mL and grown to confluence. After drug treatment and PEDV infection as required, cells were fixed with 4% paraformaldehyde for 15 min when CPE reached 80%–90% in the control group. Cells were permeabilized with 0.1% Triton X‐100 for 30 min, blocked with 3% BSA, and incubated with anti‐PEDV‐S antibody (1:1000 dilution) for 1.5 h at room temperature. After washing, cells were incubated with FITC‐conjugated secondary antibody for 1 h, counterstained with DAPI, and imaged using an EVOS M7000 fluorescence microscope.

2.7. RT‐qPCR

Total RNA was extracted using the TransZol Up Plus RNA Kit (TransGen Biotech). RNA concentration was measured spectrophotometrically. Reverse transcription was performed using HiScript III All‐in‐one RT SuperMix (Vazyme). Absolute quantification of PEDV N gene copies was performed using the following primers and probe:

• PEDV‐N‐F: 5′‐CGCAAAGACTGAACCCACTAAC‐3′

• PEDV‐N‐R: 5′‐TTGCCTCTGTTGTTACTTGGAGAT‐3′

• Probe: FAM‐TGTTGCCATTACCACGACTCCTGC‐BHQ1.

2.8. Viral Titration

Virus titers were determined by TCID₅₀ and plaque assays. For TCID₅₀, serially diluted virus was inoculated onto Vero cells in 96‐well plates, 6 replicates per dilution concentration. After 3 days, titers were calculated using the Reed–Muench method. For plaque assays, virus‐infected Vero cells in 6‐ or 12‐well plates were overlaid with agarose‐containing DMEM with trypsin. After 72 h, cells were fixed with 4% formaldehyde and stained with crystal violet.

2.9. Flow Cytometry

Cells pretreated with cetaben were infected with PEDV‐DR13‐GFP. After 12 h, cells were trypsinized, centrifuged at 500 rpm for 5 min, and fixed with 4% formaldehyde for 30 min. Fixed cells were washed and resuspended in cold wash buffer (1% BSA and 0.1% NaN₃ in PBS). GFP‐positive cells were quantified using a CytoFLEX flow cytometer.

2.10. Experiment Involving Exogenous Cholesterol Intervention

To further investigate the relationship between the anti‐PRRSV activity of cetaben and cholesterol levels, this study assessed the impact of exogenous cholesterol (CAS: 57‐88‐5, Sigma–Aldrich) supplementation on cetaben‐mediated inhibition of PEDV. Vero cells cultured in 24‐well plates to confluence were washed three times with sterile PBS. Subsequently, cells were treated with a combination solution containing 3 μM cetaben and varying concentrations of exogenous cholesterol (0, 5, 10, 15, or 20 μM) and incubated at 37°C in a humidified atmosphere with 5% CO₂ for 12 h. Following incubation, the treatment medium was removed, and cells were infected with PEDV‐GDU at an MOI of 0.1 in the presence of the corresponding compound mixture for 2 h under the same culture conditions. After viral adsorption, the inoculum was aspirated, cells were washed three times with sterile PBS, and fresh culture medium supplemented with 3 μM cetaben and the respective cholesterol concentration was added. Cells were then further incubated for 24 h prior to downstream analysis.

2.11. Statistical Analysis

Data were analyzed using GraphPad Prism 8.0. Results from three independent experiments are expressed as mean ± SD. One‐way ANOVA was used for multigroup comparisons. The statistical significances were defined as p < 0.05 ( ^∗), and the higher significance was denoted by p < 0.01 ( ^∗∗) and p < 0.001 ( ^∗∗∗).

3. Results

3.1. Cholesterol‐Lowering Drugs Cetaben and Digitonin Exhibit Potent Anti‐PEDV Activity

To identify anti‐PEDV compounds, we screened a library of 117 cholesterol‐lowering agents using a high‐throughput approach (Figure 1A). Vero cells were pretreated with each compound (10 μM) for 1 h, infected with PEDV‐DR13‐GFP (MOI = 0.1), and incubated for 18 h. Infection levels were assessed via GFP fluorescence. Two rounds of screening identified four compounds—cetaben, digitonin, aloe emodin, and tert‐butyl pitavastatin—that inhibited viral infection by more than 50% (Figure 1B–D). Cetaben and digitonin were selected for further analysis due to their dose‐dependent antiviral effects within a concentration range of 0.5–3 μM (Figure 1E). Cetaben is a PPARα–independent peroxisome proliferator that inhibits cholesterol biosynthesis, whereas digitonin, a steroidal saponin derived from Digitalis purpurea, binds cholesterol and increases membrane permeability (Figure 1F). Cytotoxicity assays (CCK‐8) showed no significant cell damage at concentrations up to 3 μM after 16 h of exposure. The half‐maximal inhibitory concentrations (IC₅₀) were 0.65 μM for cetaben and 2.45 μM for digitonin, as determined by flow cytometry (Figure 1G). Viral titration assays confirmed that cetaben reduced PEDV titers by 1–3 log₁₀ (Figure 1H) and digitonin by 0.5–2.5 log₁₀ (Figure 1I).

Figure 1.

Screening of cholesterol‐lowering drugs for anti‐PEDV activity. (A) Schematic of the drug screening strategy. (B) Workflow of the compound screening process. (C) Inhibition rates of GFP expression in Vero cells infected with DR13‐GFP after the first round of screening. (D) Inhibition rates after the second round of screening. (E) Dose‐dependent effects of cetaben and digitonin on DR13‐GFP proliferation (scale bar, 400 μm). (F) Chemical structures of cetaben and digitonin. (G) IC₅₀ and CC₅₀ values of cetaben and digitonin. (H) Effect of cetaben on DR13‐GFP titers (n = 3). (I) Effect of digitonin on DR13‐GFP titers (n = 3). The data come from three toxicology experiments.  ^∗Represented p < 0.05.  ^∗∗Rrepresented p < 0.01.  ^∗∗∗Represented p < 0.001.

(A)

(B)

(C)

(D)

(E)

(F)

(G)

(H)

(I)

3.2. Cetaben and Digitonin Inhibit Diverse Genotypes of PEDV

Flow cytometry revealed that 3 μM cetaben reduced the proportion of GFP‐positive cells from 21% to 2.53% and 3 μM digitonin from 20.4% to 7.09% (Figure 2A), confirming strong antiviral activity against the reference strain. Given the genetic diversity of PEDV, we further evaluated both compounds against classical (GI and CV777) and variant (GII, HW, HNAY, and GDU) strains. Dose‐dependent inhibition of viral replication was observed across all strains using TCID₅₀ assays (Figure 2C,D). Cetaben induced viral titer reductions of up to ~3.5 log₁₀ (PEDV‐HW), while digitonin achieved reductions up to ~3.0 log₁₀ (PEDV‐HW) at 3 μM. IFA targeting the viral S protein further supported these results, showing that both compounds reduced the number of infected cells and suppressed syncytia formation in a concentration‐dependent manner (Figure 2D).

Figure 2.

Broad‐spectrum anti‐PEDV activity of Cetaben and Digitonin. (A) Flow cytometry analysis of PEDV infection in cells treated with the indicated compounds (n = 3). (B) Immunofluorescence assay (IFA) detection of PEDV‐HW infection in Vero cells following treatment with Cetaben or Digitonin (scale bar: 400 μm). (C) Inhibitory effect of Cetaben on the replication of different PEDV genotypes, quantified by TCID₅₀ (n = 3). (D) Inhibitory effect of Digitonin on the replication of various PEDV genotypes, assessed by TCID₅₀. Data are representative of three independent experiments. Statistical significance is denoted as follows:  ^∗ p < 0.05,  ^∗∗ p < 0.01, and  ^∗∗∗ p < 0.001.

(A)

(B)

(C)

(D)

3.3. Cetaben and Digitonin Exhibit Antiviral Activity Against PEDV in Porcine‐Derived IPEC‐J2 Cells

The antiviral activity of cetaben and digitonin against PEDV was further investigated in porcine‐derived IPEC‐J2 cells, a physiologically relevant model. As illustrated in Figure 3A,B, both compounds markedly diminished the GFP fluorescence intensity of PEDV‐DR13‐GFP and inhibited syncytia formation caused by the PEDV‐HW strain. This antiviral effect was corroborated by viral titer reduction assays, which showed significant inhibition of multiple PEDV strains in IPEC‐J2 cells (Figure 3C). These results collectively indicate that cetaben and digitonin exhibit broad‐spectrum efficacy against diverse PEDV strains, validating our previous observations in Vero cells within a more biologically relevant intestinal cell model.

Figure 3.

Cetaben and Digitonin demonstrate broad‐spectrum anti‐PEDV activity in IPEC‐J2 cells. (A) Cetaben and Digitonin exhibit dose‐dependent inhibitory effects on PEDV‐DR13‐GFP replication in IPEC‐J2 cells (scale bar: 300 μm). (B) Cetaben and Digitonin exhibit dose‐dependent inhibitory effects on PEDV‐HW replication in IPEC‐J2 cells (scale bar: 300 μm). (C) Cetaben and Digitonin significantly reduce viral titers of PEDV in IPEC‐J2 cells (n = 3). Data are representative of three independent experiments. Statistical significance is indicated as follows:  ^∗ p < 0.05,  ^∗∗ p < 0.01, and  ^∗∗∗ p < 0.001.

(A)

(B)

(C)

3.4. Cetaben Inhibits PEDV Syncytia Formation Through Cholesterol Depletion

To determine the timing of cetaben’s antiviral effect, Vero cells were treated with 3 μM cetaben at various time points relative to PEDV infection: 3 or 6 h preinfection and 3–24 h postinfection (Figure 4A). RT‐qPCR analysis at 24 hpi showed the strongest reduction in viral RNA when cetaben was added before or early during infection (Figure 4B,C), indicating that it targets early stages of the viral life cycle. Cetaben also markedly suppressed syncytia formation—a cholesterol‐dependent process. To test whether this effect was due to cholesterol depletion, exogenous cholesterol (5–20 μM) was added to cetaben‐treated, PEDV–infected cells. IFA results showed that cholesterol supplementation restored both S protein–positive cell counts and syncytia formation to levels comparable to untreated infected controls (Figure 4D). Correspondingly, TCID₅₀ assays confirmed that cholesterol reversed cetaben’s antiviral effect in a dose‐dependent manner (Figure 4E).

Figure 4.

Cetaben inhibits PEDV‐induced syncytia formation. (A) Schematic timeline of the time‐of‐addition assay. (B) RT‐qPCR analysis of viral RNA levels in Cetaben‐treated cells at different time points post‐infection (n = 3). (C) Inhibition rate of PEDV infection when Cetaben was added at various stages of the viral life cycle (n = 3). (D) Impact of exogenous cholesterol supplementation on Cetaben‐mediated suppression of PEDV infection (scale bar: 300 μm). Data are representative of three independent experiments. Statistical significance is indicated as follows:  ^∗ p < 0.05,  ^∗∗ p < 0.01, and  ^∗∗∗ p < 0.001. (E) TCID₅₀ assay showing that exogenous cholesterol supplementation attenuates the antiviral activity of Cetaben in a concentration‐dependent manner.

(A)

(B)

(C)

(D)

(E)

4. Discussion

Cholesterol metabolism plays a dual role in viral infections, serving as both a structural component of host membranes and a modulator of innate immune responses [15, 16]. However, previous studies have shown that cholesterol derivatives such as 25‐HC exhibit broad‐spectrum antiviral activity [17–19]; the potential use of cholesterol‐lowering drugs as antiviral agents remains underexplored. Our study addresses this gap by identifying two cholesterol‐lowering compounds, cetaben and digitonin, as potent inhibitors of PEDV. Notably, cetaben exhibited dose‐dependent antiviral effects against both classical and variant PEDV strains, and its inhibitory activity was significantly reversed by the addition of exogenous cholesterol. This compelling evidence indicates that cetaben inhibits PEDV infection by depleting cellular cholesterol, thereby disrupting key stages of the viral life cycle, including viral entry and syncytia formation. Cetaben was initially developed as an experimental cholesterol‐lowering agent, with its mechanism of action involving the inhibition of key enzymes in the cholesterol biosynthesis pathway. However, its precise molecular target and clinical application history remain poorly characterized. Nonetheless, its established ability to modulate cholesterol metabolism provides a solid theoretical foundation for the drug repositioning strategy employed in this study. Our results demonstrate that cetaben potently suppresses PEDV replication, an effect that is completely reversed by exogenous cholesterol supplementation, indicating a strict dependence on host cholesterol metabolic regulation. Notably, cetaben effectively inhibits syncytia formation induced by PEDV infection. We propose that this effect may result from cholesterol depletion‐mediated disruption of lipid raft integrity. Lipid rafts are cholesterol‐ and sphingolipid‐rich microdomains in the plasma membrane that play a critical role in the membrane fusion process of enveloped viruses, including coronaviruses [20]. The PEDV S protein relies on the lipid raft microenvironment to undergo conformational changes and mediate membrane fusion, thereby facilitating viral entry into host cells and cell‐to‐cell spread [21]. By reducing intracellular cholesterol levels, cetaben likely compromises lipid raft structure, thereby impairing S protein clustering and function, ultimately blocking virus–host membrane fusion and syncytium formation. This hypothesis is strongly supported by our experimental observation that exogenous cholesterol restores viral infectivity. Moreover, the antiviral mechanism of cetaben is markedly distinct from that of well‐established cholesterol modulators such as statins and 25‐hydroxycholesterol (25‐HC). Statins inhibit HMG‐CoA reductase, thereby suppressing endogenous cholesterol synthesis; however, they may simultaneously impair protein prenylation and downstream immune signaling pathways, potentially causing pleiotropic effects that limit their utility as antiviral agents [22]. In contrast, cetaben functions as a nonperoxisome proliferator‐activated receptor (PPAR)–independent peroxisome proliferator that selectively targets cholesterol biosynthesis without directly disrupting the isoprenoid pathway, indicating a more specific and cholesterol‐focused mechanism of action.

The antiviral mechanism of cetaben appears distinct from that of endogenous cholesterol modulators such as 25‐HC. While 25‐HC is induced during immune activation, cetaben acts pharmacologically by targeting cholesterol biosynthesis, offering a translatable strategy for host‐directed antiviral therapy. This approach may be particularly valuable against PEDV, which relies on cholesterol‐rich membrane microdomains for entry and cell‐to‐cell spread. Our results are consistent with growing evidence that coronaviruses—including PEDV and SARS‐CoV‐2—exploit cholesterol to facilitate efficient replication [11, 23, 24]. The ability of cetaben to inhibit diverse PEDV genotypes further underscores the conserved role of cholesterol in coronavirus infection and supports its potential as a broad‐spectrum antiviral agent.

Future studies should aim to elucidate the precise molecular targets of cetaben. A comprehensive multiomics strategy—combining transcriptomics, lipidomics, and proteomics—will be critical to systematically decode the host‐centered antiviral network perturbed by cetaben. This will clarify whether it directly interacts with viral components or acts solely through cholesterol depletion. In vivo evaluations in piglets will be essential to assess its therapeutic efficacy and safety. Furthermore, testing in human cell models could reveal its applicability against other coronaviruses. Combining cetaben with direct‐acting antivirals may also enhance treatment efficacy and reduce the risk of resistance. By establishing cholesterol modulation as a viable antiviral strategy, this study not only advances the development of PEDV therapeutics but also provides a framework for repurposing metabolic drugs against viral infections, with omics profiling serving as a powerful tool for validating and optimizing such host‐directed therapies.

Disclosure

All authors read and approved the final manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

Author Contributions

Yaqin Li: writing – original draft, writing – review and editing, data curation, survey, formal analysis, method. Panpan Qin: formal analysis, methodology, writing – original drafts, writing – review and editing. Kaiqi Zhang: formal analysis. Ningning Ma: data collation, formal analysis. Tianliang Wang: formal analysis, review and editing. Zilu Chen: methodology, formal analysis. Yixin Yuan: writing – reviewing and editing. Dongliang Li: writing – reviewing and editing. Linyang Yu: writing – review and editing. Wentao Li: writing – review and editing. Wenjuan Du: writing – review and editing. Yongtao Li: conceptualization, supervision, writing – original drafts, funding acquisition, methods, projects, resources, writing – review and editing.

Funding

This work was supported by the National Natural Science Foundation of China (Grants 32573409 and 32172839) and the China Scholarship Council (Grant 201908410129).

Supporting Information

Additional supporting information can be found online in the Supporting Information section.

Supporting information

Supporting Information Table S1: Information on the cholesterol‐lowering drug library, summarizing all data relevant to the drug library used in the screening process of this study.

Li, Yaqin , Qin, Panpan , Zhang, Kaiqi , Ma, Ningning , Wang, Tianliang , Chen, Zilu , Yuan, Yixin , Li, Dongliang , Yu, Linyang , Li, Wentao , Du, Wenjuan , Li, Yongtao , Discovery of Cetaben as a Novel Antiviral Agent Against Porcine Epidemic Diarrhea Virus From a Cholesterol‐Lowering Compound Library, Transboundary and Emerging Diseases, 2026, 1481087, 11 pages, 2026. 10.1155/tbed/1481087

Data Availability Statement

Any data not presented here will be made available upon reasonable request.