Abstract
Purpose
Taxol is the first-line chemo-drug for advanced non-small cell lung cancer (NSCLC), but it frequently causes acquired resistance, which leads to the failure of treatment. Therefore, it is critical to screen and characterize the mechanism of the taxol-resistance reversal agent that could re-sensitize the resistant cancer cells to chemo-drug.
Method
The cell viability, sphere-forming and xenografts assay were used to evaluate the ability of ASIV to reverse taxol-resistance. Immunohistochemistry, cytokine application, small-interfering RNA, small molecule inhibitors, and RNA-seq approaches were applied to characterize the molecular mechanism of inhibition of epiregulin (EREG) and downstream signaling by ASIV to reverse taxol-resistance.
Results
ASIV reversed taxol resistance through suppression of the stemness-associated genes of spheres in NSCLC. The mechanism exploration revealed that ASIV promoted the K48-linked polyubiquitination of EREG along with degradation. Moreover, EREG could be triggered by chemo-drug treatment. Consequently, EREG bound to the ErbB receptor and activated the ERK signal to regulate the expression of the stemness-associated genes. Inhibition of EREG/ErbB/ERK could reverse the taxol-resistance by inhibiting the stemness-associated genes. Finally, it was observed that TGFβ and Hedgehog signaling were downstream of EREG/ErbB/ERK, which could be targeted using inhibitors to reverse the taxol resistance of NSCLC.
Conclusions
These findings revealed that inhibition of EREG by ASIV reversed taxol-resistance through suppression of the stemness of NSCLC via EREG/ErbB/ERK—TGFβ, Hedgehog axis.
Supplementary Information
The online version contains supplementary material available at 10.1007/s13402-024-00999-7.
Keywords: Non-small cell lung cancer, Taxol-resistance, ASIV, Stemness, EREG
Introduction
Lung cancer is the leading cause of cancer mortality worldwide, especially in China [1]. NSCLC is the most predominant pathological subtype of lung cancer, accounting for approximately 85% of all events [2, 3]. Over 70% of NSCLC patients are currently diagnosed at an advanced stage [4]. Docetaxel was recommended by the National Institute for Health and Care Excellence for the treatment of patients with locally advanced or metastatic NSCLC. However, taxol treatment frequently resulted in resistance, as indicated by numerous studies that reported tumor recurrence or drug resistance in roughly 70% of treated patients [5, 6]. Resistance is a leading cause of therapeutic failure, hence limiting the clinical application of taxol in patients with advanced NSCLC [7]. As a result, it is crucial to screen for taxol-resistant reversal agents, which are critical for treating resistant NSCLC.
The chemoresistance and cancer relapse were attributed to cancer stem cells (CSCs) [8]. CSCs are a small subpopulation of cells within the tumor tissue which have the ability to self-renew and differentiate to form tumor. The leukemia stem cells were demonstrated in human acute myeloid leukemia for the first time [9]. Lung cancer stem cells were identified and isolated from lung cancer patients in 2017 [10]. Chemo-drugs treatment could eliminate the cancer cells; however, it also triggered the cancer cells to release factors which remodeled the niche of tumors and consequentially rendered the cancer cells to be resistant to chemo-drugs. Our previous study demonstrated that treatment with chemo-drugs promoted cancer cells to highly express epiregulin (EREG), thereby maintaining cancer stemness and chemo-drug resistance [11].
Recently, natural compounds derived from traditional Chinese medicine as resistance reversal agents have attracted much attention among the scientific community [12–15]. Small molecule compounds derived from natural products and their derivatives comprised over 30% of the Food and Drug Administration approved tumor resistance reversal agents [14]. Due to CSCs’ resistance to chemo-drugs, an increasing number of resistance reversal agents were focused on the CSCs [16]. However, the required concentration of resistance reversal agents which could kill the CSCs was extremely high, hence it also caused toxicity to the normal cells [17]. Therefore, we aimed to discover a natural compound that reverses the resistant cells into sensitive cells which could be eliminated by chemo-drugs subsequently. Astragalus membranaceus (AS) was commonly used in combination with chemo-drugs for the treatment of advanced NSCLC patients, and it has proven to have the ability to re-sensitize cancer cells to chemo-drugs, which indicated the potential of AS to reverse the resistance. However, whether ASIV, the main ingredient in AS, reverses the taxol resistance of NSCLC via inhibition of EREG remains unclear. Taken together, we aim to explore the function and mechanism of ASIV reversing taxol-resistance in NSCLC. Our findings validated the hypothesis whereby reversing the resistant status to sensitive status by targeting resistant genes or signaling pathways is a more effective approach to resolve resistance issues. Coupling this novel approach with the use of conventional chemo-drugs, it will be more effective than the drug alteration strategy that is frequently applied in clinical treatment.
Materials and methods
Drug preparation and storage
Taxol (MCE, Shanghai, China), ASIV (Yuanye, Shanghai, China), ASII (Yuanye) Selumetinib (Selleck, Shanghai, China), Afatinib (Selleck), Salinomycin (MCE), SB431542 (MCE) and Ciliobrevin A (MCE) were dissolved in 100% DMSO as stock concentrations. EREG (MCE) protein was dissolved in deionized H2O. All these drugs were stored at − 20 ℃ for long-term use.
Mice experiment
Experimental procedures used in the study were approved by the Institutional Animal Care and Use Committee of Shanghai University of Traditional Chinese Medicine. 5-week-old male BALB/c nude mice were purchased from a commercial company (Hangzhou Ziyuan Experimental Animal Technology Co., Ltd, Hangzhou, China). After 1 week of adaptive feeding, 1 × 107 cells were mixed with matrigel (Corning, Shanghai, China) at a 1:1 ratio, and then subcutaneously injected into the nude mice. Once the tumor formed after 4 weeks, the mice were randomly divided into four groups with 4 mice per group, including the vehicle group, taxol group, ASIV group, and combined group. The mice received intraperitoneal injections of DMSO, 10 mg/kg taxol or 20 mg/kg ASIV every 3 days for 2 weeks while the tumor’s length and width were measured. The volume of the tumors was calculated according to the formula (v = 0.5 × length × width2). The tumors were stripped out for weighting and fixation once the mice were euthanized after anesthesia.
Clinical samples
The clinical lung cancer tissues derived from the Huadong Hospital affiliated to Fudan University were approved by the Institutional Ethical Board and the immunohistochemistry staining procedures are conducted in accordance to the Belmont Report. The informed consent, written was obtained from all participants. The study adhered to the Declaration of Helsinki. The information about tumor specimens is available in Supplementary Table 3. The survival time and status of patients were extracted from Supplementary Table 4. The survival curves were plotted using GraphPad Prism (SCR_002798).
Immunohistochemistry
Antigen retrieval was performed with the microwave heat-induced epitope retrieval method. Tissue-chip was incubated with primary antibody at 4℃ overnight, followed by incubation with secondary antibodies at 37℃ for 1 h. The histology slides stained with HRP-conjugated secondary antibodies were incubated with the horseradish peroxidase (HRP) substrate, DAB for 2–5 min, then counterstained with haematoxylin and mounted for imaging using ECLIPSE 90i microscope (Nikon, Tokyo, Japan). The images were scanned by a digital pathological section scanner (Hamamatsu, Japan). The primary antibodies used in this study are listed in the Supplementary Table 2.
Cell culture
Cell culture was carried out as described by Fathi and Vietor with some modifications [18]. A549 (RRID: CVCL_0023), H1299 (RRID: CVCL_0060) and 293T (RRID: CVCL_0063) cells were ordered from the Cell Bank of the Chinese Academy of Sciences. A549-TR cell was established as previously described procedures [11]. A549, H1299 and A549-TR cells were cultured in RPMI-1640 medium (Gibco, MA, USA) with 10% fetal bovine serum (GeminiBio, CA, USA). 293T cells were cultured in DMEM medium (Gibco) with 10% fetal bovine serum. The EREG shRNA lentivirus was purchased from GenePharma company (Shanghai, China) with the target sequences, shEREG1 (GCTCTGACATGAATGGCTATT) and shEREG2 (GCATGGACAGTGCATCTATCT). The cells were infected with lentivirus and selected with 2 µg/mL of puromycin. The knocking-down cell was evaluated by western blotting. All experiments were performed using the cell lines of passages 10–15. All human cell lines have been authenticated using STR profiling within the last three years and all experiments were performed with mycoplasma-free cells.
Sphere-forming assay
The sphere formation assay was used to evaluate the stemness of cancer cells [10, 19], which was conducted in accordance to Zhao et al. [20]. Two thousand cells were cultured with a sphere-forming medium containing DMEM-F12 (Gibco), 1x B27 (Absin, Shanghai, China), 20 ng/mL EGF (Absin), and 20 ng/mL bFGF (Absin) in ultra-low adhesion 24 well plate at 37 ℃ incubator for 4–5 days. Spheres were imaged under a microscope and spheres larger than 50 µm in diameter were counted using image-J software (SCR_003070). The spheres were collected by spinning at 200 xg for 6 min. To study the effects of the chemo-drug on the inhibition of sphere-forming ability, the drugs were added into the SFM medium, concomitantly with the seeding of digested single cells. For sphere passaging, once the supernatant was removed, the spheres were incubated with 200 µL of trypsin at 37 °C for 30–60 s. Subsequently, the spheres were blown using a pipette and further incubated at 37 °C for another 30–60 s. Finally, the spheres were blown and resuspended in RPMI-1640 medium containing 10% fetal bovine serum. After centrifugation at 300 × g for 5 min, the digested single cells were used for passaging.
Cell viability assay
The cells were digested and resuspended to 3 × 104/mL. 100 μL resuspended cells were then seeded into 96 well plates. After overnight incubation, the medium was replaced with fresh medium containing drugs and the plates were incubated for another 48 hours. Detection of cell viability was done as described by Wu et al. [21]. 10 μL of CCK-8 (Bimake, Shanghai, China) reagent was added into each well and maintained for 2–4 hours. The absorbance was detected with a plate reader at a wavelength of 450 nm.
Quantitative RT-PCR
Quantitative RT-PCR analysis was performed in accordance with the protocol described by Adibkia et al. [22]. Total ribonucleic acid (RNA) was extracted using Trizol reagent (Invitrogen, MA, USA) and was reverse-transcribed into cDNAs using the StarScript II first-strand cDNA synthesis kit (Yeason, Shanghai, China), according to the manufacturer’s instructions. The cDNAs were amplified by quantitative RT-PCR using the Universal SYBR Green mix (Bimake). GAPDH was used as an internal reference to normalize the input cDNAs. All the RT-PCR primer sequences used in this study are listed in Supplementary Table 1.
Western blot
This experiment was conducted as described by Fathi et al. with some modifications [23]. Total proteins were extracted with RIPA buffer (MCE), followed by centrifugation at 16,000 × g for 10 minutes at 4 °C. Extracted proteins (20 μg) were denatured and separated in 10% SDS-PAGE gels. The separated protein bands were transferred onto the PVDF membrane. These blots were incubated with the primary antibodies at 4 °C overnight, followed by incubation with secondary antibodies at room temperature for 1 hour. After subsequent incubation with ECL solution (Genenorth, Beijing, China), the chemiluminescence signal on the blots was captured using the ChemiDox XRS + system (Bio-Rad, Hercules, CA). The primary antibodies used in this study are listed in the Supplementary Table 2.
Co-immunoprecipitation
The Flag-EREG and HA-ubiquitin plasmid were co-transfected into 293T cells using polyjet (Signagen, Shandong, China). After 48 h, the cells were harvested, and then lysate was extracted using the IP lysis buffer for 40 minutes on ice. The lysate was pre-cleared with 20 μL protein A/G (CMC, Milwaukee, WI) at 4 °C for 30–60 min. Subsequentially, the supernatants were incubated and rotated with 40–50 µL anti-Flag-conjugated resin beads at 4 °C for 3–16 hours. Finally, the pellets of protein-antibody-bead complexes were eluted with 3x Flag peptides (Scilight-Peptide, Beijing, China) for target protein complexes, which were then analyzed with western blots.
Differential gene analysis
The RNA was extracted from A549-TR, A549-TR treated with ASIV, shEREG-A549-TR and shEREG-A549-TR treated with ASIV for RNA sequencing (APExBio, Shanghai, China). The RNA-seq data was analyzed using the R studio workshop (SCR_000432) and the differential genes were calculated using the DEseq2 package. Afterwards, three groups were distributed as followings: ASIV group where A549-TR cells treated with ASIV compared to A549-TR cells; shEREG group where A549-TR cells reconstituted with shEREG compared to A549-TR cells reconstituted with shScramble; and shEREG-ASIV group where shEREG-A549-TR cells treated with ASIV compared to shEREG-A549-TR cells. The differential genes of three groups with 2 foldchange and p < 0.05 were presented in the volcano plot. The GESA analysis for KEGG was conducted using the differential genes.
Meta-analysis for SMDs and pooled HRs
A pooled standard mean difference (SMDs) > 0 implies that the gene expression was increased. A pooled SMDs < 0 implies that the gene expression was decreased. The survival curves of genes from RNA-seq analysis were plotted by online software using the Kaplan Meier plotter and gene expression profiling interactive analysis. The HRs and 95% CIs were applied to calculate the pooled HRs and 95% CIs. An HR > 1 implies that the patients who highly expressed those genes had a shorter survival time. Meta-analysis was performed using the STATA software, version 16.0 (SCR_012763). Detailed information for meta-analysis is available in the study published by Xu et al. [24].
Statistical analysis
Data were reported as means ± SEM of at least three replicates. Mean differences were compared using two-sided student’s t-tests. P value lesser than 0.05 was considered to be statistically significant. Error bars, mean ± SEM; n.s., p > 0.05; *, p < 0.05; **, p < 0.01.
Results
ASIV reversed the taxol-resistance of non-small cell lung cancer
The taxol-resistant A549 (A549-TR) cells were established and proved resistant to taxol whereas parental A549 was significantly killed by taxol (Fig. 1a). Importantly, A549-TR cells were found to have stemness with a greater ability to form spheres compared to parental A549 cells (Fig. 1b). To observe whether AS could resensitize the taxol-resistant cells to taxol, the serial concentration of AS was applied to treat the attached A549-TR cells with the assistance of taxol. Results showed that taxol could not inhibit A549-TR cells compared to DMSO when AS was absent, however, taxol significantly suppressed the A549-TR cells when AS was present at a serial concentration from 0.08 to 80 µg/mL (Fig. 1c). However, taxol inhibited the A549-TR cells with the presence of ASII at 97 µM (Fig. 1d). Surprisingly, taxol obviously suppressed the A549-TR cells with the presence of ASIV at concentrations ranging from 0.1 to 100 µM (Fig. 1e). This result indicated that ASIV, as the essential component of AS, could resensitize the taxol-resistant cells to taxol at low concentration. Consequently, ASIV was adopted to investigate whether they can re-sensitize the resistant spheres to taxol treatment. The findings revealed that the taxol-resistant spheres were not inhibited by taxol or ASIV individually, however, they were significantly decreased by taxol with the assistance of serial ASIV concentration in A549-TR cells (Fig. 1f). Similarly, ASIV treatment alone did not inhibit H1299 spheres, but a combination of ASIV with taxol could significantly suppress H1299 spheres as compared to taxol or ASIV alone, indicating ASIV could sensitize H1299 spheres to taxol (Fig. 1g). Furthermore, the nude mice were subcutaneously injected with taxol-resistant cells and subsequently treated with taxol or ASIV. The analysis of tumor volume and weight showed that ASIV did not inhibit the tumor growth, however, the combination of taxol and ASIV significantly inhibited the tumor growth compared to taxol treatment or ASIV treatment (Fig. 1h, i). Collectively, it could be concluded that ASIV could re-sensitize the taxol-resistant cancer cells to taxol rather than kill the resistant cancer cells.
Fig. 1.
ASIV reversed taxol resistance of NSCLC a The cell viability of the attached parental A549 and A549-TR cells treated with 117 nM taxol for 48 h (n = 3). b The images and statistical data of spheres of parental A549 and A549-TR cells (n = 4). c The cell viability of the attached A549-TR cells treated with a serial concentration of AS in combination with 117 nM taxol for 48 h (n = 3). d Cell viability of the attached A549-TR cells treated with a serial concentration of ASII in combination with 117 nM taxol for 48 h (n = 3). e Cell viability of the attached A549-TR cells treated with a serial concentration of ASIV in combination with 117 nM taxol for 48 h (n = 3). f The representative images and statistical data of A549-TR spheres treated with 0.1 µM, 1 µM and 10 µM ASIV plus 117 nM taxol (n = 6). g The representative images and statistical data of the H1299 sphere treated with 0.1 µM, 1 µM and 10 µM ASIV plus 117 nM taxol (n = 4). h Effect of taxol (10 mg/kg/3 days) or ASIV treatment (20 mg/kg/3 days) on subcutaneous tumors with A549-TR cells (n = 4 per group). i The weight of the subcutaneous tumors after treatment of taxol or ASIV for 15 days (n = 4 per group). SFA, sphere-forming ability; Scale bars, 100 μm in black; AS, Astragalus membranaceus; ASII, Astragalus saponin II; ASIV, Astragaloside IV; n.s., no significance; *, p < 0.05; **, p < 0.01
ASIV suppressed the expression of stemness-associated genes in taxol-resistant cancer cells
The passage ability of spheres represents the stemness of cancer cells. Our result showed that the passage ability of taxol-treated spheres was not abolished, however, the passage ability of ASIV-treated or combination-treated spheres was greatly impaired in the A549-TR spheres (Fig. 2a, b). This result implied that the stemness of cancer cells was inhibited by ASIV rather than taxol. To further confirm this, the expression of stemness-associated genes in taxol or ASIV-treated taxol-resistant spheres was evaluated. qPCR result revealed that the mRNA level of all stemness-associated genes was decreased by ASIV significantly (Fig. 2d). Contrarily, only the expression of MYC and BMI1 genes was suppressed by taxol (Fig. 2c). The pooled SMDs showed that ASIV significantly and dramatically decreased the expression of stemness-associated genes rather than taxol (Fig. 2e). Similarly, WB analysis revealed that all proteins of stemness-associated genes were not suppressed by taxol, but obviously decreased by ASIV treatment (Fig. 2f, g). Furthermore, the level of MYC, SOX2 and BMI1 did not decrease in the tumor tissues of mice treated with taxol, however, they were significantly decreased in the tumor tissues of mice treated with ASIV (Fig. 2h, i). Taken together, it was concluded that ASIV reversed the taxol resistance by inhibiting the stemness of lung cancer cells.
Fig. 2.
ASIV suppressed the stemness-associated genes in taxol-resistant cancer cells a The representative images and statistical data of A549-TR spheres or passaged spheres treated with 0.1 µM ASIV or 117 nM taxol. b The representative images and statistical data of H1299 spheres or passaged spheres treated with 0.1 µM ASIV or 24 nM taxol (n = 4). c, d qPCR detection of stemness-associated genes in A549-TR spheres treated with 117 nM taxol (c) and 0.1 µM ASIV (d) (n = 3). e The pooled SMDs for the expression of stemness associated genes in A549-TR spheres treated with 117 nM taxol or 0.1 µM ASIV. f, g WB detection of stemness-associated gene expression in the attached A549-TR cells treated with 117 nM taxol (f) or 0.1 µM ASIV (g). The samples were derived from the same experiment and gels/blots were processed in parallel for quantitative comparison. h, i The representative images (h) and quantitative analysis (i) of IHC staining for the expression of MYC, SOX2 and BMI1 in the xenografted mice treated with taxol or ASIV, n = 3. SMDs, standardized mean differences; CIs, confidence interval; Scale bar, 100 µm; SFA, sphere forming ability; n.s., no significance; *, p < 0.05; **, p < 0.01
ASIV degraded the EREG through K48-linked polyubiquitination
It is wondering whether ASIV reversed resistance by inhibiting EREG. Our analysis showed that the protein level rather than the mRNA level of EREG was inhibited by ASIV (Fig. 3a, b). Meanwhile, the downstream of EREG, p-ERK1/2 was also inhibited by ASIV (Fig. 3b). To explore whether the suppression of ASIV on EREG protein occurred via degradation, MG-132, a proteasome inhibitor that prevents protein degradation by reversibly inhibiting proteasome activity [25], was applied to treat the A549-TR cells together with ASIV. Further experiments showed that the EREG protein level was rescued when cells were treated with ASIV in combination with MG-132 (Fig. 3c). Therefore, it was hypothesized that the decrease of EREG protein upon ASIV treatment was through a degradation process. Since protein degradation is regulated by ubiquitin modification, subsequently the ubiquitin level of EREG protein was evaluated under ASIV treatment. The result revealed that the ubiquitin level of EREG protein was increased under ASIV treatment (Fig. 3d). The ability of ubiquitin is to create different types of chains via its lysine residues, where degradative K48-linkage type and non-degradative K63-linkage type are two well-known types of polyubiquitination chain type. K48-linked polyubiquitination is as a recognition tag for protein degradation by the proteasome [26]. Our experiment demonstrated that the ubiquitin modification of EREG was through the K48-linkage type of polyubiquitination (Fig. 3e), which further confirmed that EREG was degraded by ASIV treatment. Taken together, it was concluded that ASIV degraded EREG protein by promoting K48-linked polyubiquitination.
Fig. 3.
EREG was degraded by ASIV and associated with taxol-resistance in lung cancer a qPCR detection of EREG mRNA level in the attached A549-TR cells treated with 0.1 µM ASIV (n = 3). b WB detection of EREG, p-ERK1/2 in the attached A549-TR cells treated with 0.1 µM or 1 µM ASIV for 24 h. The samples were derived from the same experiment and gels/blots were processed in parallel for quantitative comparison. c WB detection and quantitative analysis of EREG in the attached A549-TR cells treated with 0.1 µM or 1 µM ASIV plus 5 μM MG-132. The samples were derived from the same experiment and gels/blots were processed in parallel for quantitative comparison. d WB detection of ubiquitination level of flag-EREG in cells treated with or without 0.1 µM ASIV, 2 independent experiments. e WB detection of K48- or K63-linked polyubiquitination of flag-EREG in cells treated with 0.1 µM ASIV, 2 independent experiments. f The IHC staining for EREG in lung cancer tissues from patients treated with or without chemo-drugs, LC, lung cancer. g The statistics for EREG expression in lung cancer tissues from patients treated with or without chemo-drugs. 15 untreated samples and 30 chemo-therapy samples. h The statistics for EREG expression in lung cancer tissues from patients treated with or without taxol-related drugs. 15 untreated samples and 12 taxol-treated samples. i The statistics data for EREG expression in different stages of lung cancer tissues from patients treated with chemo-drugs. j Survival curve of the patients with high EREG or low EREG populations after chemo-treatment. k Survival curve of the patients with high EREG or low EREG populations after taxol-treatment. ub, ubiquitin; K48, the K48-linked polyubiquitination; K63, the K63-linked polyubiquitination. Scale bar, 100 μm in black. *, p < 0.01; **, p < 0.01; n.s., no significance; HR, hazard ratio
EREG was associated with chemo-resistance in lung cancer patients
Thus far, it remains uncertain whether EREG is positively associated with taxol-resistance in clinical lung cancer patients. The immunochemistry staining of EREG on tumor tissues from clinical lung cancer patients was performed and the result showed that the EREG level was increased dramatically in tumor tissues treated with chemo-drugs (Fig. 3f, g). Apart from that, the EREG protein level was also increased in the patients who received taxol treatment compared to the patients who did not receive any chemo-drug treatment (Fig. 3h). Interestingly, there is no significant difference in EREG levels between the patients who were diagnosed from stages I–IV and under chemo-drug treatment (Fig. 3i), which indicated that EREG protein is expressed independently of the cancer stages. On the other hand, under the effects of chemo-drug treatment, patients with higher EREG level tend to have a shorter survival time compared to the patients with lower EREG level (Fig. 3j). Similarly, under taxol-related drug treatment, patients with higher EREG level also tended to have a shorter survival time when it was compared to the patients with lower EREG level (Fig. 3k). Therefore, these findings demonstrated that high expression of EREG was associated with taxol resistance.
Downregulation of EREG/ErbB/ERK signal pathway reversed taxol-resistance by regulating stemness of cancer
EREG cytokine was proven to activate ERK1/2 signaling (Fig. 4a). Besides, it had the ability to render the sensitive spheres to be resistant to taxol (Fig. 4b). Consequently, EREG was applied to treat the resistant spheres along with ASIV and taxol. The result exhibited that EREG treatment did not enhance the sphere-forming ability compared to vehicle, but it significantly increased the sphere-forming ability of cells treated with ASIV and taxol (Fig. 4c, d). Meanwhile, it was found that EREG could promote the expression of the stemness-associated genes significantly (Fig. 4e). Afterwards, the EREG was knocked down to observe whether shEREG could also reverse taxol resistance (Fig. 4f). The results showed that knockdown of EREG did not suppress the spheres. Surprisingly, shEREG had significantly suppressed spheres with the assistance of taxol treatment, which presented a similar effect to the combination of ASIV and taxol in A549-TR and H1299 spheres (Fig. 4g, h). Furthermore, the expression of stemness-associated genes was dramatically decreased when EREG was knocked down in the attached taxol-resistant cells (Fig. 4i). Taken together, it was concluded that inhibition of EREG by ASIV could reverse taxol resistance via stemness regulation. Afatinib was the specific inhibitor of ErbB, which is the receptor of EREG. Afatinib was proven to decrease the level of p-ERK1/2 and reverse the taxol resistance in A549-TR spheres, which is similar to ASIV (Fig. 4j, k). Simultaneously, the inhibition of ErbB also decreased the expression of stemness-associated genes in attached A549-TR cells (Fig. 4l). Additionally, the inhibitor of downstream ERK1/2, Selumetinib, was applied to observe whether the taxol resistance would be reversed. The result showed that inhibition of ERK1/2 also could reverse taxol-resistance (Fig. 4m). Similarly, inhibition of ERK1/2 also decreased the expression of stemness-associated genes in the attached taxol-resistant cells (Fig. 4n). Taken together, it is conclusive that inhibition of EREG by ASIV reversed taxol resistance through the EREG/ErbB/ERK signaling.
Fig. 4.
EREG/ErbB/ERK signaling contributed to taxol resistance by regulating cancer stemness a WB detection and quantitative analysis of p-ERK1/2 in the attached A549 cells treated with 100 ng/mL EREG for 0.5 h or 2 h. The samples were derived from the same experiment, and gels/blots were processed in parallel. b EREG increased the resistance ability of H1299 spheres to taxol (n = 3). c The representative images and statistics data of A549-TR spheres treated with 0.1 µM ASIV or 100 ng/mL EREG cytokine (n = 3). d The representative images and statistics data of H1299 spheres treated with 0.1 µM ASIV or 100 ng/mL EREG cytokine (n = 3). e qPCR detection of stemness marker of lung cancer in A549-TR spheres treated with 100 ng/mL EREG (n = 3). f WB detection and quantitative analysis of EREG in the attached A549-TR or H1299 cells reconstituted with shEREG. The samples derived from the same experiment and that gels/blots were processed in parallel. g, h The statistics data of A549-TR (g) or H1299 (h) spheres reconstituted with shEREG under the treatment of 0.1 µM ASIV or 117 nM taxol (n = 3). i qPCR detection of stemness associated genes in A549-TR spheres reconstituted with shEREG (n = 3). j WB detection of p-ERK1/2 in the attached A549-TR cells treated with 1 µM or 10 µM Afatinib for 12 h. The samples derived from the same experiment and that gels/blots were processed in parallel. k The statistics data of A549-TR spheres under the treatment of 0.1 µM ASIV, 117 nM taxol or 1 μM Afatinib (n = 3). l WB detection of stemness-associated genes in the attached A549-TR cells treated with 1 µM or 10 µM Afatinib for 12 h. The samples derived from the same experiment and that gels/blots were processed in parallel. m The statistics data of A549-TR spheres under the treatment of 0.1 µM ASIV, 117 nM taxol or 1 μM Selumetinib (n = 3). n WB detection of stemness-associated genes in the attached A549-TR cells treated with 1 µM or 10 µM Selumetinib for 12 h. The samples derived from the same experiment and that gels/blots were processed in parallel. TR, taxol-resistance; SFA, sphere forming ability; *, p < 0.01; **, p < 0.01; n.s., no significance; h, hour
ASIV and shEREG had a similar effect on transcriptome
The transcriptome of three groups was analyzed by RNA-seq. The differential genes from these three groups were presented by the volcanic map (Fig. 5a). Interestingly, it was found that most of the genes from the ASIV group overlapped with those from the shEREG group (Fig. 5b–d). However, the upregulated genes or downregulated genes did not overlap between the ASIV/shEREG group and the shEREG-ASIV group (Fig. 5c, d). The heatmap graphic also revealed that the differential genes were similar between the ASIV group and shEREG groups (Fig. 5e). However, the differential genes from shEREG-ASIV group showed an opposite pattern to that from the ASIV/shEREG group, which strongly demonstrated that the ability of ASIV to reverse taxol resistance was through EREG. Subsequentially, the pooled HRs with 95% CIs for overall survival (OS) and recurrence-free survival (RFS) of patients with high expression of genes compared to those with low expression of genes which were downregulated in the ASIV group were over 1. These findings indicated that the downregulated genes were positively associated with lung cancer (Fig. 5f, g). Consequently, Gene Set Enrichment Analysis revealed that the signaling pathway regulating pluripotency of stem cells was inhibited by ASIV or shEREG, however, it was not inhibited in the shEREG-ASIV group (Fig. 5h). Taken together, it implied that ASIV reversed taxol-resistance by inhibiting stemness signaling via EREG.
Fig. 5.
RNA-seq of the A549-TR cells treated with ASIV or shEREG a Volcano Plot for the differential genes with 2 foldchange and p value < 0.05 in ASIV group, shEREG group and shEREG-ASIV group among A549-TR spheres. (b–d) The overlapping differential genes of differential genes (b), up-regulated genes (c) and downregulated genes (d) among three groups: A, ASIV group; B, shEREG group; C, shEREG-ASIV group. e The heatmap of the 283 differential genes in A549-TR cells treated with 0.1 µM ASIV or shEREG. f, g The pooled HRs for OS (f) or RFS (g) of the 33 downregulated protein-coding genes in A549-TR cells under 0.1 µM ASIV treatment. h GESA analysis for signaling pathway regulating pluripotency of stem cell. TR, taxol-resistance; HR, hazard ratio; OS, overall survival; RFS, recurrence-free survival
The TGFβ and Hedgehog pathways were downregulated by ASIV through EREG/ErbB/ERK signaling
The WNT pathway [27], Hedgehog pathway [28] and TGFβ pathway [29] were reported to be associated with stemness regulation and the alteration of these three pathways were analyzed. Results showed that all three signaling pathways were downregulated in the ASIV group and shEREG groups, but they were not downregulated in the shEREG-ASIV groups (Fig. 6a–c). Afterwards, the inhibitors of these three signaling pathways were applied to treat resistant cells in combination with taxol. The result showed that Ciliobrevin A and SB431542 did not suppress the viability of the attached A549-TR and H1299 cells at 10 μM except for Salinomycin, but significantly reversed the taxol-resistance (Fig. 6d, e). Similarly, Ciliobrevin A and SB431542 also reversed the taxol-resistance of A549-TR and H1299 spheres at 10 μM (Fig. 6f, g). Furthermore, it was found that all stemness-associated genes were decreased by the Hedgehog signaling inhibitor, Ciliobrevin A (Fig. 6h). Only MYC, SOX2 and KLF4 were decreased by the TGFβ signaling inhibitor, SB431542. Contrarily, all the stemness-associated genes were increased by the WNT signaling inhibitor (Fig. 6h). Subsequently, the pooled SMDs for those genes were assessed and results revealed that both SB431542 and Ciliobrevin A inhibited the expression of stemness-associated genes rather than salinomycin (Fig. 6i). These findings indicated that inhibition of TGFβ and Hedgehog signaling pathways reversed the taxol-resistance of NSCLC via the downregulation of stemness-associated genes. To study whether the TGFβ and Hedgehog were downstream of ErbB and ERK, the p-Smad3, the key proteins of TGFβ signaling, and Gli1, the key proteins of Hedgehog, were analyzed in the resistant cells treated with Afatinib and Selumetinib. The result showed that p-Smad3 and Gli1 were decreased when ErbB and ERK were inhibited (Fig. 6j, k), which indicated that TGFβ and Hedgehog were downstream of ErbB/ERK. Collectively, it can be concluded that ASIV reversed the taxol-resistance of NSCLC by inhibiting TGFβ and Hedgehog pathways through EREG/ErbB/ERK signaling.
Fig. 6.
The TGFβ and Hedgehog pathways were downregulated by ASIV through EREG/ErbB/ERK signaling (a–c) GESA analysis for WNT pathway (a), TGF-β pathway (b) and Hedgehog pathways (c) enriched from differential genes in three groups; ES, enrichment score. d, e Cell viability of the attached A549-TR cells (d) and the attached H1299 cells (e) treated with taxol plus WNT signaling inhibitor (salinomycin), TGFβ signaling inhibitor (SB431542) and Hedgehog signaling inhibitor (Cilibobrevin A) for 48 h, n = 3. f, g The relative sphere-forming ability of A549-TR cells (f) and H1299 cells (g) treated with taxol combined with WNT signaling inhibitor (salinomycin), TGFβ signaling inhibitor (SB431542) and Hedgehog signaling inhibitor (Cilibobrevin A), n = 6. h qPCR detection of the stemness-associated genes in the H1299 spheres treated with respective 1 µM salinomycin, 1 µM SB431542 and 1 µM Cilibobrevin A (n = 3). i The pooled SMDs for the expression of stemness-associated genes in the H1299 spheres treated with respective 1 µM salinomycin, 1 µM SB431542, and 1 µM Cilibobrevin A. j WB detection of p-SMAD3, SMAD3 and Gli1 in the attached A549-TR cells treated with 1 µM and 10 µM Afatinib for 12 h. k WB detection of p-SMAD3, SMAD3 and Gli1 in the attached A549-TR cells treated with 1 µM Selumetinib for 12 h. TR, taxol resistance; *, p < 0.01; **, p < 0.01; n.s., no significance; N.D, no detection; ES, enrichment score; SMDs, standardized mean differences; CIs, confidence interval
Discussion
Chemo-drug resistance is a critical issue in clinical treatment for cancers. Therefore, drug resistance reversal agent screening is of significance for clinics. Traditional Chinese medicine was widely used in clinical treatment to assist in the treatment of tumors and improve their sensitivity to chemotherapy drugs [30, 31]. Astragalus injection (AGI) has been commonly employed as an adjuvant chemotherapy drug for NSCLC in China and is demonstrated to enhance the therapeutic effect while improving the quality of life of NSCLC patients receiving chemotherapeutics [32, 33]. These studies indicate that Astragalus or its components might have the ability to reverse drug resistance. ASII, a component of Astragalus membranaceous, has been proven to sensitize ovarian cancer and liver cancer to chemo-drugs [34–36]. However, there is no publication revealing the effects of ASII on the reversal of taxol-resistance. ASIV, another main component of AS, has also been proven to sensitize various cancers to chemo-drugs. Zheng et al. showed that ASIV increased taxol chemosensitivity in breast cancer cells via inhibiting CAV-1 expression [37]. Huang et al. demonstrated that ASIV could attenuate the resistance of breast cancer cells to taxol by significantly attenuating the hallmarks of breast cancer stemness [38]. Although no studies had shown the effects of ASIV on reversing the taxol-resistance of NSCLC, Lai et al. showed that ASIV could sensitize NSCLC to cisplatin by inhibiting endoplasmic reticulum stress and autophagy [39]. Our findings innovatively revealed that ASIV could reverse the taxol-resistant cells into sensitive cells which can be removed by the chemo-drugs in the two-dimensional culture system and three-dimensional culture system at low concentrations.
Previous studies clearly demonstrate that resistance reversal agents are designed to eliminate resistance cells, resulting in most agents functioning at high concentrations and causing severe side effects [17]. However, our study showed that ASIV reversed taxol resistance at 100 nM ASIV, without acting to suppress the cancer cells. Our further study revealed that the acquired taxol-resistant cells had a stronger sphere-forming ability compared to parental cells. The possible reason is that a higher percentage of CSCs existed in acquired resistant cells compared to parental cells. The evidence from previous studies reasons out that ASIV might inhibit the stemness of cancers to reverse chemoresistance [40, 41], which was also demonstrated by our findings where ASIV could inhibit the stemness of NSCLC, consequently reversing the taxol resistance. Because the effect of ASIV on the reversal of acquired taxol-resistance depends on the inhibition of stemness, it was found that the inhibition of sphere-forming ability was stronger than the inhibition of cell viability under the treatment of ASIV and taxol, which was due to that the percentage of CSC in two-dimensional culture was less than that in three-dimensional culture. Furthermore, it revealed that taxol increased the expression of Nanog and KLF4 at the protein level. One possible reason is that the proportion of cancer stem cells was increased in the spheres when taxol only killed the sensitive non cancer stem cells. Thus, suppressing the stemness of resistant cancers could reverse its resistance.
Numerous studies revealed the mechanism of ASIV in the suppression of chemoresistance of cancers [39, 42, 43], however, the mechanism of its regulation in cancer stemness remains unclear. ASIV, one of the saponins, is an amphiphilic compound composed of hydrophilic sugar parts and a lipophilic steroid or triterpene part [44]. Cholesterol has been identified as a critical factor for enhancing or facilitating permeabilization in most of the saponins [45, 46]. Although the current publications lack direct evidence to substantiate ASIV’s ability to penetrate the cells through membranes, it can be deduced that ASIV exhibits plasma membrane permeability based on indirect evidence where saponin could encapsulate and deliver nanoparticles into cells [47]. Due to the amphiphilic glycoside’s nature, ASIV could interact with both lipid and water-soluble proteins. In our study, ASIV was proven to have the ability to degrade EREG by promoting its polyubiquitination modification and consequently reversing the taxol chemoresistance. The underlying mechanism might be that ASIV interacts with the EREG protein due to its amphiphilic nature and consequently recruits ubiquitin E3 ligase, leading to EREG’s polyubiquitination and degradation [48]. However, more experimental evidence is necessary to fully support this hypothesis.
Besides, EREG did not only activate ERK signaling but also activate the signaling pathway which regulated the pluripotency of stem cells. Our study demonstrated that WNT, TGFβ1 and Hedgehog signaling pathways were downregulated under ASIV treatment and involved in the regulation of chemoresistance in spheres. Remarkably, an inhibitor of the WNT signaling pathway increased the expression of stemness-associated genes dramatically. A possible reason is that the effective concentration of salinomycin was lower than the other two inhibitors; consequently, 1 μm salinomycin directly resulted in the death of taxol-resistant cells instead of inhibition of cancer cell stemness of NSCLC. Contrarily, the SB-431542 and Cilibobrevin A at 10 µM did not kill the spheres but instead reversed the taxol resistance of NSCLC significantly.
Nevertheless, there still exist some limitations in this study. Firstly, the number of patients under chemo-drug treatment was limited, which resulted in the p-value was not less than 0.05. More patients will be included in the analysis in future. Moreover, the mechanism of TGFβ and Hedgehog signaling pathways in the regulation of stemness-associated gene expression also needs to be investigated further. Additionally, the application of a single Wnt inhibitor, salinomycin, may not exclusively conclude that Wnt signaling was not involved in regulatory pathways through the regulation of cancer stemness in taxol-resistant cells. Thus, other Wnt inhibitors will be applied in future experiments to make this conclusion more convincing.
Conclusion
Our findings innovatively revealed a chemoresistance reversal agent, ASIV, could promote the ubiquitin level of EREG, followed by the degradation of EREG. It has subsequentially resulted in the downregulation of ERK signaling and TGFβ and hedgehog signaling pathways, which consequently decreased the expression of stemness genes. Once the stemness of resistant cancer cells was decreased, this could re-sensitize the resistant cancer cells to chemo-drugs. This study has discovered a resistance reversal agent which could be a potential small molecule drug for the treatment of cancer chemoresistance. Additionally, inhibition of EREG/ErbB/ERK—TGFβ, Hedgehog—stemness genes axis is of clinical significance in solving the resistance issue of NSCLC.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
We would like to thank Li Qiang in the Shanghai University of Traditional Chinese Medicine for his help in the plasmid extraction. Our appreciation also goes to Ying Sun in the School of Medicine, Shanghai Jiao Tong University for his help in the R studio operation.
Abbreviations
- CI
Confidence interval
- EREG
Epiregulin
- HR
Hazard ratio
- NSCLC
Non-small cell lung cancer
- OS
Overall survival
- RFS
Relapse-free survival
- SFA
Sphere-forming ability
- SMD
Standardized mean difference
- TR
Taxol resistance
- ASIV
Astragaloside IV
Author contributions
X.W.H. participated in data acquisition, analysis, interpretation, and revised the manuscript. Z.Y.J. participated in data acquisition, analysis, and interpretation. T.D.F. conceived the study concept, interpretation, and revision of the manuscript. Z.R. contributed to data acquisition. L.S.H. contributed to the manuscript revision. Y.T.J., W.X.L., Q.C.T., Y.Y.X., H.X.D., Y.X.F., L.H., and L.Y.L. helped with the manuscript revision. S.Z.M. conceived the study concept and contributed to data interpretation. X.W. conceived the study concept, contributed to data acquisition, analysis, interpretation, drafted the manuscript, and revised the manuscript. The work reported in the paper has been performed by the authors unless clearly specified in the text. All authors read and approved the final manuscript.
Funding
Wei Xu has been funded by the NSFC grant (No. 82204673) and the budget research project of Shanghai University of Traditional Chinese Medicine (No.2021LK018). Yujia Zhang has been funded by the Medical Scientific Research Project of Jiangsu Provincial Health Commission (No. H2023140). All the funding bodies played no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.
Data availability
The datasets analyzed in the current study are available from the corresponding author on reasonable request. The RNA-seq raw data reported in this paper has been deposited in the Genome Sequence Archive in National Genomics Data Center (HRA004591) and the processed data has been deposited in the OMIX (OMIX004028), China National Center for Bioinformation/Beijing Institute of Genomics, Chinese Academy of Sciences. The direct link to the HRA004591 datasets is: https://ngdc.cncb.ac.cn/gsa-human/s/V6Svj4DR, while the direct link to the OMIX004028 is: https://ngdc.cncb.ac.cn/omix/preview/J1wW9hg5, which are available for editors and reviewers.
Declarations
Ethical approval
The clinical lung cancer tissues are approved by the Institutional Ethical Board of the huadong hospital. The mice experiment procedure was approved by the Institutional Animal Care and Use Committee of Shanghai University of Traditional Chinese Medicine.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Wenhao Xiu, Yujia Zhang and Dongfang Tang contributed equally to this work.
Contributor Information
Zhumei Sun, Email: sunzhumei2000@126.com.
Wei Xu, Email: wei-xu11@tsinghua.org.cn.
References
- 1.R.L. Siegel, K.D. Miller, H.E. Fuchs et al., Cancer statistics, 2021. CA Cancer J. Clin. 71, 7–33 (2021) [DOI] [PubMed] [Google Scholar]
- 2.A. Thomas, S.V. Liu, D.S. Subramaniam et al., Refining the treatment of NSCLC according to histological and molecular subtypes. Nat. Rev. Clin. Oncol. 12, 511–526 (2015) [DOI] [PubMed] [Google Scholar]
- 3.J. Rotow, T.G. Bivona, Understanding and targeting resistance mechanisms in NSCLC. Nat. Rev. Cancer 17, 637–658 (2017) [DOI] [PubMed] [Google Scholar]
- 4.W.D. Travis, E. Brambilla, G.J. Riely, New pathologic classification of lung cancer: relevance for clinical practice and clinical trials. J. Clin. Oncol. 31, 992–1001 (2013) [DOI] [PubMed] [Google Scholar]
- 5.P. Zhou, B. Li, F. Liu et al., The epithelial to mesenchymal transition (EMT) and cancer stem cells: implication for treatment resistance in pancreatic cancer. Mol. Cancer 16, 52 (2017) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.T.A. d’Amato, R.J. Landreneau, W. Ricketts et al., Chemotherapy resistance and oncogene expression in non-small cell lung cancer. J. Thorac. Cardiovasc. Surg. 133, 352–363 (2007) [DOI] [PubMed] [Google Scholar]
- 7.W.J. Liu, Y. Du, R. Wen et al., Drug resistance to targeted therapeutic strategies in non-small cell lung cancer. Pharmacol. Ther. 206, 107438 (2020) [DOI] [PubMed] [Google Scholar]
- 8.A. Kusoglu, C. Biray Avci, Cancer stem cells: a brief review of the current status. Gene 681, 80–85 (2019) [DOI] [PubMed] [Google Scholar]
- 9.T. Lapidot, C. Sirard, J. Vormoor et al., A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature 367, 645–648 (1994) [DOI] [PubMed] [Google Scholar]
- 10.Y. Zhang, W. Xu, H. Guo et al., NOTCH1 signaling regulates self-renewal and platinum chemoresistance of cancer stem-like cells in human non-small cell lung cancer. Cancer Res. 77, 3082–3091 (2017) [DOI] [PubMed] [Google Scholar]
- 11.Y. Zhang, F. Qiu, T. Ye et al., Epiregulin increases stemness-associated genes expression and promotes chemoresistance of non-small cell lung cancer via ERK signaling. Stem Cell Res. Ther. 13, 197 (2022) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.W.J. Huang, S. Ruan, F. Wen et al., Multidrug resistance of gastric cancer: the mechanisms and Chinese medicine reversal agents. Cancer Manag. Res. 12, 12385–12394 (2020) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Y. Zhao, C. Tang, J. Huang et al., Screening multidrug resistance reversal agents in traditional Chinese medicines by Efflux Kinetics of D-luciferin in MCF-7/DOX(Fluc) cells. ACS Omega 8, 4853–4861 (2023) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.J.S. Lou, P. Yao, K.W.K. Tsim, Cancer treatment by using traditional Chinese medicine: probing active compounds in anti-multidrug resistance during drug therapy. Curr. Med. Chem. 25, 5128–5141 (2018) [DOI] [PubMed] [Google Scholar]
- 15.L. Chen, Y.X. Xu, Y.S. Wang et al., Integrative Chinese-Western medicine strategy to overcome docetaxel resistance in prostate cancer. J. Ethnopharmacol. 331, 118265 (2024) [DOI] [PubMed] [Google Scholar]
- 16.Q. Zhang, Y. Feng, D. Kennedy, Multidrug-resistant cancer cells and cancer stem cells hijack cellular systems to circumvent systemic therapies, can natural products reverse this? Cell Mol. Life Sci. 74, 777–801 (2017) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.M. Kartal-Yandim, A. Adan-Gokbulut, Y. Baran, Molecular mechanisms of drug resistance and its reversal in cancer. Crit. Rev. Biotechnol. 36, 716–726 (2016) [DOI] [PubMed] [Google Scholar]
- 18.E. Fathi, I. Vietor, Mesenchymal stem cells promote caspase expression in Molt-4 Leukemia cells via GSK-3alpha/Beta and ERK1/2 signaling pathways as a therapeutic strategy. Curr. Gene. Ther. 21, 81–88 (2021) [DOI] [PubMed] [Google Scholar]
- 19.W. Zeng, J.F. Zhu, J. Guo et al., m(6)A-modified circFNDC3B inhibits colorectal cancer stemness and metastasis via RNF41-dependent ASB6 degradation. Cell Death Dis. 13, 1008 (2022) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.H. Zhao, C. Yan, Y. Hu et al., Sphereforming assay vs. organoid culture: determining longterm stemness and the chemoresistant capacity of primary colorectal cancer cells. Int. J. Oncol. 54, 893–904 (2019) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.C. Wu, L. Chen, H. Tao et al., RING finger protein 38 induces the drug resistance of cisplatin in non-small-cell lung cancer. Cell Biol. Int. 45, 287–294 (2021) [DOI] [PubMed] [Google Scholar]
- 22.K. Adibkia, A. Ehsani, A. Jodaei et al., Silver nanoparticles induce the cardiomyogenic differentiation of bone marrow derived mesenchymal stem cells via telomere length extension. Beilstein J. Nanotechnol. 12, 786–797 (2021) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.E. Fathi, R. Farahzadi, B. Valipour, Alginate/gelatin encapsulation promotes NK cells differentiation potential of bone marrow resident C-kit(+) hematopoietic stem cells. Int. J. Biol. Macromol. 177, 317–327 (2021) [DOI] [PubMed] [Google Scholar]
- 24.W. Xu, S.H. Lee, F. Qiu et al., Association of SMAD4 loss with drug resistance in clinical cancer patients: a systematic meta-analysis. PLoS One 16, e0250634 (2021) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.C. Shan, D. Ou, Y. Xiong et al., Molecular mechanism of anti-inflammatory effects of the proteasome inhibitor MG-132 on Con A-induced acute liver injury in mice. Res. Vet. Sci. 156, 60–65 (2023) [DOI] [PubMed] [Google Scholar]
- 26.A. Martinez-Ferriz, A. Ferrando, A. Fathinajafabadi et al., Ubiquitin-mediated mechanisms of translational control. Semin. Cell Dev. Biol. 132, 146–154 (2022) [DOI] [PubMed] [Google Scholar]
- 27.J.B. Cordero, O.J. Sansom, Wnt signalling and its role in stem cell-driven intestinal regeneration and hyperplasia. Acta Physiol. (Oxf) 204, 137–143 (2012) [DOI] [PubMed] [Google Scholar]
- 28.N. Takebe, L. Miele, P.J. Harris et al., Targeting Notch, Hedgehog, and Wnt pathways in cancer stem cells: clinical update. Nat. Rev. Clin. Oncol. 12, 445–464 (2015) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.C. Schug, S. Urnauer, C. Jaeckel et al., TGFB1-driven mesenchymal stem cell-mediated NIS gene transfer. Endocr. Relat. Cancer 26, 89–101 (2019) [DOI] [PubMed] [Google Scholar]
- 30.F. Qi, A. Li, Y. Inagaki et al., Chinese herbal medicines as adjuvant treatment during chemo- or radio-therapy for cancer. Biosci. Trends 4, 297–307 (2010) [PubMed] [Google Scholar]
- 31.W. Zhang, Y. Zhao, H. Liu et al., Efficacy of Traditional Chinese medicine combined with chemotherapy in the treatment of gastric cancer: a meta-analysis. Comput. Math. Methods Med. 2022, 8497084 (2022) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Y.H. Zou, X.M. Liu, Effect of astragalus injection combined with chemotherapy on quality of life in patients with advanced non-small cell lung cancer. Zhongguo Zhong Xi Yi Jie He Za Zhi 23, 733–735 (2003) [PubMed] [Google Scholar]
- 33.A. Cao, H. He, Q. Wang et al., Evidence of Astragalus injection combined platinum-based chemotherapy in advanced nonsmall cell lung cancer patients: a systematic review and meta-analysis. Medicine (Baltimore) 98, e14798 (2019) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.L. Zhang, Y. Liu, X. Lei et al., Astragaloside II enhanced sensitivity of ovarian cancer cells to cisplatin via triggering apoptosis and autophagy. Cell Biol. Int. 47, 1600–1613 (2023) [DOI] [PubMed] [Google Scholar]
- 35.C. Huang, D. Xu, Q. Xia et al., Reversal of P-glycoprotein-mediated multidrug resistance of human hepatic cancer cells by Astragaloside II. J. Pharm. Pharmacol. 64, 1741–1750 (2012) [DOI] [PubMed] [Google Scholar]
- 36.M. Wang, C. Huang, Y. Su et al., Astragaloside II sensitizes human hepatocellular carcinoma cells to 5-fluorouracil via suppression of autophagy. J. Pharm. Pharmacol. 69, 743–752 (2017) [DOI] [PubMed] [Google Scholar]
- 37.Y. Zheng, Y. Dai, W. Liu et al., Astragaloside IV enhances taxol chemosensitivity of breast cancer via caveolin-1-targeting oxidant damage. J. Cell Physiol. 234, 4277–4290 (2019) [DOI] [PubMed] [Google Scholar]
- 38.P. Huang, H. Li, L. Ren et al., Astragaloside IV enhances the sensitivity of breast cancer stem cells to paclitaxel by inhibiting stemness. Transl. Cancer Res. 12, 3703–3717 (2023) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.S.T. Lai, Y. Wang, F. Peng, Astragaloside IV sensitizes non-small cell lung cancer cells to cisplatin by suppressing endoplasmic reticulum stress and autophagy. J. Thorac. Dis. 12, 3715–3724 (2020) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.C.S. He, Y.C. Liu, Z.P. Xu et al., Astragaloside IV enhances cisplatin chemosensitivity in non-small cell lung cancer cells through inhibition of B7-H3. Cell Physiol. Biochem. 40, 1221–1229 (2016) [DOI] [PubMed] [Google Scholar]
- 41.Z. Liu, W. Zhang, J.B. Phillips et al., Immunoregulatory protein B7-H3 regulates cancer stem cell enrichment and drug resistance through MVP-mediated MEK activation. Oncogene 38, 88–102 (2019) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.X. Qu, H. Gao, J. Zhai et al., Astragaloside IV enhances cisplatin chemosensitivity in hepatocellular carcinoma by suppressing MRP2. Eur. J. Pharm. Sci. 148, 105325 (2020) [DOI] [PubMed] [Google Scholar]
- 43.Q. Ye, L. Su, D. Chen et al., Astragaloside IV Induced miR-134 expression reduces EMT and increases chemotherapeutic sensitivity by suppressing CREB1 signaling in colorectal cancer cell line SW-480. Cell Physiol. Biochem. 43, 1617–1626 (2017) [DOI] [PubMed] [Google Scholar]
- 44.J.H. Lorent, J. Quetin-Leclercq, M.P. Mingeot-Leclercq, The amphiphilic nature of saponins and their effects on artificial and biological membranes and potential consequences for red blood and cancer cells. Org. Biomol. Chem. 12, 8803–8822 (2014) [DOI] [PubMed] [Google Scholar]
- 45.J. Lorent, C.S. Le Duff, J. Quetin-Leclercq et al., Induction of highly curved structures in relation to membrane permeabilization and budding by the triterpenoid saponins, alpha- and delta-Hederin. J. Biol. Chem. 288, 14000–14017 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.J. Lorent, L. Lins, O. Domenech et al., Domain formation and permeabilization induced by the saponin alpha-hederin and its aglycone hederagenin in a cholesterol-containing bilayer. Langmuir 30, 4556–4569 (2014) [DOI] [PubMed] [Google Scholar]
- 47.A. Nicol, R.T.K. Kwok, C. Chen et al., Ultrafast delivery of aggregation-induced emission nanoparticles and pure organic phosphorescent nanocrystals by saponin encapsulation. J. Am. Chem. Soc. 139, 14792–14799 (2017) [DOI] [PubMed] [Google Scholar]
- 48.N. Zheng, N. Shabek, Ubiquitin ligases: structure, function, and regulation. Annu. Rev. Biochem. 86, 129–157 (2017) [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets analyzed in the current study are available from the corresponding author on reasonable request. The RNA-seq raw data reported in this paper has been deposited in the Genome Sequence Archive in National Genomics Data Center (HRA004591) and the processed data has been deposited in the OMIX (OMIX004028), China National Center for Bioinformation/Beijing Institute of Genomics, Chinese Academy of Sciences. The direct link to the HRA004591 datasets is: https://ngdc.cncb.ac.cn/gsa-human/s/V6Svj4DR, while the direct link to the OMIX004028 is: https://ngdc.cncb.ac.cn/omix/preview/J1wW9hg5, which are available for editors and reviewers.






