Abstract
The genetic manipulation of the human parasite Trypanosoma cruzi has been significantly improved since the implementation of the CRISPR/Cas9 technology for genome editing in this organism. Initially, the system was successfully used for gene knockout and endogenous C-terminal tagging in T. cruzi. Recently, an updated version of this technology has been used for gene complementation, site-directed mutagenesis, and N-terminal tagging in trypanosomatids. This cloning-free strategy, called CRISPR/T7RNAP/Cas9, is extremely useful for identifying essential genes when null mutants are not viable. Mutant cell lines obtained by this new system have been used for the functional characterization of proteins in different developmental stages of this parasite’s life cycle, including infective trypomastigotes and intracellular amastigotes. In this chapter we describe the methodology to achieve genome editing by CRISPR/T7RNAP/Cas9 in T. cruzi. Our method involves the generation of T. cruzi epimastigotes that constitutively express the T7 RNA polymerase (T7RNAP) and SpCas9, and their co-transfection with a sgRNA template and donor DNA(s) as PCR products. Using this strategy, we have generated genetically modified parasites in 2–3 weeks without the need for gene cloning, cell sorting, or having to perform several transfection attempts to verify the sgRNA efficiency for targeting the gene of interest. The methodology has been organized according to three main genetic purposes: gene knockout, gene complementation of knockout cell lines, and endogenous (N- or C-terminal) tagging in T. cruzi.
Keywords: CRISPR/Cas9, endogenous gene tagging, gene complementation, gene knockout, genome editing, T7 RNA polymerase, Trypanosoma cruzi
1. Introduction
CRISPR/Cas9 is a natural adaptive defense system in prokaryotes that has been repurposed as a very efficient genome editing tool in a wide variety of organisms [1–6]. The number of genetic interventions in pathogenic protists has considerably increased since the development of this technology [reviewed in 7–11]. Trypanosoma cruzi is the etiologic agent of Chagas disease, a tropical infectious disease considered a leading cause of disability and premature death in the Americas, for which there is no vaccine or satisfactory treatment available. Compared to other protozoan parasites, T. cruzi has been a particularly difficult organism to perform genetic interventions [12]. This scenario has changed radically since the implementation of the CRISPR/Cas9 technology in this pathogen [12, 13, reviewed in 14, 15] to study the role of different proteins, some of which play an important role in T. cruzi survival under environmental stress [16–27]. Originally, the CRISPR/Cas9 method we adapted to T. cruzi involved the co-transfection of epimastigotes with an expression plasmid harboring the Cas9 sequence and a specific single guide RNA (sgRNA), together with a template cassette (donor DNA) to promote double strand break repair by homologous directed repair (HDR) [13]. This methodology was successfully used to generate stable cell lines in 4–5 weeks without the need of cell sorting, selection of clonal populations, or more than one round of transfection to modify both alleles of the gene [13, 17]. However, the system required the cloning of a sgRNA sequence in an expression vector for T. cruzi, which is a time-consuming step that extended the protocol for 1–2 more weeks. To address this issue, we recently developed a cloning-free strategy, called CRISPR/T7RNAP/Cas9, that has been extremely useful to identify essential genes when null mutants are nonviable. Mutant cell lines obtained by this new system have been used for the functional characterization of proteins in different developmental stages of this parasite’s life cycle, including infective trypomastigotes and intracellular amastigotes. In this chapter we describe the methodology to achieve genome editing by CRISPR/T7RNAP/Cas9 in T. cruzi. This method involves the generation of T. cruzi epimastigotes that constitutively express the T7 RNA polymerase (T7RNAP) and SpCas9, and their co-transfection with a sgRNA template and donor DNA(s) as PCR products. Mutant cell lines generated through this method can be phenotypically evaluated to study protein function and to establish gene essentiality in T. cruzi. Each section has been organized according to three main aspects of this parasite’s genetic manipulation: gene knockout (KO), gene complementation and endogenous gene tagging, based on results generated in our laboratory using this technology [26–28].
2. Materials
2.1. Generation of a T7RNAP/Cas9-expressing cell line in Trypanosoma cruzi
T. cruzi Y strain epimastigotes (wild type).
pTREXn-T7RNAP/Cas9 plasmid [28].
Anti-HA antibody
Materials for transfection (subheading 2.5)
2.2. Cell culture
T7RNAP/Cas9 T. cruzi epimastigotes (T7RNA/Cas9).
Heat-inactivated fetal bovine serum (FBS) (storage temperature: −20 °C).
100× Penicillin (10,000 U/ml)/Streptomycin (10 mg/ml) stock solution (storage temperature: −20 °C).
G418 disulfate.
Sodium chloride (NaCl).
Potassium chloride (KCl).
Sodium phosphate dibasic (Na2HPO4).
D-(+)-glucose.
Liver infusion broth.
Trypticase™ peptone.
Hemin stock solution (20 mg/ml hemin, 1 N NaOH). Store at 4 °C, protected from light.
Liver infusion tryptose (LIT) medium (68 mM NaCl, 5.3 mM KCl, 56 mM Na2HPO4, 0.2% glucose, 0.5% liver infusion, 0.5% trypticase, 0.002% hemin, pH 7.3).
Incubator with refrigeration (28°C).
Neubauer chamber.
Biological safety cabinet (Class II).
T25 culture flasks.
2.3. Amplification of sgRNA template (124-bp DNA templates for sgRNA transcription)
10 μM sgRNA template forward primer (Fw_sgRNA). This primer contains the T7 promoter and a specific protospacer targeting the gene of interest (GOI). The protospacer is a 20-nt sequence upstream a protospacer-adjacent motif (PAM) in the GOI, that is recognized by the sgRNA by base complementarity and determines the cleavage site by the Cas9 nuclease.
10 μM sgRNA template common reverse primer (G00).
High-Fidelity DNA Polymerase (5 U/μl).
PCR Reaction Buffer.
10 mM dNTPs.
Agarose (molecular biology grade).
TAE buffer: 40 mM Tris–acetate, 1 mM EDTA, pH 8.3.
DNA molecular weight marker.
10 mg/ml ethidium bromide solution.
Dimethyl sulfoxide (DMSO).
Phenol-chloroform-isoamyl alcohol (25:24:1).
Ethanol.
Horizontal DNA electrophoresis system.
PCR Thermal Cycler.
UV transilluminator or Gel documentation system.
Microvolume spectrophotometer.
Tabletop microcentrifuge.
2.4. Preparation of donor DNAs
pMOTag23M plasmid for C-terminal tagging [29].
pMOTag-N23M for N-terminal tagging.
pBSD, plasmid containing Blasticidin-S-deaminase (BSD) gene [28].
pPAC, plasmid containing puromycin-N-acetyltransferase (PAC) gene [28].
Taq DNA Polymerase (5 U/μl).
DNA oligonucleotides (desalted purity).
Materials for PCR and DNA gel electrophoresis (items 5–18, Subheading 2.3)
2.5. Transfection of T. cruzi epimastigotes
T. cruzi T7RNAP/Cas9-expressing epimastigotes (T7RNAP/Cas9 cell line).
Materials for cell culture (subheading 2.2).
Electroporation buffer (120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4, 25 mM HEPES, 2 mM EDTA, 5 mM MgCl2, pH 7.6).
PBS (phosphate-buffered saline: 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4 pH 7.4).
Electroporation cuvettes 0.4 cm gap.
Puromycin dihydrochloride.
Blasticidin S dihydrochloride.
Hygromycin B
2.6. Genome editing verification
Genomic DNA (gDNA) extracted from control and transfectant T. cruzi epimastigotes.
DNA oligonucleotides (desalted purity).
Materials for PCR and DNA gel electrophoresis (items 5–11, 14–18 Section 2.3)
Anti-c-Myc antibody.
2.7. Gene KO complementation
Parental KO cell line
gDNA from T. cruzi wild type cell line
Materials for Transfection (subheading 2.5)
pTREXh-2xTy1 vector [27].
Materials for PCR and DNA electrophoresis (items 3–18, Section 2.3)
Chemically competent E. coli DH5α cells (storage temperature: −80 °C)
Plasmid DNA extraction kits for mini and midi preparations
DNA extraction kit from agarose gels
Restriction enzymes
T4 DNA ligase
LB broth
LB agar
Ampicillin sodium salt
SOC medium
Incubator with agitation (37 °C)
Sequencing facility.
Anti-Ty1 antibody.
3. Methods
3.1. Generation of a T7RNAP/Cas9-expressing cell line in Trypanosoma cruzi
To generate a T. cruzi cell line that constitutively expresses T7 RNA polymerase and SpCas9, T. cruzi epimastigotes must be transfected with the pTREXn-T7RNAP/Cas9 construct [28], that confers resistance to G418 (see subheading 3.6).
After selection of resistant parasites, clonal populations must be obtained by serial dilutions or cell sorting.
Check expression of Cas9 by western blot analysis using anti-HA antibody, and by direct observation of T. cruzi epimastigotes with green nuclei by fluorescence microscopy (see Note 1).
3.2. Protospacer selection
3.2.1. Protospacer selection for gene KO
Use the TriTrypDB database (http://tritrypdb.org/tritrypdb/) [30] to download the open reading frame (ORF) sequence of the GOI plus 200 nt upstream and downstream the start and stop codons, respectively (see Note 2).
For gene KO (through gene replacement or disruption with resistance markers) select the protospacer region inside the ORF of the GOI, but always between the homology regions 1 and 2 (HR1 and HR2) present in the donor DNA(s) (see Subheading 3.4.1 and Fig. 1).
Find protospacers by searching in the coding (sense) strand of the gene that has the same sequence as the mRNA, for 5’-N20-NGG-3’, where N20 is the protospacer and NGG is the PAM sequence. Alternatively, search for protospacers in the non-sense strand sequence for 5’-CCN-N20-3’. In the latter case, the reverse complementary sequence of the N20 will be the protospacer.
Verify that the selected protospacers do not generate Cas9 off-targeting on the T. cruzi genome by using online prediction tools like EuPaGDT (Eukaryotic Pathogen CRISPR guide RNA Design Tool, http://grna.ctegd.uga.edu/) [31].
Figure 1. Schematic representation of the T7RNAP/Cas9-based gene knockout strategy in Trypanosoma cruzi.

This system requires constitutive expression of Cas9 and T7RNAP, while sgRNA template and donor DNAs are PCR-generated. The sgRNA template, which includes a T7 promoter sequence, is transfected along with donor DNAs. The scheme shows the integration of the repair cassettes containing homologous regions (HR1 and HR2) after the specific double-strand break generated by the ribonucleoprotein. BSD, blasticidin-S deaminase; PAC, puromycin N-acetyltransferase; UTR, untranslated region. Horizontal black arrows indicate primers used for checking integration of donor DNA by PCR.
3.2.2. Selection of protospacer for endogenous gene tagging (N- and C-terminal)
Use the TriTrypDB database [30] to download the ORF sequence of the GOI plus about 200 nt upstream and downstream the start and stop codons to search a protospacer for N-terminus and a protospacer for C-terminus gene tagging, respectively (see Note 3).
For endogenous N-terminal tagging, the protospacer region should be selected in the sense or non-sense strand at the 5’ end of the gene, near the start codon (between 50 nt upstream and 20 nt downstream the start codon, but preferably upstream the start codon of the target gene) (see subheading 3.2.1, Figs. 2 and 3, and Note 4). Alternatively, for C-terminal tagging the protospacer region should be selected near the stop codon (between 20 nt upstream and 50 nt downstream the stop codon, but preferably downstream the stop codon of the target gene) (see subheading 3.2.1, Figs. 2 and 3, and Note 5).
Verify that the selected protospacers do not generate Cas9 off-targeting on the T. cruzi genome by using online prediction tools like EuPaGDT [31].
Figure 2. Schematic representation of the strategy for N-terminal, and C-terminal gene tagging with 3xc-Myc.

For endogenous N-terminal gene tagging (A), the Cas9 cut site should be selected upstream the start codon of the gene of interest (GOI), whereas for C-terminal gene tagging (B), the cut site of the endonuclease should be found close to the stop codon of GOI. After co-transfecting the sgRNA template with the donor cassette containing homologous regions HR1 and HR2, the induced DSB is repaired by HDR. Donor DNAs for performing N-terminal (A), and C-terminal (B) gene tagging are obtained by PCR amplification using plasmids pMOTagN23M and pMOTag23M as DNA template, respectively. Horizontal black arrows indicate primers used for checking integration of the donor DNAs by PCR. ATG, start codon, UTR, untranslated region; Igr, T. brucei tubulin intergenic region; PAC, puromycin N-acetyltransferase; HX1, T. cruzi trans-splicing region.
Figure 3. Molecular design for CRISPR/Cas9-mediated gene N- and C-terminal tagging by homology-directed repair.

As an example for the design strategy, the scheme shows the genomic DNA sequence of TcYC6_0111320, including the start codon (start, ATG, red sequence), the stop codon (stop, TAG, purple sequence), the chosen protospacers (highlighted sequence in cyan), the protospacer adjacent motifs (PAM, dark blue sequence) and the homology regions 1 (HR1) and 2 (HR2) (underlined in green and magenta). HR1 and HR2 are included in the 60-nt primers to produce a donor DNA cassette that will induce DNA repair by homologous recombination. The Cas9 cleaves the DNA exactly 3 nt upstream the PAM. Yellow and grey boxes enclose the designed strategy for endogenous gene N- and C-terminal tagging, respectively.
3.3. Amplification of sgRNA template
For each sgRNA template to be amplified design a Fw_sgRNA primer. Insert the specific 20-nt protospacer sequence (N20) into the primer backbone: 5’-GAAATTAATACGACTCACTATAGG-N20-GTTTTAGAGCTAGAAATAGC-3’ [32].
Use a common reverse primer G00 to amplify all the designed sgRNA template, called 5’AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’. The underlined regions in the Fw_sgRNA and RvG00 primers represent the DNA sequence annealing during PCR (see Note 6) [32].
Amplify the sgRNA template using a high-fidelity DNA polymerase, the specific forward primer, and the common reverse primer. The volume of PCR should be enough to obtain at least 25 μg of DNA product per transfection. PCR conditions using high-fidelity DNA polymerase following manufacturer’s instructions: initial denaturation step of 98 °C for 30 s, then 15 amplification cycles (98 °C for 10 s, 55 °C for 20 s, 72 °C for 15 s), followed by 25 amplification cycles (98 °C for 10 s and 72 °C for 20 s), followed by a final elongation step at 72 °C for 2 min and hold at 12 °C. The size of the PCR product should be 124 bp.
Visualize 10 μl of PCR product by 2% agarose gel electrophoresis in 1x TAE buffer containing 0.5 μg/ml ethidium bromide and purify the remaining PCR product volume by phenol/chloroform/isoamyl alcohol (25:24:1) extraction, followed by DNA precipitation with ethanol/sodium acetate 3M, pH 5.2. Resuspend the DNA in dH2O at a concentration ≥ 1.25 μg/μl.
Quantify the sgRNA template (precipitated PCR product) by standard spectrophotometry.
3.4. Preparation of donor DNAs
3.4.1. Preparation of donor DNAs for gene KO
Select two homologous regions of 40 and 37 bp (HR1 and HR2) preferably located right upstream the start codon (5′UTR) and right downstream the stop codon (3’UTR) of the target gene, respectively (see Notes 7–8).
The 60-bp primers to amplify the DNA cassettes to promote gene ablation by homologous directed repair will be designed as follow: The forward primer contains a 40-nt sequence corresponding to the HR1 plus a 20-nt sequence of the plasmid (pBSD/pPAC) backbone including the start codon of the resistance markers as follows: 5’-HR1-GCCGCGGGAATTCGATTATG-3’. The reverse primer consists of 37-nt sequence of the HR2 followed by 20-nt sequence of the plasmid (pBSD/pPAC) backbone and the four last nucleotides of the antibiotic resistance genes, including the stop codon: 5’-HR2-GCCGCGGGAATTCGATTATG-3’.
Prepare individual reactions to amplify the two donor DNAs containing the ORFs of BSD and PAC as resistance markers plus HR1 and HR2 using pBSD and pPAC as template, respectively. PCR conditions using Taq DNA polymerase: initial denaturation step of 2 min at 95°C, followed by 15 cycles of 20s at 95°C, 20s at 60°C, 55s at 72°C, then other 25 cycles of 20 s at 95°C, 1 min at 72°C, followed by a final elongation step of 5 min at 72°C. Expected sizes of donor DNAs are 515 bp and 715 bp for BSD and PAC resistant markers, respectively. Perform enough PCRs to obtain at least 25 μg of DNA product per transfection (see Note 9).
Load 10 μl of PCR product in a 1% agarose gel prepared in TAE buffer containing 0.5 μg/ml ethidium bromide to verify the fragment sizes and purify DNA by standard phenol/chloroform/isoamyl alcohol (25:24:1) extraction and ethanol/sodium acetate precipitation method. Resuspend the DNA in a volume of ultrapure water to reach a final concentration ≥ 1.25 μg/μl.
Quantify donor DNAs by spectrophotometry.
3.4.2. Preparation of donor DNA for endogenous C-terminal tagging
Select a 39-nt region upstream the stop codon of the gene to be tagged (HR1) and a 34-nt region downstream the Cas9 cut site on the protospacer (HR2). The Cas9 cut site is located 3 bp upstream the PAM sequence (see Notes 7–8, and Fig. 3).
Design primers to amplify a donor DNA for gene tagging. Forward and reverse primer sequences are 5’-HR1-GGTACCGGGCCCCCCCTCGAG-3’ and 5’-HR2 reverse complementary-TGGCGGCCGCTCTAGAACTAGTGGAT- 3’, respectively.
Amplify the donor DNA containing HR1, a tag sequence, a resistance marker, and HR2, using pMOTag23M vector (3xc-Myc tag and puromycin resistance gene) as template. PCR conditions using Taq DNA polymerase are: initial denaturation step of 95 °C for 2 min, 15 cycles (95 °C for 20 s, 63 °C for 15 s, 72 °C for 1 min and 40 s), and then 25 cycles (95 °C for 20 s, 72 °C for 1 min and 45 s), followed by a final elongation step at 72 °C for 5 min. Perform enough PCRs to obtain ≥ 25 μg of donor DNA per transfection.
Load 10 μl of PCR product in 1% agarose gel prepared in TAE buffer containing 0.5 μg/ml ethidium bromide to verify the fragment size (1.3 kb). Purify the remaining PCR product by phenol/chloroform/isoamyl alcohol (25:24:1) extraction and precipitate the donor DNA with ethanol/sodium acetate 3M, pH 5.2. Resuspend DNA in ultrapure water at a concentration ≥ 1.25 μg/μl.
Quantify the donor DNA by spectrophotometry.
3.4.3. Preparation of donor DNAs endogenous N-terminal tagging
Select two 39-nt regions, the first one (HR1) upstream the Cas9 cut site on the protospacer (3-nt upstream the PAM sequence), and the second one (HR2) starting at the start codon of the GOI (see Notes 7–8, and Fig. 3).
Design primers to amplify a donor DNA for gene tagging. Forward and reverse primer sequences are 5’-HR1-CCCTCGACAAAGTGTGACAAC-3’ and 5’-HR2 reverse complementary-AGAACCACTGCCGGCCGCACT- 3’, respectively.
Amplify the donor DNA containing HR1, a resistance marker, a tag sequence, and HR2, using pMOTagN23M vector (puromycin resistance gene and 3xc-Myc tag) as a template (see Note 10). PCR conditions using Taq DNA polymerase are: initial denaturation step of 95 °C for 2 min, 15 amplification cycles (95 °C for 20 s, 63 °C for 15 s, 72 °C for 1 min and 45 s), and then 25 amplification cycles (95 °C for 20 s, 72 °C for 1 min and 50 s), followed by a final elongation step at 72 °C for 5 min. Perform enough PCRs to obtain ≥ 25 μg of donor DNA per transfection.
Load 10 μl of PCR product in 1% agarose gel prepared in TAE buffer containing 0.5 μg/ml ethidium bromide to verify the fragment size (1.4 kb). Purify the remaining PCR product by phenol/chloroform/isoamyl alcohol (25:24:1) extraction and precipitate the DNA with ethanol/sodium acetate 3M pH 5.2. Resuspend the donor DNA in ultrapure water at a concentration ≥ 1.25 μg/μl.
Quantify the donor DNA by spectrophotometry.
3.5. Maintenance and growth of T. cruzi epimastigotes
Culture T. cruzi Y strain epimastigotes in LIT medium supplemented with 10% heat-inactivated FBS and 100 U/ml penicillin/streptomycin at 28 °C [33].
Count T. cruzi epimastigotes using a Neubauer chamber and determine cell density. T. cruzi culture manipulation should be carried out within a Class II microbiological safety cabinet.
3.6. Cell transfections
Grow T. cruzi epimastigotes until reaching a cell density of 1–2 × 107 cells/ml.
Centrifuge at 1,000 × g for 7 min.
Wash cells once in 1x PBS pH 7.4 at room temperature.
Centrifuge at 1,000 × g for 7 min.
Resuspend cells in ice-cold cytomix electroporation buffer at a density of 1 × 108 cells/ml.
For each transfection, add 400 μl of cell suspension to ice-cold 0.4 cm electroporation cuvettes and gently mix with 25 μg sgRNA template and 25 μg of donor DNA. For gene KO transfections, two donor DNA cassettes (BSD and PAC) will be transfected to ablate both alleles of the GOI. The total volume of DNA in the cuvette should not exceed 50 μl (see Note 11 and Fig. 4).
Add 10 μl of ultrapure water to one cuvette with cells to use as control for the electroporation and selection process.
Keep cuvettes with DNA/cells mixture on ice for 10 min.
Electroporate at 1.5 kV and 25 μF with 3 pulses using the exponential protocol of a Gene Pulser Xcell™ system (Bio-Rad). Leave cuvettes for ~1 min on ice between pulses (see Note 12).
Following the third pulse, let cuvettes at room temperature for 15 min for the recovery of the cells after electroporation.
Transfer cells to T25 culture flasks containing 5 ml LIT medium supplemented with 20% heat-inactivated FBS. Incubate at 28 °C.
Add antibiotics for selection 24 h after transfection. Transfected T. cruzi T7RNAP/Cas9-expressing epimastigotes should be maintained in medium containing 250 μg/ml G418 and 10 μg/ml blasticidin and/or 5 μg/ml puromycin, depending on the resistance marker present in the donor DNA(s) used for transfection (see Note 13).
Replace the medium with fresh LIT medium supplemented with 20% FBS and antibiotics once a week during the selection of resistant cells (2–3 weeks).
When double-resistant parasites reach a cell density of 1–2 × 107 cells/ml, they can be diluted and maintained in LIT medium supplemented with 10% FBS.
Figure 4. General strategy to generate T. cruzi knockout cell lines with the T7RNAP/Cas9-based system.

PCR amplified sgRNA template and two donor DNAs, containing PAC (puromycin N-acetyltransferase) and BSD (Blasticidin-S deaminase) resistant markers, are electroporated into T. cruzi epimastigotes with three pulses and then subjected to selection in the presence of blasticidin and puromycin.
3.7. Genome editing verification for gene KO
Analyze gDNA by PCR to verify the replacement/disruption of the target gene by the donor DNA molecule.
Design specific forward and reverse primers annealing upstream HR1 and downstream HR2, respectively. Usually, these primers anneal at the untranslated 5’ and 3’ regions (UTRs) of the target gene.
Isolate genomic DNA (gDNA) from double-resistant transfectants using standard protocols or commercial kits.
Perform PCR using gDNA from T7RNAP/Cas9 parental cell line and transfectant cells as template, and water instead of gDNA as negative control. PCR conditions will vary depending on PCR product size, primer composition, and DNA polymerase used for the assay.
Load 10 μl of PCR product in 1% agarose gel prepared in TAE buffer containing 0.5 μg/ml ethidium bromide to visualize the DNA fragments.
Calculate the fragment size difference between parental and KO parasites considering the length of the target gene replaced by the resistance markers used in the donor DNAs.
3.8. Gene complementation of KO cell lines generated by CRISPR/Cas9
To further assess the specificity of the phenotype exhibited by KO cell line, complement (add back) the ablated gene by transfecting an extra copy of it inserted in an expression vector for T. cruzi, such as pTREX-h-2xTy1, into the KO cell line (see Note 14).
Design a gene-specific forward and reverse primer to amplify the ORF of the GOI without the stop codon using wild-type T. cruzi genomic DNA as a template.
To verify the amplification, load 10 μl of PCR product in 1% agarose gel prepared in TAE buffer containing 0.5 μg/ml ethidium bromide and purify the remaining PCR product using a commercial kit.
Digest ≥ 1 μg of insert (purified PCR product of the GOI) and 3 μg of plasmid (pTREX-h-2xTy1) individually with the same pair of restriction enzymes and incubate the reactions overnight at 37°C. For this reaction, select a pair of restriction enzymes from the multiple cloning site (MCS) of the vector that are not present in the ORF of the GOI in the insert. Alternatively, perform any other cloning strategy (exonuclease-based, ligation-independent cloning (LIC), isothermal assembly, recombinase-based cloning, etc.) if unable to find appropriate restriction enzymes. The GOI without a stop codon should be in-frame with the 2xTy1 tag in the construct.
Analyze the digestion products by electrophoresis using a 1% preparative agarose gel containing 0.5 μg/ml ethidium bromide in TAE buffer. Extract the corresponding insert and vector DNAs using a commercial kit for DNA extraction from agarose gels.
Quantify the extracted DNA fragments by spectrophotometry.
Perform a ligation reaction as follows: mix pure digested fragments in a 3:1 insert-to-vector molar ratio. Add 3 units of T4 DNA ligase, ligation buffer, and ultrapure water to a final volume of 10 μl. Incubate overnight at 4°C.
Transform chemically competent DH5α E. coli cells by standard heat-shock transformation protocol using 5 μl of the ligation product. Recover transformed cells in SOC medium for 1 h at 37 °C with rapid shaking (200 rpm) and subsequently spread them on LB-agar plates supplemented with 100 μg/ml ampicillin. Incubate overnight at 37 °C.
Pick 2–4 colonies from transformed bacteria and culture them individually in 5 ml of LB broth supplemented with 100 μg/ml ampicillin overnight at 37 °C, and extract DNA using a plasmid miniprep kit.
Quantify extracted plasmids by spectrophotometry and verify the presence of the GOI by restriction analysis and Sanger sequencing.
For restriction analysis, resolve the digestion products by agarose gel electrophoresis, and select positive clones according to the expected insert and vector sizes.
Sequence positive clones (pTREXn-GOI-2xTy1) using FwHX1 (5’- CATTTTCACGCACGAAAGC-3’) and RvpTREXSeq (5’- TGCCTTGGAGTCGTAAATGG-3’) primers.
Prepare a 25-ml bacterial culture from a positive clone and extract DNA for transfection (Subheading 3.6) of KO epimastigotes to obtain the addback cell line.
For selection of addback epimastigotes in LIT medium use the following antibiotic concentrations: 250 μg/ml G418, 5 μg/ml puromycin, 10 μg/ml blasticidin, and 250 μg/ml hygromycin.
Replace the medium supplemented with 20% FBS and antibiotics once a week during the selection of resistant parasites (3–4 weeks).
When resistant parasites reach a cell density of 1–2 × 107 cells/ml, they can be maintained and diluted in LIT medium supplemented with 10% FBS.
Verify the expression of the protein of interest by western blot and immunofluorescence analysis using anti-Ty1 antibodies or antibodies recognizing the specific epitope tag present in the protein of interest.
3.9. Verification of endogenous N-terminal and C-terminal tagging
Analyze gDNA by PCR to verify the insertion of the tag and resistance marker at the 5’ or 3’ end of the GOI for N-terminal or C-terminal tagging, respectively.
Design specific forward and reverse primers annealing upstream HR1 and downstream HR2, respectively (Fig. 2).
Isolate genomic DNA from transfectants using standard protocols.
Perform PCR using gDNA from parental cell line (T7RNAP/Cas9) and transfectant parasites, and ultrapure water instead of gDNA as negative control. PCR conditions will vary depending on PCR product size, primer composition, and DNA polymerase.
Load 10 μl of PCR product in a 1% agarose gel prepared in TAE buffer containing 0.5 μg/ml ethidium bromide to verify the fragment sizes.
Confirm expression of tagged proteins by western blot analysis using anti-c-Myc antibodies. The expected size of the protein includes 6 kDa of the 3x-cMyc tag.
4. Notes
In the pTREXn-T7RNAP/Cas9 plasmid, a copy of the HA tag (a protein tag derived from the human influenza hemagglutinin protein) and GFP (green fluorescent protein) are located downstream the Cas9 sequence. Therefore, Cas9 is expressed with an HA tag and GFP fused to its C-terminus. The nuclease also contains a nuclear localization signal (NLS) that targets it to the nucleus.
T. cruzi strains exhibit a high genetic diversity. For this reason, it is very important to use the most similar genome sequence from TriTrypDB according to the current classification of T. cruzi strains [34]. For Y strain, use the T. cruzi YC6 genome available in TriTrypDB [35].
The decision of tagging a GOI at either the 5’ or the 3’ end (protein N- or C-terminus) depends on the structural features of the predicted protein, such as the presence of a signal peptide, or a C-terminal membrane-anchoring motif. Ideally, the tag should be placed in a location that does not interfere with the expression and function of the protein.
If the protospacer is located downstream the start codon, the HR1 (included in the forward primer) used to obtain the donor DNA should be modified by insertion of a silent mutation to eliminate the PAM sequence and thus avoid Cas9 cleavage of the GOI targeted by the specific sgRNA.
If the protospacer is located upstream the stop codon, the HR1 (included in the forward primer) used to obtain the donor DNA should be modified by insertion of a silent mutation to eliminate the PAM sequence and thus avoid Cas9 cleavage of the GOI targeted by the specific sgRNA.
The amplification of the sgRNA template is performed in the absence of a DNA template. The amplification occurs by sequence complementation of the 20-nt region at the 3’ end of the primers, generating a primer dimer that is extended by the DNA polymerase.
It is important to conserve as much as possible the 5’ and 3’ UTR regions of edited genes because they include sequence elements that are required for proper processing of mRNAs. In addition, if the information of the gene flanking regions is not available in the genome sequence, or if the designed strategy involves the interruption or partial elimination of the GOI, the sequences of HR1 and HR2 can include the coding region of the gene.
Homologous regions in the primers must be at least 30 nt. Primers to amplify the donor DNA are designed to be 60-nt long, including the common annealing region from the template plasmids.
It is recommended to add dimethyl sulfoxide (DMSO) to PCR reactions at a final concentration of 2.5% to help amplify templates that include the puromycin N-acetyltransferase (PAC) gene due to its high GC content.
The pMOTagN23M plasmid was generated from pMOTag2T plasmid (https://tryps.rockefeller.edu/trypsru2_plasmids_tagging_insitu.html) by removing the Ty1 tag and inserting downstream the PAC gene a copy of the T. cruzi HX1 trans-splicing sequence followed by three copies of the c-Myc tag.
It is strongly recommended that in addition to performing co-transfections of epimastigotes with the sgRNA template and two different resistant markers (donor DNAs), perform an alternative co-transfection with the sgRNA and only one donor DNA (either PAC or BSD). If parasites transfected with 2 resistance markers cannot be selected (non-viable parasites), those transfected with a single resistance marker (SKO) can be used to perform a second round of transfection following a two-step strategy for gene KO. If the second round of transfection does not allow the selection of KO parasites, the GOI is most likely essential for this developmental stage (T. cruzi epimastigotes).
This transfection protocol for T. cruzi epimastigotes has been optimized using the Gene Pulser XCell™ electroporation system (Bio-Rad). Transfection conditions should be standardized if a different device will be used.
The optimal antibiotic concentration for selection of transfectants should be determined for each particular T. cruzi strain before performing cell transfections. Antibiotic sensitivity varies due to several factors such as T. cruzi strain, maintenance period of the strain in laboratory conditions, and antibiotic commercial brand.
A T. cruzi expression vector that confers hygromycin resistance should be used for gene complementation, since the KO cell line is already resistant to G418, blasticidin, and puromycin.
Acknowledgments
Funding for this work was provided by the National Institute of Allergy and Infectious Diseases of the National Institutes of Health (Award number R00AI137322 to N. Lander and award number R21AI178573 to M. Chiurillo) and by the American Heart Association (Award number 23IPA1054779 to M. Chiurillo).
References
- 1.Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337 (6096):816–821. 10.1126/science.1225829 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339 (6121):819–823. 10.1126/science.1231143 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.DiCarlo JE, Norville JE, Mali P, Rios X, Aach J, Church GM (2013) Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res 41 (7):4336–4343. 10.1093/nar/gkt135 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Gratz SJ, Cummings AM, Nguyen JN, Hamm DC, Donohue LK, Harrison MM, Wildonger J, O’Connor-Giles KM (2013) Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics 194 (4):1029–1035. 10.1534/genetics.113.152710 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Jiang W, Zhou H, Bi H, Fromm M, Yang B, Weeks DP (2013) Demonstration of CRISPR/Cas9/sgRNA-mediated targeted gene modification in Arabidopsis, tobacco, sorghum and rice. Nucleic Acids Res 41 (20):e188. 10.1093/nar/gkt780 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Wang JY, Doudna JA (2023) CRISPR technology: A decade of genome editing is only the beginning. Science 379 (6629):eadd8643. 10.1126/science.add8643. [DOI] [PubMed] [Google Scholar]
- 7.Lander N, Chiurillo MA, Docampo R (2016) Genome editing by CRISPR/Cas9: a game change in the genetic manipulation of protists. J Eukaryot Microbiol 63 (5):679–90. 10.1111/jeu.12338 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Yagoubat A, Corrales RM, Bastien P, Lévêque MF, Sterkers Y (2020) Gene editing in trypanosomatids: tips and tricks in the CRISPR-Cas9 era. Trends Parasitol 36 (9):745–760. 10.1016/j.pt.2020.06.005 [DOI] [PubMed] [Google Scholar]
- 9.Pal S, Dam S (2022) CRISPR-Cas9: Taming protozoan parasites with bacterial scissor. J Parasit Dis 46 (4):1204–1212. 10.1007/s12639-022-01534-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hagen KD, Hart CJS, McInally SG, Dawson SC (2024) Harnessing the power of new genetic tools to illuminate Giardia biology and pathogenesis. Genetics 227 (2):iyae038. 10.1093/genetics/iyae038 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Webi E, Abkallo HM, Obiero G, Ndegwa P, Xie S, Zhao S, Nene V, Steinaa L (2024) Genome editing in apicomplexan parasites: current status, challenges, and future possibilities. CRISPR J 7 (6):310–326. 10.1089/crispr.2024.0032 [DOI] [PubMed] [Google Scholar]
- 12.Chiurillo MA, Lander N (2021) The long and winding road of reverse genetics in Trypanosoma cruzi Microb Cell 8 (9):203–207. 10.15698/mic2021.09.758 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Lander N, Li ZH, Niyogi S, Docampo R (2015) CRISPR/Cas9-induced disruption of paraflagellar rod protein 1 and 2 genes in Trypanosoma cruzi reveals their role in flagellar attachment. MBio 6(4):e01012. 10.1128/mBio.01012-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Peng D, Kurup SP, Yao PY, Minning TA, Tarleton RL (2015) CRISPR-Cas9-mediated single-gene and gene family disruption in Trypanosoma cruzi. MBio 6(1):e02097–02014. 10.1128/mBio.02097-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Lander N, Chiurillo MA (2019) State-of-the-art CRISPR/Cas9 technology for genome editing in trypanosomatids. J Eukaryot Microbiol 66 (6):981–991. 10.1111/jeu.12747 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Lander N, Chiurillo MA, Storey M, Vercesi AE, Docampo R (2016) CRISPR/Cas9-mediated endogenous C-terminal tagging of Trypanosoma cruzi genes reveals the acidocalcisome localization of the inositol 1,4,5-trisphosphate receptor. J Biol Chem 291 (49):25505–25515. 10.1074/jbc.M116.749655 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Chiurillo MA, Lander N, Bertolini MS, Storey M, Vercesi AE, Docampo R (2017) Different roles of mitochondrial calcium uniporter complex subunits in growth and infectivity of Trypanosoma cruzi. mBio 8 (3):e00574–17. 10.1128/mBio.00574-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Lander N, Chiurillo MA, Bertolini MS, Storey M, Vercesi AE, Docampo R (2018) Calcium-sensitive pyruvate dehydrogenase phosphatase is required for energy metabolism, growth, differentiation, and infectivity of Trypanosoma cruzi. J Biol Chem 293 (45):17402–17417. 10.1074/jbc.RA118.004498 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Bertolini MS, Chiurillo MA, Lander N, Vercesi AE, Docampo R (2019) MICU1 and MICU2 play an essential role in mitochondrial Ca2+ uptake, growth, and infectivity of the human pathogen Trypanosoma cruzi. mBio 10 (3):e00348–19. 10.1128/mBio.00348-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Chiurillo MA, Lander N, Bertolini MS, Vercesi AE, Docampo R (2019) Functional analysis and importance for host cell infection of the Ca2+-conducting subunits of the mitochondrial calcium uniporter of Trypanosoma cruzi. Mol Biol Cell 30 (14):1676–1690. 10.1091/mbc.E19-03-0152 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Chiurillo MA, Lander N, Vercesi AE, Docampo R (2020) IP3 receptor-mediated Ca2+ release from acidocalcisomes regulates mitochondrial bioenergetics and prevents autophagy in Trypanosoma cruzi. Cell Calcium 92 :102284. 10.1016/j.ceca.2020.102284 [DOI] [PubMed] [Google Scholar]
- 22.Dave N, Cetiner U, Arroyo D, Fonbuena J, Tiwari M, Barrera P, Lander N, Anishkin A, Sukharev S, Jimenez V (2021) A novel mechanosensitive channel controls osmoregulation, differentiation, and infectivity in Trypanosoma cruzi. Elife 10:e67449. 10.7554/eLife.67449 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Dos Santos GRR, Rezende Leite AC, Lander N, Chiurillo MA, Vercesi AE, Docampo R (2021) Trypanosoma cruzi Letm1 is involved in mitochondrial Ca2+ transport, and is essential for replication, differentiation, and host cell invasion. FASEB J 35 (7):e21685. 10.1096/fj.202100120RR [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Negreiros RS, Lander N, Chiurillo MA, Vercesi AE, Docampo R (2021) Mitochondrial pyruvate carrier subunits are essential for pyruvate-driven respiration, infectivity, and intracellular replication of Trypanosoma cruzi. mBio 12 (2):e00540–21. 10.1128/mBio.00540-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Bertolini MS, Docampo R (2022) MICU1 and MICU2 potentiation of Ca2+ uptake by the mitochondrial Ca2+ uniporter of Trypanosoma cruzi and its inhibition by Mg2+. Cell Calcium 107 :102654. 10.1016/j.ceca.2022.102654 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Chiurillo MA, Carlson J, Bertolini MS, Raja A, Lander N (2023) Dual localization of receptor-type adenylate cyclases and cAMP response protein 3 unveils the presence of two putative signaling microdomains in Trypanosoma cruzi. mBio. 14 (4):e0106423. 10.1128/mbio.01064-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Carlson J, Ahmed M, Hunter R, Hoque SF, Benoit JB, Chiurillo MA, Lander N (2024) TcCARP3 modulates compartmentalized cAMP signals involved in osmoregulation, infection of mammalian cells, and colonization of the triatomine vector in the human pathogen Trypanosoma cruzi. bioRxiv [Preprint]. 2024 Nov 21:2024.11.20.624561. doi: 10.1101/2023.07.09.548290 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Chiurillo MA, Ahmed M, González C, Raja A, Lander N (2023) Gene editing of putative cAMP and Ca2+-regulated proteins using an efficient cloning-free CRISPR/Cas9 system in Trypanosoma cruzi J Eukaryot Microbiol 70 (6):e12999. 10.1111/jeu.12999 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Oberholzer M, Morand S, Kunz S, Seebeck T (2006) A vector series for rapid PCR-mediated C-terminal in situ tagging of Trypanosoma brucei genes. Mol Biochem Parasitol 145 (1):117–120. 10.1016/j.molbiopara.2005.09.002 [DOI] [PubMed] [Google Scholar]
- 30.Aslett M, Aurrecoechea C, Berriman M, Brestelli J, Brunk BP, Carrington M, Depledge DP, Fischer S, Gajria B, Gao X, Gardner MJ, Gingle A, Grant G, Harb OS, Heiges M, Hertz-Fowler C, Houston R, Innamorato F, Iodice J, Kissinger JC, Kraemer E, Li W, Logan FJ, Miller JA, Mitra S, Myler PJ, Nayak V, Pennington C, Phan I, Pinney DF, Ramasamy G, Rogers MB, Roos DS, Ross C, Sivam D, Smith DF, Srinivasamoorthy G, Stoeckert CJ Jr, Subramanian S, Thibodeau R, Tivey A, Treatman C, Velarde G, Wang H (2010) TriTrypDB: a functional genomic resource for the Trypanosomatidae. Nucleic Acids Res 38(Database issue): D457–D462. 10.1093/nar/gkp851 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Peng D, Tarleton R (2015) EuPaGDT: a web tool tailored to design CRISPR guide RNAs for eukaryotic pathogens. Microb Genom 1 (4):e000033. 10.1099/mgen.0.000033 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Bassett A, Liu JL (2014) CRISPR/Cas9 mediated genome engineering in Drosophila. Methods, 69 (2)128–136. 10.1016/j.ymeth.2014.02.019 [DOI] [PubMed] [Google Scholar]
- 33.Bone GJ, Steinert M (1956) Isotopes incorporated in the nucleic acids of Trypanosoma mega. Nature 178:2. [DOI] [PubMed] [Google Scholar]
- 34.Zingales B, Andrade SG, Briones MR, Camp- bell DA, Chiari E, Fernandes O, Guhl F, Lages- Silva E, Macedo AM, Machado CR, Miles MA, Romanha AJ, Sturm NR, Tibayrenc M, Schijman AG (2009) A new consensus for Trypanosoma cruzi intraspecific nomenclature: second revision meeting recommends TcI to TcVI. Memorias do Instituto Oswaldo Cruz 104 (7):1051–1054. 10.1590/S0074-02762009000700021 [DOI] [PubMed] [Google Scholar]
- 35.Wang W, Peng D, Baptista RP, Li Y, Kissinger JC, Tarleton RL (2021) Strain-specific genome evolution in Trypanosoma cruzi, the agent of Chagas disease. PLoS Pathog 17(1):e1009254. 10.1371/journal.ppat.1009254 [DOI] [PMC free article] [PubMed] [Google Scholar]
