Abstract
Purpose
As a vital component of the hepatitis B virus (HBV) nucleocapsid, HBV core protein (HBC) contributes to hepatocarcinogenesis. Here, we aimed to assess the effects of RANGAP1 and KDM2A on tumorigenesis induced by HBC.
Methods
Co-immunoprecipitation (Co-IP) combined with mass spectrometry were utilized to identify the proteins with the capacity to interact with HBC. The gene and protein levels of RANGAP1 and KDM2A in hepatocellular carcinoma (HCC) and HBV-positive HCC tissues were evaluated using different cohorts. The roles of RANGAP1 and KDM2A in HCC cells mediated by HBC were investigated in vitro and in vivo. Co-IP and western blot were used to estimate the interaction of HBC with RANGAP1 and KDM2A and assess RANGAP1 stabilization regulated by HBC.
Results
We discovered that HBC could interact with RANGAP1 and KDM2A, the levels of which were markedly elevated in HCC tissues. Relying on RANGAP1 and KDM2A, HBC facilitated HCC cell growth and migration. The increased stabilization of RANGAP1 mediated by HBC was relevant to the disruption of the interaction between RANGAP1 and an E3 ligase SYVN1. RANGAP1 interacted with KDM2A, and it further promoted KDM2A stabilization by disturbing the interaction between KDM2A and SYVN1. HBC enhanced the interaction of KDM2A with RANGAP1 and upregulated the expression of KDM2A via RANGAP1 in HCC cells.
Conclusions
These findings demonstrate a novel mechanism by which HBC facilitates hepatocarcinogenesis. RANGAP1 and KDM2A could act as potential molecular targets for treating HBV-associated malignancy.
Supplementary Information
The online version contains supplementary material available at 10.1007/s13402-023-00889-4.
Keywords: HBC, KDM2A, RANGAP1, SYVN1, Hepatocellular carcinoma
Introduction
Hepatocellular carcinoma (HCC) remains a global threat to health and one major risk factor for the malignancy is the hepatitis B virus (HBV) [1, 2]. Particularly, among the encoded proteins produced by the virus, HBV core protein (HBC), a vital component of viral nucleocapsid, is demonstrated to play significant roles in the virus-induced tumorigenesis [3]. Although various cellular factors, including C5α receptor 1 (C5ΑR1) [4], miR-382-5p [5], and neuraminidase 1(NEU1) [6], have been identified to participate in the modulation of HBC-associated hepatocarcinogenesis, the exact molecular mechanisms are still not well clarified. Therefore, further illustrating the factors that are responsible for HCC development stimulated by the viral molecule may help us find new strategies to treat HBV-positive malignancy.
RanGTPase activating protein 1 (RANGAP1) is a vital component of the nuclear pore complex, which controls the nuclear transport of intracellular proteins [7]. Current investigations have indicated that the expression levels of RANGAP1 are elevated in different forms of cancer, including colon, breast, and pancreatic cancers [8], glioma [9], and diffuse large B-cell lymphoma [10]. Especially, the molecule is implicated in the development of these tumors by modulating cell death, apoptosis [9], and cell cycle arrest [10]. Nevertheless, the relationship between RANGAP1 and HCC, especially HBV-associated tumors, is still unclear so far.
Lysine demethylase 2 A (KDM2A) is a histone demethylase. It not only can demethylate H3 lysine 36 (H3K36) but also has an inhibitory function on the methylation of non-histone proteins to control cell growth, differentiation, and other normal cellular functions [11, 12]. Importantly, it is shown that KDM2A is relevant to the malignant development of bladder cancer [13], colorectal adenocarcinoma [14], gastric cancer [15], and breast cancers [16], and contributes to the modulation of the growth and movement of these cancer cells. In HCC, KDM2A is also upregulated and benefits the tumor’s progression [17]. However, the regulatory factors that contribute to KDM2A expression are not well illustrated. Here, we explored the effect of HBC on RANGAP1 and KDM2A expressions in HCC cells. The mechanisms regarding the modulation of RANGAP1 and KDM2A mediated by SYVN1 and HBC were also examined, and these investigations could give us a greater understanding of HBC-associated tumorigenesis.
Materials and methods
Reagents, plasmids, and cell culture
HBV plasmid, cycloheximide (CHX), matrigel solution, the short hairpin RNA (shRNA) plasmid targeting RANGAP1, MG132, and the antibodies against GAPDH, HBC, HBsAg, and Flag-Tags were obtained previously [6, 18–21]. The antibodies targeting RANGAP1, SYVN1, and KDM2A were purchased from Proteintech (Wuhan, China), Abclonal (Wuhan, China), HUABIO (Hangzhou, China), and Sigma-Aldrich (St Louis, MO, USA). The Flag-labeled HBC plasmid was constructed based on the HBC plasmid [4, 6]. The plasmid (pLKO.1-EGFP-puro) containing KDM2A shRNA (sequence information: GGAAGAGAGTGACGAAGAACTCGAGTTCTTCGTCACTTCTT CC TTTTTT) was from Genebay (Nanjing, Jiangsu, China). The plasmids (pCDNA3.1-3×FLAG-N) containing RANGAP1, KDM2A, and SYVN1 genes were obtained from Ke Lei Biological Technology (Shanghai, China). HepG2, HepG2.2.15, and Huh7 were cultured as described [18, 19, 21]. After HCC cells were transfected with different gene expression vectors or shRNA plasmids, G418 or Puromycin were used to select the stably transfected cells.
HBV-associated hepatocellular carcinoma (HCC) samples, hematoxylin-eosin (HE) staining, and immunohistochemistry (IHC) analysis
The adjacent tissues (n = 60) and HBV-associated HCC tissues (n = 130) were acquired from Outdo Biotech Co., Ltd (Shanghai, China). Using IHC analysis, the expression levels of RANGAP1 and KDM2A in the tumor tissues were examined. After the tissue sections were deparaffinized and rehydrated, they were further treated with sodium citrate. Next, these sections were incubated with H2O2, blocked using 5% goat serum, and treated with the primary antibodies targeting RANGAP1 (1:400) and KDM2A (1:300) at 4℃ for 12 h and HRP-conjugated second antibodies (1:500) at room temperature for 2 h. Sequentially, the sections were stained by 3,3’-diaminobenzidine, terminated with water, and further counterstained with hematoxylin [6, 18, 22]. HE staining of the tissues was performed as mentioned previously [21, 23]. The expressions of RANGAP1 and KDM2A protein levels in the tumor tissues were calculated as described [18, 22]. The work was followed by the principles of the Declaration of Helsinki. Approval was obtained from the ethics committee of Outdo Biotech Co., Ltd, and Xuzhou Medical University.
Immunofluorescence analysis
The situations of HBC, RANGAP1, KDM2A, and SYVN1 in HCC cells were estimated with the immunofluorescence experiment. After being fixed with acetone, the target cells were blocked by 2% bovine serum albumin (BSA), they were incubated with HBC (1:200), RANGAP1(1:400), KDM2A(1:200), and SYVN1(1:100) antibodies for 12 h at 4℃. Next, these cells were incubated with DAPI for 10 min, and treated with Alexa Fluor 488-conjugated antibodies (1:400) or Alexa Fluor 594-conjugated antibodies (1:400) for 2 h at room temperature. Finally, the fluorescence images were acquired using an Olympus microscope (Tokyo, Japan).
The detection of cellular proliferation and migration
The growth capability of target cells was examined with the CCK-8 Kit and cell clone formation assays [22, 24]. In addition, a wound healing assay, as well as a transwell experiment, were utilized to examine cell migration as reported previously [18, 21].
Real-time polymerase chain reaction (PCR)
The primers for the detection of the RANGAP1 gene were: F: CCTGAATGGCAACACCCTGG, R: GCGTGGCTGACTTCTCTCCCT; The information for the KDM2A gene primers was: F: CCAAAGGTGCGGGTTCCTAC, R: GGCTCCTGACACAATCGGG. PCR amplification conditions were: 5 min at 95 °C, 32 cycles of 30 s at 95 °C, 30 s at 61 °C, and 30 s at 72 °C. The expression of the RANGAP1 and KDM2A mRNAs was normalized against GAPDH, which primers have been shown before [20, 22].
Western blot, mass spectrometry (MS), co‑immunoprecipitation (Co‑IP) assays, and ubiquitination detection
The manipulation of western blot analysis was described previously [4, 6]. For the Co-IP assay, the extracts from target cells were treated with Protein G Sepharose beads and Flag-HBC (1:500), RANGAP1 (1:400), KDM2A (1:400), and SYVN1(1:200) antibodies for 12 h at 4℃. Then, the target molecules in the immunoprecipitates were examined by western blot. The immunoprecipitants were also analyzed by MS at Beijing Protein Innovation Co., Ltd (Beijing, China). The interaction information of identified proteins from MS was extracted from the STRING database [25]. For detecting the ubiquitination levels of RANGAP1 and KDM2A, cell extracts were incubated with Protein G Sepharose beads and the ubiquitin (1:500) antibodies at 4℃ for 12 h. Western blot analysis was performed with RANGAP1 (1:2000) and KDM2A(1:1000) antibodies to investigate the ubiquitination levels of these molecules.
Bioinformatics analysis
The gene expression information of RANGAP1 and KDM2A was collected from the TCGA and ICGC databases as mentioned [26], and associated clinical data were extracted from the TCGA database. Relying on the ICGC database, the expression levels of RANGAP1 and KDM2A genes were assessed in, HBV-positive tumor tissues (HBV-HCC, n = 53), hepatitis C virus (HCV)-positive HCC tissues (HCV-HCC, n = 117), and HCC tissues without HBV or HCV infection (Non-HBV-HCV-HCC, n = 32). Dependent on the gene expression information from the HCC cohort in the TCGA database, the GSEA analysis on RANGAP1 and KMD2A was performed [27], and the median value of target genes was utilized to divide into the high group and low group. The pathways related to the target genes were predicted with the ARCHS4 database [28]. RANGAP1 and KDM2A gene expression levels in HBV-associated HCC tissues were collected from Gao, et al [29]. The expression information of RANGAP1 and KDM2A proteins in HBV-positive HCC tissues was collected from the CPTAC database [30]. The gene expression levels of RANGAP1, SYVN1, and KDM2A in HCC tissues were also obtained from GSE25097 in the GEO database [31, 32]. The molecules with the capability to interact with RANGAP1 were predicted by the PrePPI database [33]. The potential E3 ligases of RANGAP1 and KDM2A were predicted via the UbiBrowser database [34].
Animal transplantation
A total of 0.1 ml matrigel solution combined with 0.1 ml different cell suspensions (2 × 107/ml) were injected into the shoulder of female BALB/c null mice (4-week old, n = 4 per group). The mice were obtained as described before [4], and they were fed under temperature-controlled and specific pathogen-free conditions. The weight and volume of target tumors that extracted from the nude mice were examined as mentioned previously [4, 6]. The mice experiment was approved by the Animal Care and Use Committee of Xuzhou Medical University.
Statistical analysis
The data from at least three independent experiments were presented in the study. T-test, chi-square test, or one-way ANOVA test, were adopted when appropriate to compare the data between two groups or among no less than three groups. Univariate survival analysis (using the Log-rank test) was performed to evaluate the association of overall survival (OS) and disease-free survival (DFS) with the levels of RANGAP1 and KDM2A expression in HCC tissues. A p < 0.05 was considered significant.
Results
HBC interacts with RANGAP1 and enhances its expression in HCC cells
To better estimate the molecules participating in HCC development mediated by HBC, Co-immunoprecipitation (Co-IP) assay combined with mass spectrometry (MS) was used to assess the proteins with the ability to interact with HBC in HepG2 cells, and a total of 127 proteins were identified (Fig. 1A). Among these molecules, we were interested in assessing whether RANGAP1 was involved in the modulation of hepatocarcinogenesis mediated by HBC. Because as an important molecule that participates in modulating the nuclear transport of intracellular proteins, RANGAP1 is essential for the development of several cancers [8–10]. However, until now, the effect of RanGAP1 on HCC is still unclear. Relying on GSEA analysis [27], we observed that RANGAP1 was associated with the pathways in cancer (Fig. 1B). Dependent on the ARCHS4 database [28], we discovered that the molecule was relevant to hepatitis B and viral carcinogenesis (Fig. 1C). These results of bioinformatics analysis implied that RANGAP1 might have vital roles in the development of HBV-positive malignancy. Relying on the Co-IP experiment, the interaction of HBC with RANGAP1 in HepG2 and Huh7 cells was confirmed, after transfecting the HBC expression plasmid into these HCC cells (Fig. 1D). Depending on the immunofluorescence assay, the colocalization of HBC with RANGAP1 in the tumor cells was observed (Fig. 1E). We also detected the effect of HBC on RANGAP1 expression at the gene and protein levels in HCC cells. As shown in Fig. 1F, HBC could significantly induce the increase of RANGAP1 protein, while it has no obvious influence on the expression of RANGAP1 mRNA in either HepG2 or Huh7 cells (Fig. 1G). We further examined the influence of HBV on RANGAP1 expression by using HCC cells transfected with HBV plasmids and HepG2.2.15 cells (HepG2 cells with stable expression of HBV). The observations showed that the protein levels of RANGAP1 expression in virus-positive tumor cells were higher, in comparison with the control cells (Fig. 1H). Interestingly, the results suggested that the virus also can elevate RANGAP1 mRNA expression in HCC cells (Fig. 1I), suggesting that, except HBC, other viral proteins encoded by HBV participated in the modulation of RANGAP1 mRNA expression in hepatoma cells.
Fig. 1.

The interaction of HBC with RANGAP1 in hepatoma cells. A The proteins interacted with HBC that identified with Co-IP and MS. B The KEGG pathways that identified with GSEA analysis of RANGAP1 in HCC using the TCGA cohort. C The predicted pathways of RANGAP1 in the ARCHS4 database. D The interaction between RANGAP1 and HBC identified by Co-IP assay. E The colocation of RANGAP1 with HBC in tumor cells that detected by immunofluorescence assay. Scale bar, 10 μm. F The effect of HBC on RANGAP1 protein expression in tumor cells that detected by western blot. G The effect of HBC on RANGAP1 mRNA expression in HCC cells that detected by real-time PCR. H The effect of HBV on RANGAP1 protein expression in HCC cells that detected by western blot. I The effect of HBV on RANGAP1 mRNA expression in HCC cells that detected by real-time PCR. Mock: the cells transfected with control expression plasmid, HBC: the cells transfected with HBC expression plasmid, HBV: the cells transfected with HBV expression plasmid. The experimental data were performed from at least three independent determinations
The levels and clinical association of RANGAP1 in HCC
We next estimated the clinical significance of RANGAP1 in HCC, especially in the tumor with HBV infection. Relying on the transcriptome data from the TCGA cohorts, as well as the ICGC cohorts [26], the upregulated expression of RANGAP1 genes in HCC tissues was identified (Fig. 2A, B), compared to adjacent tissues. Based on the HBV-associated HCC cohorts from Gao, et al. and the CPTAC database [29, 30], the upregulated levels of the RANGAP1 gene and its protein in HBV-positive HCC were discovered (Fig. 2C, D). Using the immunohistochemistry (IHC) analysis, we also assessed the levels of RANGAP1 protein in both adjacent tissues and virus-positive tumor tissues. Consistent with the HCC cohort from Gao, et al. [29] and CPTAC database, increased expression of RANGAP1 was noticed in HBV-positive neoplastic tissues (Fig. 2E). Based on the ICGC HCC cohorts, we assessed the expression of RANGAP1 genes in tumor tissues without HBV and HCV infection, and in HBV or HCV-positive HCC tissues. The results demonstrated that in comparison to adjacent tissues, the levels of RANGAP1 were elevated in HBV and HCV-negative HCC tissues, and in HBV and HCV-positive HCC tissues. However, the discrepancy in RANGAP1 gene expression among HBV-positive HCC tissues, HCV-positive HCC tissues, and HBV and HCV-negative HCC tissues, was not significant (Fig. 2F). These results suggested that, in HCC tissues, multiple factors, including HBV, HCV, and the factors unrelated to hepatitis virus infection, might participate in the modulation of RANGAP1 expression. Relying on the TCGA HCC cohort, we also estimated the relationship between RANGAP1 and various clinical parameters in the tumor. Our observations demonstrated that the levels of RANGAP1 expression in HCC patients with an age less than 60 were higher than those in cases with an age no less than 60 (Fig. 2G). The levels of RANGAP1 in HCC cases with AFP levels of no more than 20 ng/mL were lower than that in the patients with AFP of more than 20 ng/mL (Fig. 2H). Compared with male patients, RANGAP1 expression levels in female patients were higher (Fig. 2I). The levels of the RANGAP1 gene were higher in patients with a neoplasm histologic grade of more than G2 (Fig. 2J), compared with patients with a neoplasm histologic grade of no more than G2. Furthermore, relying on univariate survival analysis, we discovered that high levels of RANGAP1 were relevant to the poor overall survival (OS) and disease-free survival (DFS) of tumor patients (Fig. 2K, L).
Fig. 2.
The clinical association of RANGAP1 in HCC. A The levels of RANGAP1 in HCC in the TCGA cohort. B The expression of RANGAP1 in HCC in the ICGC database. C The expression of RANGAP1 gene in HBV-associated HCC in the cohort from Gao, et al. D The expression of RANGAP1 protein in HBV-associated HCC in the cohort from the CPTAC database. E The levels of RANGAP1 in adjacent tissue and HBV-positive HCC detected by IHC. Scale bar, 50 μm. F The expression of RANGAP1 genes in HCC tissues without HBV and HCV infection (Non-HBV-HCV-HCC), HBV positive HCC tissues (HBV-HCC), and HCV positive HCC tissues (HCV-HCC) in ICGC HCC cohort. G The relationship of RANGAP1 expression with age in HCC in the TCGA cohort. H The association of RANGAP1 expression with AFP levels in the TCGA cohort. I The relationship of RANGAP1 with gender in HCC in TCGA cohort. J The association of RANGAP1 expression with neoplasm histologic grade in the TCGA cohort. K The association of RANGAP1 with OS in HCC through univariate survival analysis. L The relationship of RANGAP1 with DFS in HCC via univariate survival analysis. *P < 0.05, ns: no significant
RANGAP1 enhances tumor cell growth and migration mediated by HBC
We previously showed that HBC contributed to HCC cell growth and migration [4, 6]. Here, we assessed whether RANGAP1 participated in regulating cellular proliferation and migration induced by HBC. At first, the constructed RANGAP1 expression plasmid was transfected into the tumor cells. After the expression of exogenous Flag-labeled RANGAP1 was identified in hepatoma cells (Supplementary Fig. S1A), the influence of RANGAP1 on tumor cell growth and migration was investigated. Relying on the CCK-8, cell colony-forming experiment, transwell, as well as wound healing assays, RANGAP1 was shown to significantly enhance the growth and motion of both HepG2 and Huh7 cells in vitro (Supplementary Fig. S1B-E). Dependent on subcutaneous tumorigenesis in nude mice, we also discovered that RANGAP1 has the capability of enhancing HCC cell proliferation in vivo (Supplementary Fig. S1F-H).
Next, a shRNA specifically targeting RANGAP1 was constructed, and its effect on the inhibition of RANGAP1 protein was confirmed (Supplementary Fig. S1I). Using the functional experiments mentioned above, we found that HBC was able to enhance HCC cell growth and migration. After inhibiting RANGAP1 with shRNA, the proliferation, as well as migration, of liver cancer cells mediated by HBC were reduced in vitro (Supplementary Fig. S1J-M). In nude mice, in comparison to control cells, the enhanced growth capability of HCC cells induced by HBC was discovered. After the expression levels of RANGAP1 in HCC cells were restrained by its shRNA, the capacity of tumor formation mediated by HBC was suppressed in vivo (Supplementary Fig. S1N-P). Collectively, these findings demonstrated that RANGAP1 contributed to the growth and migration of HBC-associated HCC cells.
HBC promotes the stability of RANGAP1 by suppressing the interaction of RANGP1 with SYVN1 in HCC cells
As mentioned above, we discovered that HBC upregulated the expression of RANGAP1 at only its protein levels. Because the ubiquitin-proteasome-dependent degradation manner is crucial for the regulation of intracellular protein expression [35], we assessed whether HBC was capable of increasing the stability of RANGAP1 mediated by the ubiquitin-proteasome manner to facilitate the upregulation of the molecule. As shown in Fig. 3A, the stabilization of RANGAP1 was examined after the target HCC cells were given the protein synthesis inhibitor CHX, and we observed that HBC can increase the half-life of RANGAP1 protein. Besides, with the treatment of MG132 (a proteasome inhibitor), the expressions levels of the RANGAP1 protein were also determined in the target cells, and the observation suggested that HBC obviously enhanced the stability of the RANGAP1 protein (Fig. 3B). Meanwhile, HBC was capable of reducing RANGAP1 ubiquitination in HCC cells (Fig. 3C).
Fig. 3.
The effect of SYVN1 on RANGAP1 expression in HBC-related hepatoma cells. A HBC-positive HCC cells and control cells were treated with CHX (200 ug/mL), and the levels of RANGAP1 were examined at 0 h, 2 h, 4 h, and 8 h after the cells incubated with CHX. B HBC-positive hepatoma cells and control cells were treated with MG132 (100 nM), and the levels of RANGAP1 were examined at 0 h, 12 h, 24 h, and 36 h after the target cells incubated with MG-132. C The effect of HBC on RANGAP1 ubiquitination in hepatoma cells. D SYVN1, the potential E3 ligase of RANGAP1 predicted by the UbiBrowser database. E The predicted pathways of SYVN1 in the ARCHS4 database. F The effect of SYVN1 on the expression of RANGAP1 protein in HCC cells. G The interaction of SYVN1 with RANGAP1 detected by Co-IP in HCC cells. H The colocation of SYVN1 with RANGAP1 was examined by immunofluorescence in HCC cells. Scale bar, 10 μm. I SYVN1-overexpressing HCC cells and control cells were treated with CHX (200 ug/mL), and the levels of RANGAP1 were examined at 0 h, 2 h, 4 h, and 8 h after the cells incubated with CHX. J SYVN1-overexpressing hepatoma cells and control cells were treated with MG132 (100 nM), and the levels of RANGAP1 were examined at 0 h, 12 h, 24 h, and 36 h after the target cells incubated with MG-132. K The effect of SYVN1 on RANGAP1 ubiquitination in hepatoma cells. L The association of SYVN1 with RANGAP1 in HCC tissues by examined using GSE25097. M The effect of HBC on SYVN1 protein expression in HCC cells. N The interaction of HBC with SYVN1 that detected by Co-IP assay in HCC cells. O The effect of HBC on the interaction between SYVN1 with RANGAP1 that detected by Co-IP assay in hepatoma cells. Mock: the cells transfected with control expression plasmid, HBC: the cells transfected with HBC expression plasmid, SYVN1: the cells transfected with SYVN1 expression plasmid. The data was acquired in at least three independent experiments
Although we found that HBC can regulate the ubiquitination of RANGAP1, it is not a E3 ubiquitin (Ub) ligase, which can transfer Ub molecules to target proteins. Based on the UbiBrowser database [34], the potential E3 Ub ligases of RANGAP1 were predicted. Among these predicted E3 Ub ligases, we chose SYVN1, which had the highest score in the database (Fig. 3D), for further investigation, because relying on the ARCHS4 database, we found that SYVN1 was associated with hepatitis B and viral carcinogenesis (Fig. 3E), suggesting that the E3 ligase might participate in the development of HBV-induced malignancy. Furthermore, the inhibition of RANGAP1 mediated by exogenous SYVN1 was observed, based on the western blot analysis (Fig. 3F). We also confirmed the interaction of SYVN1 with RANGAP1 via the Co-IP assay (Fig. 3G). The colocalization between SYVN1 and RANGAP1 was detected by immunofluorescence experiment in the tumor cells as well (Fig. 3H). Using CHX and MG-132, the ability of SYVN1 to restrict RANGAP1 half-life and stability was determined (Fig. 3I-J). In addition, an increase in RANGAP1 ubiquitination mediated by SVYN1 was also found (Fig. 3K). Dependent on the HCC cohort from GSE25097 in the GEO database [31, 32], we also detected the clinical relationship of SYVN1 with RANGAP1 in HCC tissues, and a negative association between SYVN1 and RANGAP1 was discovered (Fig. 3L). As mentioned, our results suggested that HBC could enhance the stabilization of RANGAP1 by inhibiting its ubiquitination. We were interested in investigating whether the regulation of RANGAP1 stabilization and ubiquitination mediated by HBC was associated with SYVN1. Although no significant effect of the viral protein on SYVN1 expression was observed (Fig. 3M), relying on the Co-IP experiment, the binding of HBC with SYVN1 was identified (Fig. 3N). Furthermore, the decreased interaction between SYVN1 and RANGAP1 in HBC-positive HCC cells was determined, in comparison to control HCC cells (Fig. 3O). These results suggest that SYVN1 could bind to HBC and RANGAP1, and in HCC cells, to benefit the stability RANGAP1, HBC can compete with RANGAP1 to bind to SYVN1 and destroy the interaction between RANGAP1 and SYVN1.
RANGAP1 interacts with KDM2A and enhances the expression of KDM2A in HCC cells
Next, we estimated the downstream molecules that participated in the modulation of HCC development mediated by RANGAP1. The potential proteins that can interact with RANGAP1 were predicted by the PrePPI online database [33]. Among these predicted molecules, KDM2A was chosen (Fig. 4A), because as shown in Fig. 1A, the molecule was also found to interact with HBC identified by MS. Furthermore, relying on GSEA analysis, the molecule was discovered to be relevant to pathways in cancer (Fig. 4B). Depending on the ARCHS4 database [28], KDM2A was also observed to be associated with hepatitis B, and viral carcinogenesis (Fig. 4C). These findings suggested that, similar to RANGAP1, KDM2A might have a pivotal effect on HBV-associated tumorigenesis. Relying on the Co-IP experiment, the binding of RANGAP1 to KDM2A was confirmed (Fig. 4D). Using the immunofluorescence experiment, the colocalization between RANGAP1 and KDM2A was discovered (Fig. 4E). We evaluated the influence of RANGAP1 on KDM2A expression in the tumor cells. The observations indicated that RANGAP1 did not influence KDM2A mRNA expression (Fig. 4F), but it can upregulate the levels of KDM2A protein (Fig. 4G). Conversely, KDM2A has no notable impact on the expression of RANGAP1 (Fig. 4H). We further estimated the effect of RANGAP1 on the stability of KDM2A and its ubiquitination. The results demonstrated that RANGAP1 can enhance the half-life and stabilization of KDM2A (Fig. 4I-J), and the regulation of KDM2A stabilization mediated by RANGAP1 was associated with decreased ubiquitination of KDM2A in HCC cells (Fig. 4K). Apart from these, dependent on the HCC cohort from GSE25097 in the GEO database, we discovered that RANGAP1 gene expression was positively relevant to KDM2A in HCC tissues (Fig. 4L).
Fig. 4.
The effect of RANGAP1 on KDM2A expression in hepatoma cells. A The interaction of RANGAP1 with KDM2A predicted by the PrePPI database. SM: structural modeling; PrP: Protein-Peptide modeling; OR: Orthology; PP: Phylogenetic Profile Similarity; EP: Co-expression similarity; PR: Partner Redundancy; GO: Gene Ontology (GO) term similarity. Pred_Score: prediction score. B The KEGG pathways that identified with GSEA analysis of KDM2A in HCC using the TCGA cohort. C The predicted pathways of KDM2A in the ARCHS4 database. D The interaction of SYVN1 with RANGAP1 detected by Co-IP in HCC cells. E The colocation of SYVN1 with RANGAP1 was examined by immunofluorescence in HCC cells. Scale bar, 10 μm. F The effect of RANGAP1 on the expression of KDM2A mRNA in HCC cells that detected by real-time PCR. G The effect of RANGAP1 on the expression of KDM2A protein in HCC cells. H The effect of KDM2A on the expression of RANGAP1 protein in HCC cells. I RANGAP1-positive HCC cells and control cells were treated with CHX (200 ug/mL), and the levels of KDM2A were examined at 0 h, 2 h, 4 h, and 8 h after the cells incubated with CHX. J RANGAP1-positive hepatoma cells and control cells were treated with MG132 (100 nM), and the levels of KDM2A were examined at 0 h, 12 h, 24 h, and 36 h after the target cells incubated with MG-132. K The effect of RANGAP1 on KDM2A ubiquitination in hepatoma cells. L Based on GSE25097, the association of RANGAP1 with KDM2A genes in the HCC tissues was examined. Mock: the cells transfected with control expression plasmid, RANGAP1: the cells transfected with RANGAP1 expression plasmid. The experimental data was acquired in at least three independent experiments
RANGAP1 promotes KDM2A stabilization by disrupting the interaction between KDM2A and SYVN1
Next, we assessed the potential E3 Ub ligases of KDM2A through the UbiBrowser database [34]. Interestingly, SYVN1 was also observed to be a potential E3 Ub ligase (Fig. 5A). We tested the impact of SYVN1 on the modulation of KDM2A protein expression. As the result presented in Fig. 5B, SYVN1 can decrease the levels of KDM2A protein. The interaction and colocalization between SYVN1 and KDM2A in HCC cells were determined using Co-IP and immunofluorescence assays (Fig. 5C-D). Based on MG132 and CHX, we discovered that the half-life and stabilization of KDM2A could be suppressed by SYVN1 (Fig. 5E-F). Meanwhile, the ubiquitination levels of KDM2A were enhanced by SYVN1 in hepatoma cells (Fig. 5G). As shown above, we found that the upregulation of KDM2A protein mediated by RANGAP1 is relevant to the increase in KDM2A stability. Here, we also investigated whether RANGAP1 can influence the interaction of KDM2A with SYVN1 to benefit KDM2A stabilization. Based on RANGAP1-overexpressing HCC cells and control cells, we discovered that KDM2A upregulation mediated by RANGAP1 relied on the inhibition of KDM2A interacting with SYVN1 (Fig. 5H). These findings indicated that to facilitate KDM2A stabilization, RANGAP1 competes with KDM2A to bind to SYVN1 and disrupts the interaction of SYVN1 with KDM2A in hepatoma cells.
Fig. 5.
The effect of RANGAP1 on the expression of KDM2A was associated with SYVN1 in HCC cells. A SYVN1, the potential E3 ligase of KDM2A was predicted by the UbiBrowser database. B The effect of SYVN1 on the expression of KDM2A. C The interaction of KDM2A with SYVN1 was detected by Co-IP in HCC cells. D The colocation of KDM2A with SYVN1 was examined by immunofluorescence in HCC cells. Scale bar, 10 μm. E SYVN1-overexpressing HCC cells and control cells were treated with CHX (200 ug/mL), and the levels of KDM2A were examined at 0 h, 2 h, 4 h, and 8 h after the cells incubated with CHX. F SYVN1-overexpressing hepatoma cells and control cells were treated with MG132 (100 nM), and the levels of KDM2A were examined at 0 h, 12 h, 24 h, and 36 h after the target cells incubated with MG-132. G The effect of SYVN1 on KDM2A ubiquitination in hepatoma cells. H The effect of RANGAP1 on the interaction of SYVN1 with KDM2A. I The effect of RANGAP1 on the expression of KDM2A mediated by SYVN1 was detected by western blot in HCC cells. J After RANGAP1 plasmid and control plasmid were transfected into SYNV1-overexpressing HCC cells, the cells were treated with CHX (200 ug/mL), and the levels of KDM2A in these cells were examined at 0 h, 2 h, 4 h, and 8 h after the cells incubated with CHX. K After RANGAP1 plasmid and control plasmid were transfected into SYNV1-overexpressing HCC cells, the cells were treated with MG132 (100 nM), the levels of KDM2A in these cells were examined at 0 h, 12 h, 24 h, and 36 h after the target cells incubated with MG-132. L The effect of RANGAP1 on the ubiquitination of KDM2A mediated by SYVN1 in HCC cells. Mock: the cells transfected with control expression plasmid, SYVN1: the cells transfected with SYVN1 expression plasmid, RANGAP1: the cells transfected with RANGAP1 expression plasmid, SYVN1-CON: SYVN1-overexpressing HCC cells transfected with control expression plasmid, SYVN1-RANGAP1: SYVN1-overexpressing HCC cells transfected with RANGAP1 expression plasmid
To better determine the role of RANGAP1 in the restrain of KDM2A ubiquitination mediated by SYVN1 to regulate its stabilization. We transfected exogenous RANGAP1 into SYVN1-overexpressing HCC cells. The observations indicated that after transfecting the exogenous RANGAP1 genes into SYVN1-overexpressing HepG2 and Huh7 cells, the expression of KDM2A protein increased (Fig. 5I). Based on the treatment with CHX and MG132, we discovered that the suppressed half-life and stabilization of KDM2A mediated by SYVN1 could be prevented by RANGAP1 (Fig. 5J-K). Meanwhile, the ubiquitination levels of KDM2A in SYVN1-overexpressing HCC cells were reduced by RANGAP1 (Fig. 5L).
The association of KDM2A with HCC and the role of HBC on KDM2A via RANGAP1 in HCC cells
We sequentially evaluated the relationship between KDM2A and HCC. Based on the tumor cohorts from the TCGA and ICGC databases, we showed that compared to adjacent tissues, the elevated expression of the KDM2A gene was discovered in the cancer tissues (Fig. 6A-B). Relying on the HBV-associated HCC cohorts from Gao, et al. and the CPTAC database [29, 30], the upregulated levels of the KDM2A gene and its protein were discovered in HBV-positive HCC tissues (Fig. 6C-D). Using IHC analysis and comparing with adjacent tissues, we also determined that the expression of KDM2A protein was enhanced in HBV-associated malignant tissues (Fig. 6E). Relying on the ICGC HCC cohorts, the expression levels of KDM2A in HBV and HCV-negative HCC tissues, HBV-positive HCC tissues, and HCV-positive HCC tissues were estimated. Compared to adjacent tissues, the upregulated expression of KDM2A in HBV and HCV-positive HCC tissues but not in the tumor without HBV or HCC infection was found (Fig. 6F). These findings suggested that HBV and HCV infection can cause the increase of KDM2A in HCC tissues. Depending on the TCGA HCC cohort, we assessed the relationship of KDM2A with different clinical parameters in HCC patients. Similar to RANGAP1, compared with HCC cases less than the age of 60, the level of KDM2A was lower in the tumor patients no less than the age of 60. KMD2A expression levels were higher in patients with AFP levels no less than 20 ng/mL, compared to that in those cases with AFP levels less than 20 ng/mL. Besides these, in comparison with patients with a neoplasm histologic grade no more than G2, the levels of KDM2A genes were higher in those cases with a neoplasm histologic grade more than G2 (Fig. 6G-I). Furthermore, a significantly positive association between KDM2A with RANGAP1 in HCC tissues was also identified (Fig. 6J). Additionally, we discovered that KDM2A was not relevant to the OS and DFS of the tumor patients (Fig. 6K-L).
Fig. 6.
The association of KDM2A with HCC and the effect of HBC on the expression of KDM2A in HCC cells. A The levels of KDM2A in HCC in the TCGA cohort. B The expression of KDM2A in HCC in the ICGC database. C The expression of KDM2A gene in HBV-associated HCC in the cohort from Gao, et al. D The expression of KDM2A protein in HBV-associated HCC in the cohort from the CPTAC database. E The levels of KDM2A in adjacent tissue and HBV-positive HCC detected by IHC assay. Scale bar, 50 μm. F The expression of KDM2A genes in HCC tissues without HBV and HCV infection (Non-HBV-HCV-HCC), HBV positive HCC tissues (HBV-HCC), and HCV positive HCC tissues (HCV-HCC) in ICGC HCC cohorts. G The relationship of KDM2A expression with age in HCC in the TCGA cohort. H The association of KDM2A expression with AFP levels in the TCGA cohort. I The association of KDM2A expression with neoplasm histologic grade in the TCGA cohort. J The association of RANGAP1 expression with KDM2A genes in the TCGA cohort. K The association of KDM2A with OS in HCC via univariate survival analysis. L The relationship of RANGAP1 with DFS in HCC through univariate survival analysis. M The effect of HBC on KDM2A protein expression in HCC cells that detected by western blot. N The effect of HBC on KDM2A mRNA expression in HCC cells that detected by real-time PCR. O The effect of HBV on KDM2A protein expression in HCC cells that detected by western blot. P The effect of HBV on KDM2A mRNA expression in HCC cells that detected by real-time PCR. Q The interaction of RANGAP1 with HBC was identified by Co-IP in HCC cells. R The colocation of RANGAP1 with HBC in HCC cells that detected by immunofluorescence. Scale bar, 10 μm. S The effect of HBC on the interaction between RANGAP1 and KDM2A in hepatoma cells. T The effect of RANGAP1 on the expression of KDM2A in HBC-associated HCC cells. U The effect of HBC on the interaction between SYVN1 and KDM2A in hepatoma cells. Mock: the cells transfected with control expression plasmid, HBC: the cells transfected with HBC expression plasmid, HBV: the cells transfected with HBV expression plasmid, HBC-shCON, HBC-positive HCC cells transfect with shRNA control plasmids, HBC-shRANGAP1, HBC-positive HCC cells transfect with shRNA plasmids targeting RANGAP1, *P < 0.05. The experimental data were performed from at least three independent determinations
As the results detected by the Co-IP assay combined with MS in Fig. 1A, HBC could interact with KDM2A. Here, we also examined the influence of HBC on KDM2A expression. The findings suggested that, in hepatoma cells, HBC could enhance the levels of KDM2A protein but did not influence the KDM2A mRNA (Fig. 6M-N). The role of HBV in increasing KDM2A protein levels was confirmed as well (Fig. 6O). Besides, the increase in KDM2A mRNA expression mediated by the virus was also found (Fig. 6P), suggesting that HBV may promote KDM2A gene expression through other viral proteins, except HBC. Relying on the Co-IP and immunofluorescence experiments, the interaction and colocation of HBC with KDM2A in HCC cells were observed (Fig. 6Q-R). As mentioned, RANGAP1 can interact with KDM2A, and HBC was capable of binding to RANGAP1, and here we investigated whether HBC enhanced the interaction between RANGAP1 and KDM2A. As the results showed in Fig. 6S, in comparison to control cells, the elevated interaction of RANGAP1 with KDM2A was discovered in HBC-expressing tumor cells. Because RANGAP1 facilitated the upregulation of KDM2A, we were interested in exploring whether the increase of KDM2A induced by HBC relied on RANGAP1. Consistent with the prediction, we found that after inhibiting RANGAP1 in HBC-expressing hepatoma cells, the enhanced protein levels of KDM2A mediated by the viral protein were restrained (Fig. 6T). Apart from these, our results have shown that RANGAP1 could inhibit the interaction between KDM2A and SYVN1 to benefit the expression of KDM2A. Because HBC could increase the expression of KDM2A via RANGAP1, we were also interested in investigating whether HBC also suppressed the interaction of KDM2A with SYVN1. Consistent with the prediction, compared to control cells, the reduced interaction between KDM2A and SYVN1 in HBC-positive HCC cells was discovered (Fig. 6U). Together, these results indicated that HBC can enhance the interaction of RANGAP1 with KDM2A but inhibit the interaction between KDM2A and SYVN1, and benefit the increase of KDM2A protein via RANGAP1 in HCC cells.
KDM2A enhances the growth and migration capacity of hepatoma cells induced by HBC
Until now, although KDM2A was found to be associated with hepatocarcinogenesis [17, 36], the exact role of KDM2A in the modulation of HCC cell growth and migration was not been well evaluated. Here, using the CCK-8 and cell cloning experiments, we discovered that, in vitro, the over-expressed KDM2A was capable of promoting the growth efficiency of HCC cells (Supplementary Fig. S2A-B). The increased migration of HCC cells was also noticed in KDM2A over-expressing tumor cells (Supplementary Fig. S2C-D). Relying on xenograft models in nude mice, the enhanced proliferation of HCC in vivo was discovered as well (Supplementary Fig. S2E-G). Next, the specific shRNA against KDM2A was constructed. The effect of the shRNA on inhibiting the protein expression of KDM2A was confirmed in HCC cells (Supplementary Fig. S2H). We further discovered that in HCC cells, the increased proliferation of liver cancer cells mediated by HBC could be prevented when the expression of KDM2A was restricted by its shRNA (Supplementary Fig. S2I-J). After KDM2A silencing, the migration capacity of HBC-positive HCC cells declined (Supplementary Fig. S2K-L). In the subcutaneous tumorigenesis model in nude mice, the role of KDM2A in enhancing the growth of HCC cells induced by HBC was also found (Supplementary Fig. S2M-O).
Discussion
To date, although current evidence indicates that HBC, a structural protein of HBV, contributed to HCC development [3], the mechanisms that facilitate hepatocarcinogenesis caused by the viral protein are still not clear. Here, we found that RANGAP1 and KDM2A were upregulated in HCC, especially in tumors with HBV infection. HBC could interact with these two molecules and enhance their protein expression in HCC. Functionally, RANGAP1 and KDM2A benefited the strengthening of the growth and motion capacity of liver cancer cells controlled by HBC. Furthermore, we discovered that the stabilization of RANGAP1 was increased in HBC-expressing HCC cells. Mechanistically, the enhancement of RANGAP1 stabilization regulated by HBC was dependent on the inhibition of the interaction between RANGAP1 and SYVN1. Besides these, we found the increase of KDM2A induced by HBC was dependent on RANGAP1, which disrupted the interaction of KDM2A with SYVN1 to enhance the stability of KDM2A (Fig. 7).
Fig. 7.
The pattern diagram of the molecular mechanisms responsible for the expression of RANGAP1 and KDM2A mediated by HBC to facilitate the proliferation and migration of HCC cells. HBC interacts with RANGAP1 and KDM2A. HBC blocks the ubiquitination-dependent degradation of RANGAP1 to promote its stabilization by inhibiting the interaction of RANGAP1 with SYVN1. Via RANGAP1, HBC increases the expression of KDM2A. RANGAP1 suppresses KDM2A ubiquitination regulated by SYVN1 to enhance the stabilization of KDM2A in HCC cells. The Figure was drawn relying on BioRender.com
To better find the molecules that were related to carcinogenesis induced by HBC, the Co-IP assay combined with MS was used by us. Among the identified proteins, RANGAP1 [7–9], a component of the nuclear pore complex, was chosen. Because although RANGAP1 contributes to the development of several cancers [7, 9, 10], the association of RANGAP1 with HCC is still unclear. Relying on bioinformatics analysis, RANGAP1 was discovered to be closely relevant to hepatitis B, pathways in cancer, and viral carcinogenesis (Fig. 1), and these results implied that RANGAP1 may facilitate hepatocarcinogenesis caused by HBV infection and that the molecule may take part in modulating the biological functions mediated by HBC. Consistent with expectations, the observations from different HCC cohorts indicated that the expression levels of RANGAP1 were elevated in HCC. Furthermore, the high levels of RANGAP1 were relevant to various clinical parameters, and significantly associated with the poor progress of patients with the tumor (Fig. 2). These findings suggested that RANGAP1 was a potential molecular target or served as a prognostic factor for liver cancer. Furthermore, our findings showed that RANGAP1 benefited the growth and migration of HBC-associated cancer cells (Supplementary Fig. S1), demonstrating that the molecule played vital roles in modulating these biological processes controlled by HBC in the tumor cells. Previous studies reported that RANGAP1 could regulate the cell cycle [10], and the modulation of this biological process might be relevant to the promotion of HCC cell growth controlled by RANGAP1. In smooth muscle cells, RanGAP1 has the capability of controlling the expression of p27Kip1 [37], a molecule responsible for cellular migration, and p27Kip1 might participate in RANGAP1-medicated HCC cell migration. In the future, more work is worthy to assess the molecules in the modulation of HCC cell growth and motion induced by RANGAP1.
It is worth noting that in comparison with adjacent tissues, the elevated expression levels of RANGAP1 were discovered in HCC caused by different etiological factors, including HBV and HCV infection, and the factors unrelated to HBV or HCV (Fig. 2F). The findings indicated that many factors may control the elevation of RANGAP1 expression in the tumor. Therefore, apart from HBV, the role and associated mechanisms relevant to other etiological factors in upregulating RANGAP1 in HCC are needed to assess in future work. Besides these, although HBC could elevate the expression of RANGAP1 at the protein level, HBV has the capability of enhancing RANGAP1 levels at both mRNA and protein levels (Fig. 1G-H). Until now, apart from HBC, the viral proteins, including HBX [38] and preS1 [39], also were reported to participate in the hepatocarcinogenesis induced by HBV via regulating different intracellular proteins. Therefore, it is reasonable to speculate that these viral proteins may enhance RANGAP1 mRNA expression to facilitate the development of HCC, and further investigation is worthy to confirm the prediction. Except for RANGAP1, other identified proteins with the ability to interact with HBC, including USP7 [40], HADHA [41], and MTDH [42] shown in Fig. 1A, play vital roles in hepatocarcinogenesis. Whether these proteins are closely relevant to the development of HCC induced by HBC is also needed to evaluate in future studies.
Especially, we discovered that, in HCC cells, HBC can enhance the expression of RANGAP1 at only its protein level (Fig. 1F-H). Given that the stability of intracellular proteins was mainly controlled by the ubiquitin-proteasome pathway [35], whether the stabilization of RANGAP1 mediated by HBC was closely relevant to the ubiquitination-dependent manner was estimated. As expected, our findings demonstrated that HBC could effectively increase its stability by inhibiting ubiquitination-mediated degradation (Fig. 3A-C). More importantly, we discovered that SYVN1, an E3 ligase that was implicated in hepatocarcinogenesis [43, 44], participated in the modulation of RANGAP1 degradation in a ubiquitination-dependent way (Fig. 3I-K). Moreover, our evidence demonstrated that, in HCC cells, the enhanced stabilization of RANGAP1 induced by HBC was relevant to the disruption of RANGAP1’s interaction with SYVN1 mediated by the viral protein (Fig. 3N).
Furthermore, the downstream molecules that could be regulated by RANGAP1 in HCC were assessed. In the study, KDM2A, a histone demethylase predicted by the PrePPI database, was chosen for evaluation. Because depending on the bioinformatics analysis, the molecule was also discovered to have a close association with hepatitis B, pathways in cancer, and viral carcinogenesis (Fig. 4A-C), which were similar to RANGAP1. Besides, previous reports have indicated the involvement of KDM2A in HCC development [17, 36], and our findings confirmed that the expression levels of KDM2A were obviously enhanced in the tumor and KDM2A was significantly related to different clinical parameters (Fig. 6A-J). We also detected the expression of KDM2A in HCC tissues with HBV or HCV infection, and in the cancer without HBV and HCV infection, based on the ICGC HCC cohort (Fig. 6F). The results indicated that HBV and HCV infection have a significant effect on the upregulation of KDM2A in the cancer tissues. The expressions of the KDM2A mRNA and its protein controlled by HBV in hepatoma cells were also measured (Fig. 6O-P). Similar to RANGAP1, the increase of KDM2A genes in the virus-positive HCC cells was discovered, in comparison with its control cells. These results suggest that, except HBC, other virus proteins encoded by HBV might contribute to the upregulation of KDM2A in the tumor cells, and it was needed to be further explored in future work.
In addition to these, RANGAP1 was further demonstrated to bind with KDM2A and the interaction facilitated the stabilization of KDM2A (Fig. 4). Interestingly, SYVN1 was also identified as an E3 ligase of KDM2A (Fig. 5A-G). Although our research indicated that SYVN1 could degrade RANGAP1, RANGAP1 was capable of disrupting the ubiquitination-dependent degradation of KDM2A mediated by SYVN1 (Fig. 5J-L). Furthermore, we discovered that HBC also had the capability of binding to KDM2A (Fig. 6M). Depending on RANGAP1, HBC upregulated KDM2A expression in HCC cells (Fig. 6T). Functionally, elevated KDM2A was necessary for the growth and motion of HBC-positive tumor cells (Supplementary Fig. 2). In bladder cancer, KDM2A can inhibit RARRES3 expression to facilitate the cancer cell proliferation and migration [13]. In ovarian cancer, KDM2A encourages cell growth and migration by controlling epithelial‑mesenchymal transition [45]. Besides these, KDM2A has the capability of enhancing cell proliferation and invasion by repressing DUSP3 to activate the ERK signaling pathway in non-small cell lung cancer [46]. In HCC cells, especially in HBV-associated tumor cells, the factors involved in the modulation of cell growth and movement mediated by KDM2A are still unknown. Therefore, more research is required to identify the KDM2A downstream molecules in HCC. Importantly, our results indicated that HBC could strengthen the interaction between RANGAP1 and KDM2A while weakening the interaction of KDM2A with SYVN1. Considering that HBC could interact with RANGAP1 and KDM2A, and RANGAP1 binds to KDM2A, it is reasonable to assume that HBC has the ability to form a protein complex, like a protein trimer, with RANGAP1 and KDM2A. Functionally, the protein complex can disrupt the degradation of RANGAP1 and KDM2A mediated by SYVN1 in HCC cells.
In conclusion, we discovered that HBC could interact with RANGAP1 and KDM2A and raise their protein levels in HCC to benefit the growth and movement of the tumor cells. SYVN1 was identified as an E3 ligase of both RANGAP1 and KDM2A. To enhance the stability of RANGAP1, HBC can interfere with the interaction between RANGAP1 and SYVN1. RANAP1 blocked the interplay between KDM2A and SYVN1 to benefit KDM2A expression. These discoveries could broaden a deeper comprehension of the effect and mechanisms relevant to RANGAP1 and KDM2A in HCC and lay an experimental foundation for providing potential therapeutic targets for HCC linked to HBV.
Supplementary information
Below is the link to the electronic supplementary material.
(DOCX 3.91 MB)
Author contributions
HY and LM equally contributed to the study. HY and LM performed the laboratory work and wrote the manuscript; XW, YW, HZ, EB, YZ, XL, and DK performed experiments and contributed to analyzing the data; KZ, FK, and RT designed the study and checked the data. All authors read and approved the final manuscript.
Funding
The study was supported by Xuzhou Technology Bureau Foundation (KC21065), the Natural Science Foundation of Jiangsu Province (BK20211347), the Natural Science Foundation of the Jiangsu Higher Education Institutions (21KJA310004), a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).
Data availability
All data in this work are in the manuscript and supplementary materials or available from the corresponding authors on reasonable request.
Declarations
Ethics approval
The work was followed by the principles of the Declaration of Helsinki. Approval was obtained from the ethics committee of Outdo Biotech Co., Ltd, and Xuzhou Medical University. The mice experiment was approved by the Animal Care and Use Committee of Xuzhou Medical University.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Hong-Juan You and Li-Hong Ma contributed equally to this work.
Contributor Information
Fan-Yun Kong, Email: kong.fanyun@163.com.
Ren-Xian Tang, Email: tangrenxian-t@163.com.
References
- 1.G.E.M. Rizzo, G. Cabibbo, A. Craxi, Hepatitis B virus-associated hepatocellular carcinoma. Viruses 14(5), 986 (2022) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Y. Jiang, Q. Han, H. Zhao, J. Zhang, The mechanisms of HBV-induced hepatocellular carcinoma. J. Hepatocell Carcinoma 8, 435–450 (2021) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.C. Lefeuvre, H. Le Guillou-Guillemette, A. Ducancelle, A pleiotropic role of the Hepatitis B Virus core protein in Hepatocarcinogenesis. Int. J. Mol. Sci. 22(24), 13651 (2021) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.F. Kong, Y. Tao, D. Yuan, N. Zhang, Q. Li, T. Yu, X. Yang, D. Kong, X. Ding, X. Liu, H. You, K. Zheng, R. Tang, Hepatitis B Virus core protein mediates the upregulation of C5alpha receptor 1 via NF-kappaB pathway to facilitate the Growth and Migration of Hepatoma cells. Cancer Res. Treat 53(2), 506–527 (2021) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.J. Du, F. Bai, P. Zhao, X. Li, X. Li, L. Gao, C. Ma, X. Liang, Hepatitis B core protein promotes liver cancer metastasis through miR-382-5p/DLC-1 axis. Biochim Biophys Acta Mol. Cell. Res. 1865(1), 1–11 (2018) [DOI] [PubMed] [Google Scholar]
- 6.F. Kong, N. Li, T. Tu, Y. Tao, Y. Bi, D. Yuan, N. Zhang, X. Yang, D. Kong, H. You, K. Zheng, R. Tang, Hepatitis B virus core protein promotes the expression of neuraminidase 1 to facilitate hepatocarcinogenesis. Lab. Invest. 100(12), 1602–1617 (2020) [DOI] [PubMed] [Google Scholar]
- 7.T.Y. Lin, K.C. Chen, H.J. Liu, A.J. Liu, K.L. Wang, C.M. Shih, MicroRNA-1301-Mediated RanGAP1 downregulation induces BCR-ABL Nuclear Entrapment to enhance Imatinib Efficacy in Chronic myeloid leukemia cells. PLoS ONE 11(5), e0156260 (2016) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Z. Boudhraa, E. Carmona, D. Provencher, A.M. Mes-Masson, Ran GTPase: a key player in Tumor Progression and Metastasis. Front. Cell. Dev. Biol. 8, 345 (2020) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.T.Y. Lin, C.C. Lee, K.C. Chen, C.J. Lin, C.M. Shih, Inhibition of RNA transportation induces glioma cell apoptosis via downregulation of RanGAP1 expression. Chem. Biol. Interact. 232, 49–57 (2015) [DOI] [PubMed] [Google Scholar]
- 10.K.C. Chang, W.C. Chang, Y. Chang, L.Y. Hung, C.H. Lai, Y.M. Yeh, Y.W. Chou, C.H. Chen, Ran GTPase-activating protein 1 is a therapeutic target in diffuse large B-cell lymphoma. PLoS ONE 8(11), e79863 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.L. Liu, J. Liu, Q. Lin, Histone demethylase KDM2A: Biological functions and clinical values (review). Exp. Ther. Med. 22(1), 723 (2021) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.L. Lu, Y. Gao, Z. Zhang, Q. Cao, X. Zhang, J. Zou, Y. Cao, Kdm2a/b lysine demethylases regulate canonical wnt signaling by modulating the Stability of Nuclear beta-catenin. Dev. Cell. 33(6), 660–674 (2015) [DOI] [PubMed] [Google Scholar]
- 13.B. Lu, J. Wei, H. Zhou, J. Chen, Y. Li, L. Ye, W. Zhao, S. Wu, Histone H3K36me2 demethylase KDM2A promotes bladder cancer progression through epigenetically silencing RARRES3. Cell Death Dis. 13(6), 547 (2022) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.L.L. Cao, C. Du, H. Liu, L. Pei, L. Qin, M. Jia, H. Wang, Lysine-specific demethylase 2A expression is associated with cell growth and cyclin D1 expression in colorectal adenocarcinoma. Int J Biol Markers. 33(4), 407–414 (2018) [DOI] [PubMed] [Google Scholar]
- 15.F. Wang, S. Liang, X. Liu, L. Han, J. Wang, Q. Du, LINC00460 modulates KDM2A to promote cell proliferation and migration by targeting mir-342-3p in gastric cancer. Onco. Targets Ther. 11, 6383–6394 (2018) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.H. Zhang, Y. Tu, B. Huang, J. Xiao, J. Xiao, J. Wang, Y. Pei, R. Yang, J. Feng, J. Li, X. Zhang, Histone demethylase KDM2A suppresses EGF-TSPAN8 pathway to inhibit breast cancer cell migration and invasion in vitro. Biochem. Biophys. Res. Commun. 628, 104–109 (2022) [DOI] [PubMed] [Google Scholar]
- 17.X. Huang, J. Pan, G. Wang, T. Huang, C. Li, Y. Wang, X. Li, UNC5B-AS1 promotes the proliferation, migration and EMT of hepatocellular carcinoma cells via regulating miR-4306/KDM2A axis. Cell Cycle 20(20), 2114–2124 (2021) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.H. You, D. Yuan, Y. Bi, N. Zhang, Q. Li, T. Tu, X. Wei, Q. Lian, T. Yu, D. Kong, X. Yang, X. Liu, X. Liu, F. Kong, K. Zheng, R. Tang, Hepatitis B virus X protein promotes vimentin expression via LIM and SH3 domain protein 1 to facilitate epithelial-mesenchymal transition and hepatocarcinogenesis. Cell Commun. Signal 19(1), 33 (2021) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.H. You, D. Yuan, Q. Li, N. Zhang, D. Kong, T. Yu, X. Liu, X. Liu, R. Zhou, F. Kong, K. Zheng, R. Tang, Hepatitis B virus X protein increases LASP1 SUMOylation to stabilize HER2 and facilitate hepatocarcinogenesis. Int. J. Biol. Macromol. 226, 996–1009 (2023) [DOI] [PubMed] [Google Scholar]
- 20.F. Kong, H. You, J. Zhao, W. Liu, L. Hu, W. Luo, W. Hu, R. Tang, K. Zheng, The enhanced expression of death receptor 5 (DR5) mediated by HBV X protein through NF-kappaB pathway is associated with cell apoptosis induced by (TNF-alpha related apoptosis inducing ligand) TRAIL in hepatoma cells. Virol. J. 12, 192 (2015) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.H. You, N. Zhang, T. Yu, L. Ma, Q. Li, X. Wang, D. Yuan, D. Kong, X. Liu, W. Hu, D. Liu, F. Kong, K. Zheng, R. Tang, Hepatitis B virus X protein promotes MAN1B1 expression by enhancing stability of GRP78 via TRIM25 to facilitate hepatocarcinogenesis. Br. J. Cancer 128(6), 992–1004 (2023) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.F. Kong, K. Zhou, T. Zhu, Q. Lian, Y. Tao, N. Li, T. Tu, Y. Bi, X. Yang, X. Pan, S. Li, H. You, K. Zheng, R. Tang, Interleukin-34 mediated by hepatitis B virus X protein via CCAAT/enhancer-binding protein alpha contributes to the proliferation and migration of hepatoma cells. Cell Prolif. 52(6), e12703 (2019) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.C. Yan, Q.Y. Zhou, J. Wu, N. Xu, Y. Du, J. Li, J.X. Liu, S. Koda, B.B. Zhang, Q. Yu, H.M. Yang, X.Y. Li, B. Zhang, Y.H. Xu, J.X. Chen, Z. Wu, X.Q. Zhu, R.X. Tang, K.Y. Zheng, Csi-let-7a-5p delivered by extracellular vesicles from a liver fluke activates M1-like macrophages and exacerbates biliary injuries. Proc. Natl. Acad. Sci. U. S. A. 118(46), e2102206118 (2021) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.R. Tang, F. Kong, L. Hu, H. You, P. Zhang, W. Du, K. Zheng, Role of hepatitis B virus X protein in regulating LIM and SH3 protein 1 (LASP-1) expression to mediate proliferation and migration of hepatoma cells. Virol. J. 9, 163 (2012) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.D. Szklarczyk, A.L. Gable, K.C. Nastou, D. Lyon, R. Kirsch, S. Pyysalo, N.T. Doncheva, M. Legeay, T. Fang, P. Bork, L.J. Jensen, C. von Mering, The STRING database in 2021: customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 49(D1), D605–D612 (2021) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.W. Hu, D. Liu, R. Li, H. Qian, W. Qiu, Q. Ye, F. Kong, Comprehensive analysis of TRIM family genes in Hepatitis Virus B-Related Hepatoma Carcinoma. Front. Genet. 13, 913743 (2022) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.A. Subramanian, P. Tamayo, V.K. Mootha, S. Mukherjee, B.L. Ebert, M.A. Gillette, A. Paulovich, S.L. Pomeroy, T.R. Golub, E.S. Lander, J.P. Mesirov, Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. U. S. A. 102(43), 15545–15550 (2005) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.A. Lachmann, D. Torre, A.B. Keenan, K.M. Jagodnik, H.J. Lee, L. Wang, Silverstein,A. Ma’ayan. Massive mining of publicly available RNA-seq data from human and mouse. Nat. Commun. 9(1), 1366 (2018) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Q. Gao, H. Zhu, L. Dong, W. Shi, R. Chen, Z. Song, C. Huang, J. Li, X. Dong, Y. Zhou, Q. Liu, L. Ma, X. Wang, J. Zhou, Y. Liu, E. Boja, A.I. Robles, W. Ma, P. Wang, Y. Li, L. Ding, B. Wen, B. Zhang, H. Rodriguez, D. Gao, H. Zhou, J. Fan, Integrated proteogenomic characterization of HBV-Related Hepatocellular Carcinoma. Cell 179(2), 561-577 e522 (2019) [DOI] [PubMed] [Google Scholar]
- 30.N.J. Edwards, M. Oberti, R.R. Thangudu, S. Cai, P.B. McGarvey, S. Jacob, S. Madhavan, K.A. Ketchum, The CPTAC Data Portal: a resource for cancer proteomics research. J. Proteome. Res. 14(6), 2707–2713 (2015) [DOI] [PubMed] [Google Scholar]
- 31.E.K. Tung, C.K. Mak, S. Fatima, R.C. Lo, H. Zhao, C. Zhang, H. Dai, R.T. Poon, M.F. Yuen, C.L. Lai, J.J. Li, J.M. Luk, I.O. Ng, Clinicopathological and prognostic significance of serum and tissue Dickkopf-1 levels in human hepatocellular carcinoma. Liver Int. 31(10), 1494–1504 (2011) [DOI] [PubMed] [Google Scholar]
- 32.S. Srivastava, K.F. Wong, C.W. Ong, C.Y. Huak, K.G. Yeoh, M. Teh, J.M. Luk, Salto-Tellez. A morpho-molecular prognostic model for hepatocellular carcinoma. Br. J. Cancer 107(2), 334–339 (2012) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Q.C. Zhang, D. Petrey, J.I. Garzon, L. Deng, B. Honig, PrePPI: a structure-informed database of protein-protein interactions. Nucleic Acids Res. 41(Database issue), D828-833 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Y. Li, P. Xie, L. Lu, J. Wang, L. Diao, Z. Liu, F. Guo, Y. He, Y. Liu, Q. Huang, H. Liang, D. Li, F. He, An integrated bioinformatics platform for investigating the human E3 ubiquitin ligase-substrate interaction network. Nat. Commun. 8(1), 347 (2017) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.F. Kong, H. You, D. Kong, K. Zheng, R. Tang, The interaction of hepatitis B virus with the ubiquitin proteasome system in viral replication and associated pathogenesis. Virol. J. 16(1), 73 (2019) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Q. Lin, Z. Wu, X. Yue, X. Yu, Z. Wang, X. Song, L. Xu, Y. He, Y. Ge, S. Tan, T. Wang, H. Song, D. Yuan, Y. Gong, L. Gao, X. Liang, C. Ma, ZHX2 restricts hepatocellular carcinoma by suppressing stem cell-like traits through KDM2A-mediated H3K36 demethylation. EBioMedicine 53, 102676 (2020) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.M. Vorpahl, S. Schonhofer-Merl, C. Michaelis, A. Flotho, F. Melchior, R. Wessely, The ran GTPase-activating protein (RanGAP1) is critically involved in smooth muscle cell differentiation, proliferation and migration following vascular injury: implications for neointima formation and restenosis. PLoS ONE 9(7), e101519 (2014) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.M.L. Dong, X. Wen, X. He, J.H. Ren, H.B. Yu, Y.P. Qin, Z. Yang, M.L. Yang, C.Y. Zhou, H. Zhang, S.T. Cheng, J. Chen, HBx mediated increase of DDX17 contributes to HBV-Related Hepatocellular Carcinoma Tumorigenesis. Front. Immunol. 13, 871558 (2022) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Z. Liu, X. Dai, T. Wang, C. Zhang, W. Zhang, W. Zhang, Q. Zhang, K. Wu, F. Liu, Y. Liu, J. Wu, Hepatitis B virus PreS1 facilitates hepatocellular carcinoma development by promoting appearance and self-renewal of liver cancer stem cells. Cancer Lett. 400, 149–160 (2017) [DOI] [PubMed] [Google Scholar]
- 40.T. Sakamoto, S. Kuboki, K. Furukawa, T. Takayashiki, S. Takano, A. Yoshizumi, M. Ohtsuka, TRIM27-USP7 complex promotes tumour progression via STAT3 activation in human hepatocellular carcinoma. Liver Int. 43(1), 194–207 (2023) [DOI] [PubMed] [Google Scholar]
- 41.Y. Liu, L.L. Lu, D. Wen, D.L. Liu, L.L. Dong, D.M. Gao, X.Y. Bian, J. Zhou, J. Fan, W.Z. Wu, MiR-612 regulates invadopodia of hepatocellular carcinoma by HADHA-mediated lipid reprogramming. J. Hematol. Oncol. 13(1), 12 (2020) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.C. Jin, D. Han-Hua, L. Qiu-Meng, N. Deng, D. Peng-Chen, M. Jie, X. Lei, Z. Xue-Wu, L. Hui-Fang, C. Yan, C. Xiao-Ping, Bi-Xiang. MTDH-stabilized DDX17 promotes tumor initiation and progression through interacting with YB1 to induce EGFR transcription in Hepatocellular Carcinoma. Oncogene 42(3), 169–183 (2023) [DOI] [PubMed] [Google Scholar]
- 43.F. Ji, M. Zhou, Z. Sun, Z. Jiang, H. Zhu, Z. Xie, X. Ouyang, L. Zhang, L. Li, Integrative proteomics reveals the role of E3 ubiquitin ligase SYVN1 in hepatocellular carcinoma metastasis. Cancer Commun. (Lond) 41(10), 1007–1023 (2021) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.L. Liu, H. Long, Y. Wu, H. Li, L. Dong, J.L. Zhong, Z. Liu, X. Yang, X. Dai, L. Shi, M. Ren, Z. Lin, HRD1-mediated PTEN degradation promotes cell proliferation and hepatocellular carcinoma progression. Cell Signal 50, 90–99 (2018) [DOI] [PubMed] [Google Scholar]
- 45.D.H. Lu, J. Yang, L.K. Gao, J. Min, J.M. Tang, M. Hu, Y. Li, S.T. Li, J. Chen, L. Hong, Lysine demethylase 2A promotes the progression of ovarian cancer by regulating the PI3K pathway and reversing epithelial–mesenchymal transition. Oncol. Rep. 41(2), 917–927 (2019) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.K.W. Wagner, H. Alam, S.S. Dhar, U. Giri, N. Li, Y. Wei, D. Giri, T. Cascone, J.H. Kim, Y. Ye, A.S. Multani, C.H. Chan, B. Erez, B. Saigal, J. Chung, H.K. Lin, X. Wu, M.C. Hung, J.V. Heymach, M.G. Lee, KDM2A promotes lung tumorigenesis by epigenetically enhancing ERK1/2 signaling. J. Clin. Invest. 123(12), 5231–5246 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(DOCX 3.91 MB)
Data Availability Statement
All data in this work are in the manuscript and supplementary materials or available from the corresponding authors on reasonable request.






