Nup107 is a crucial regulator of torso-mediated metamorphic transition in Drosophila melanogaster

Abstract

Nuclear pore complexes (NPCs), composed of nucleoporins (Nups), affect nucleocytoplasmic transport, thus influencing cell division and gene regulation. Nup107 subcomplex members have been studied in housekeeping functions, diseases, and developmental disorders. We report a unique regulatory function for Nup107 in metamorphic transition during Drosophila development. RNA interference (RNAi)-mediated Nup107-depleted larvae were arrested in the third-instar larval stage with no signs of pupariation. This lack of pupariation is primarily due to inhibited nuclear translocation and transcriptional activation by EcR. We demonstrate the involvement of Nup107 in the transcription of the Halloween genes, modulating ecdysone biosynthesis and the EcR pathway activation. The regulation of EcR-mediated metamorphosis by the receptor tyrosine kinase, torso, is well documented. Accordingly, overexpression of the torso and MAP-kinase pathway activator, ras^V12, in the Nup107 depletion background rescues the phenotypes, implying that Nup107 is an epistatic regulator of Torso-mediated activation of EcR signaling during metamorphosis.

eLife digest

Fruit flies are a widely used model organism for genetic and developmental studies because of their genetic similarity to humans. One example is the study of metamorphosis, the process during which flies develop from eggs into larvae, pupae, and ultimately adults. A comparable process in mammals is puberty, when juveniles mature into fully developed adults.

Puberty involves profound physical changes, such as the attainment of sexual maturity and the emergence of new social behaviors. These major life transitions are primarily regulated by hormonal signals from the brain, ovaries and adrenal glands. Imbalances in these hormones can delay or disrupt pubertal development. However, the underlying mechanisms remain incompletely understood.

To address this gap, Kawadkar et al. used established genetic tools to reduce or eliminate the nuclear pore complex protein Nup107 in fruit flies. This protein is essential for the movement of molecules between the nucleus and the surrounding space, the cytoplasm.

Reduced levels of Nup107 decreased ecdysone production, the steroid hormone needed to start metamorphosis. As a result, the development of fruit fly larvae was disrupted, with animals failing to progress efficiently to the pupal stage. Kawadkar et al. further showed that the ecdysone receptor did not properly move into the nucleus, where it would activate specific genes necessary for metamorphosis. This prevented gene expression essential for developmental progression.

The findings of Kawadkar et al. suggest that Nup107 may have a broader role in developmental processes that depend on steroid hormones. Indeed, in humans, Nup107 mutations are known to disrupt gonad development. In insects, the production of ecdysone is indirectly affected by Nup107. Supporting this, feeding synthetic ecdysone to Nup107-depleted larvae partially restored metamorphosis, allowing the animals to reach the pupal stage. Similarly, overexpressing the torso gene, which is part of the signalling pathway that stimulates ecdysone production, fully rescued timely metamorphosis, suggesting that activating the hormone pathway can compensate for the defects caused by reduced Nup107 levels.

Overall, these results clarify how Nup107 controls the production of the steroid hormone ecdysone at the start of metamorphosis in fruit flies. This work opens new avenues for investigating whether Nup107 performs similar roles during steroid hormone-dependent puberty in humans. Furthermore, these findings suggest that Nup107 may regulate broader neuroendocrine functions in the brain, with wide-ranging implications for the development of an organism.

Introduction

The multi-protein assembly of nucleoporins (Nups) constitutes nuclear pore complexes (NPCs). In eukaryotic cells, NPCs serve as molecular conduits for the trafficking of proteins and RNAs between the nucleus and the cytoplasm. The NPC composition, as ascertained from proteomic analyses conducted in yeasts and vertebrates, has contributed to our understanding, revealing that approximately 30 distinct Nups are arranged in sub-structures and are distributed on different faces of NPCs (Cronshaw et al., 2002; Rout et al., 2000). The substructures are the outer cytoplasmic and inner nuclear rings, which surround a central inner ring called the scaffold ring, primarily aiding in the process of nucleocytoplasmic transport (Lin and Hoelz, 2019).

The largest Nup107 sub-complex, also called the Y-complex, is symmetrically located on both sides of the nuclear membrane. In metazoans, the Y-complex is composed of 10 distinct Nups (ELYS, Nup160, Nup133, Nup107, Nup96, Nup85, Nup43, Nup37, Sec13, and Seh1). ELYS is a sub-stoichiometric Y-complex member and is present only on the nucleoplasmic side (D’Angelo and Hetzer, 2008; Morchoisne-Bolhy et al., 2015). Nup107, along with Nup133, forms the stalk of the Y-complex and is critically required for the Y-complex stability. The Nup107 complex plays a pivotal role in facilitating ELYS-coordinated post-mitotic NPC assembly (Boehmer et al., 2003; Walther et al., 2003) and messenger RNA (mRNA) export (Baï et al., 2004). Additionally, the Nup107 complex members actively participate in mitosis, contributing to the regulation of kinetochore-microtubule polymerization (Mishra et al., 2010; Zuccolo et al., 2007). The multitude of cellular processes in which the Y-complex performs vital functions suggests it to be a central component in maintaining cellular homeostasis.

As a stable constituent of NPC, many Nups, including the members of the Y-complex, associate with chromatin and exert transcriptional regulation. Notably, interactions between active genes and Nups occurring predominantly within the nucleoplasm have been reported for dynamic Nups such as Nup98, ELYS, and Sec13 (Capelson et al., 2010b; Kalverda et al., 2010; Kuhn et al., 2019). In Drosophila, the dual Nup, ELYS, governs the development, and ELYS RNA interference (RNAi)-induced developmental defects are due to the reactivation of the dorsal (NF-κB) pathway even during the late larval stages (Mehta et al., 2020).

Nup107 is associated with actively transcribing genes at the nuclear periphery (Gozalo et al., 2020). The disruption of Nup107 in zebrafish embryos leads to significant developmental anomalies, including the absence of the pharyngeal skeleton (Zheng et al., 2012). Moreover, the biallelic Nup107 mutations (D157Y and D831A) correlate well with clinical conditions such as microcephaly and steroid-resistant nephrotic syndrome (Miyake et al., 2015). In Drosophila, Nup107 co-localizes with Lamin during meiotic division, and Nup107 depletion perturbs Lamin localization, leading to a higher frequency of cytokinesis failure during male meiosis (Hayashi et al., 2016). Nup107 influences the regulation of cell fate in aged and transformed cells by modulating EGFR signaling and the nuclear trafficking of extracellular signal-regulated kinase (ERK) protein (Kim et al., 2010).

Drosophila undergoes elaborate metamorphosis initiated by the neuropeptide prothoracicotropic hormone (PTTH) (Rewitz et al., 2013). Bilateral neurons projecting into the prothoracic gland (PG), when stimulated by the PTTH, induce ecdysone production, which is subsequently released into the circulatory system for conversion by peripheral tissues into its active form, 20-hydroxyecdysone (20E) (Johnson et al., 2013; McBrayer et al., 2007; Shimell et al., 2018). The 20E binds to the ecdysone receptor (EcR), and the whole complex translocates into the nucleus and binds to chromatin to activate ecdysone-inducible genes (Johnston et al., 2011; Kozlova and Thummel, 2002; Tennessen and Thummel, 2011). In the PG, the primary neuroendocrine organ, PTTH signals through the receptor tyrosine kinase (RTK), Torso. The Torso-dependent activation of the MAP kinase pathway is responsible for the production and release of ecdysone hormone. However, ecdysone synthesis can also be regulated by the EGFR pathway (Cruz et al., 2020; Yamanaka et al., 2013). While Nup107 modulates EGFR pathway activation, the involvement of EGFR and torso pathways in ecdysone-dependent metamorphosis is undeniable. We dissect the involvement of Nup107 in Torso-mediated signaling and underlying mechanisms during Drosophila metamorphosis.

In a reverse genetic RNAi screening for Nup107 complex members, we noted that Nup107 RNAi induces a significant developmental arrest at the third instar larval stage. Further analysis revealed that the EcR signaling pathway is perturbed, and EcR fails to translocate into the nucleus in Nup107 knockdown. The failure of the EcR nuclear localization upon Nup107 depletion is due to significantly reduced ecdysone hormone levels during the late third instar larval stage. Interestingly, overexpression of the torso and the ras^V12 in Nup107-depleted larvae rescued the developmental arrest and subsequently initiated pupariation. We propose that Nup107, an epistatic regulator of torso pathway activation in the PG, enables ecdysone surge for efficient metamorphic transition.

Results

Nup107 is essential for larval-to-pupal metamorphic transition

Cell biological analyses in the mammalian cell culture system have shed light on critical regulatory roles of Nup107 in vertebrates. Yet its importance in development remains poorly understood. In this context, we started the characterization of Drosophila Y-complex member Nup107 in greater detail. Utilizing RNAi lines (Nup107^KK and Nup107^GD), we performed ubiquitous depletion through Actin5C-GAL4. Interestingly, Nup107 depletion led to larvae arrest at the third instar stage, causing complete cessation of pupariation (120 hr after egg laying [AEL], right panel, Figure 1A), which was accompanied by an extension of larval feeding and growth periods. Quantitative assessment of Nup107 transcript levels in the Nup107^GD and Nup107^KK RNAi lines suggested efficient Nup107 knockdown (approximately 60–70%, Figure 1B). For further analyses, we generated polyclonal antibodies against the Nup107 amino-terminal antigenic fragment (amino acids 1–210; see Materials and methods for details). Purified anti-Nup107 polyclonal antibodies detected a band of approximately ~100 kDa in lysates prepared from the control larval brain complex. The intensity of this ~100 kDa band was significantly reduced in lysates prepared from organisms where Nup107 was knocked down ubiquitously (Figure 1C) using Actin5C-GAL4 driving Nup107 RNAi (denoted as ubiquitous hereon). Further, the immunostaining with Nup107 antibodies identified a conserved and robust nuclear rim staining pattern overlapping with mAb414 antibodies recognizing FG-Nups and mRFP-tagged Nup107 expressed through its endogenous promoter (Figure 1—figure supplement 1) in salivary gland tissues. These observations confirm the efficacy of Nup107 knockdown and provide a handle to assess levels and localization of Nup107 in affected tissues. To further investigate the role of Nup107 in development, we generated a Nup107 null mutant using CRISPR-Cas9-mediated gene editing. This comprehensive approach involving RNAi-mediated knockdown and CRISPR-Cas9 gene editing is expected to provide valuable insights into the significance of Nup107 in Drosophila development. The gRNAs targeting regions close to the start and stop codons of the nup107 gene generated knockout (Nup107^KO) mutants, which were confirmed by sequencing and PCR (Figure 1—figure supplement 2). However, the Nup107^KO mutants could not be used as the Nup107^KO homozygous shows lethality at the embryonic stage. So, we carried out all the analyses hereon with Nup107 RNAi lines.

Figure 1. Nup107 depletion impairs metamorphosis.

Analysis of Nup107 depletion and its impact on growth and development of organism. (A) Growth profile of third instar larvae from Actin5C-Gal4-driven control and Nup107 knockdowns (Nup107^GD and Nup107^KK RNA interference [RNAi] lines) at 96 hr AEL (after egg laying) and 120 hr AEL. (B) Quantitation of Nup107 knockdown efficiency. Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. **p=<0.001 and ****p=<0.0001. (C) Immunodetection of Nup107 protein levels in third instar larval brain-complex lysates from control and Nup107 knockdown. (D) Quantification of Nup107 protein levels seen in (C). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ***p=<0.0002 and ****p=<0.0001. (E) Comparison of pupariation profiles of control and Nup107 knockdown organisms.

Figure 1—figure supplement 1. Nup107 staining in salivary glands.

(A-B) Custom-generated polyclonal anti-Nup107 antibody colocalizes with pan-FG-Nup antibody, mAb414 (A), and mRFP-tagged Nup107 (B) at the nuclear rim of the third instar salivary gland. DNA stained with DAPI. Scale bars, 20 µm.

Figure 1—figure supplement 2. Nup107 CRISPR mutant generation.

(A) Schematic representation of Nup107^KO generation. (Ai) The genomic locus of nup107 on chromosome-II (2L). The filled black box corresponds to the nup107 ORF (2779 bp) with gRNA(s) positions indicated by red arrows. The first and second gRNAs were designed near start and stop codons, respectively, of the nup107 locus. (Aii) Blue and green arrows indicate two sets of primers located in the 5’-UTR and 3’-UTR regions used for screening of Nup107 mutant. (Aiii) The black discontinuous line represents the nup107 (2752 bp) deletion allele. (B) Confirmation of Nup107 deletion mutant (heterozygous) line assessed by the presence of an ~630 bp band amplified from isolated genomic DNA.

Nup107 contributes significantly to ecdysone signaling

The depletion of Nup107 in Drosophila resulted in a distinct halt in growth and a developmental arrest at the third instar stage (Figure 1A). To discern the pathways affecting juvenile to adult developmental transition in Drosophila, we focused on levels of the sole insect steroid hormone, ecdysone.

We examined the localization of EcR in the late third instar salivary glands of both the control and Nup107-depleted larvae (using the Nup107^KK line). Wild-type larvae exhibited normal EcR localization within the nucleus, but the nuclear translocation of EcR is perturbed in the Nup107-depleted larvae, with the bulk of the signal retained in the cytoplasm (Figure 2A and B). Quantitative analysis of EcR intensities in the cytoplasm and nucleus further established a significant decrease in EcR signals inside the nucleus upon Nup107 depletion (Figure 2C). This observation suggests that Nup107 is required for EcR nuclear localization to mediate critical larval-to-pupal developmental transition. Furthermore, we noticed significantly smaller size salivary glands and the brain complex in Nup107-depleted larvae (Figure 2—figure supplement 1).

Figure 2. Ubiquitous knockdown of Nup107 disrupts ecdysone signaling.

Assessment of ecdysone receptor-dependent signaling in salivary glands of third instar larvae. (A–B) Staining of third instar larval salivary glands from control (A) and ubiquitous Nup107 knockdown (B) with ecdysone receptor (EcR) (anti-EcR antibody, red) and Nup107 (anti-Nup107 antibody, green). DNA is stained with DAPI. Scale bars, 20 μm. Charts represent the line scan intensity profile of EcR (red) and DAPI (cyan) in the salivary gland nucleus region. (C) Quantification of the nucleocytoplasmic ratio of EcR under control and Nup107 knockdown conditions. At least 45 nuclei were analyzed from seven to eight pairs of salivary glands. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ****p=<0.0001. (D–F) Analysis of ecdysone-inducible genes, EcR (D), Eip75A (E), and Eip74EF (F) expression, respectively, at the onset of metamorphosis (late third instar larvae stage). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. The error bars represent the SEM. ***p=<0.0004 and ****p=<0.0001.

Figure 2—figure supplement 1. Compromised organ size due to ubiquitous depletion of Nup107: Actin5C-Gal4 was used as a ubiquitous driver.

(A-B) Third instar larval salivary gland (A), and brain complex (B) images of Control, Nup107^KK RNAi and Nup107^GD RNAi. DNA stained with DAPI. Scale bars are 200 µm and 100 µm in (A) and (B), respectively.

Figure 2—figure supplement 2. Ubiquitous knockdown of Nup107 using Nup107^GD RNA interference (RNAi) disrupts ecdysone signaling.

(A–B) Staining of third instar larval salivary glands from control (A) and ubiquitous Nup107^GD knockdown (B) with ecdysone receptor (EcR) (anti-EcR antibody, red) and Nup107 (anti-Nup107 antibody, green). DNA is stained with DAPI, and scale bars, 20 μm. Charts represent the line scan intensity profile of EcR (red) and DAPI (cyan) in the salivary gland nucleus region. (C) Quantification of nucleocytoplasmic ratio of EcR under control and Nup107 knockdown conditions. At least 45 nuclei were analyzed from seven to eight pairs of salivary glands. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ****p=<0.0001. (D–F) Analysis of ecdysone-inducible genes, EcR (D), Eip75A (E), and Eip74EF (F) expression. Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. The error bars represent the SEM. ***p=<0.0007 and ****p=<0.0001.

Prompted by the cytoplasmic accumulation of EcR, we investigated whether the mRNA levels of ecdysone-inducible genes were affected. Under normal conditions, 20E binds with EcR, and the activated EcR occupies the ecdysone response element in the promoter region of genes. The EcR is thought to function in a positive auto-regulatory loop, which may elevate EcR levels and sustain ecdysone signaling (Varghese and Cohen, 2007). First, we examined the EcR transcript levels, revealing a reduction under Nup107 depletion conditions (Figure 2D). Subsequently, we measured the mRNA levels of known EcR target genes, Eip75A and Eip74EF, to find that the expression of each of these two target genes is reduced and correlates with Nup107 knockdown levels (Figure 2E and F). Similar results were observed in the depletion of Nup107 using the GD-based RNAi line (Figure 2—figure supplement 2). The defects observed during metamorphic transitions can be attributed to impaired ecdysone signaling in Nup107-depleted organisms, prompting a closer examination of their regulatory relationship.

Nup107 is dispensable for the nuclear import of EcR in the target tissue

We established that the nuclear localization of EcR is impaired upon Nup107 knockdown (see Figure 2B). Typically, EcR nuclear localization follows an intricate mechanism where the 20E binding allows nuclear translocation of EcR and subsequent activation of its target genes (Cronauer et al., 2007; Johnston et al., 2011; Lenaerts et al., 2019). Biosynthesis of ecdysone hormone from dietary cholesterol is a prerequisite for EcR activation and requires a group of P450 enzymes coded by the Halloween genes (Kannangara et al., 2021; Niwa and Niwa, 2014). Moreover, the involvement of nucleoporin, Nup358, in facilitating nuclear transport of Met juvenile hormone receptors is well documented (He et al., 2017). Consequently, we posited the hypothesis that Nup107 either regulates active 20E-EcR complex formation by affecting 20E biosynthesis in ubiquitous Nup107 knockdown scenarios or directly regulates EcR nuclear translocation in the target tissue.

We chose salivary glands to address these hypotheses and depleted Nup107 using salivary gland-specific AB1-GAL4 and PG-specific Phm-GAL4. Surprisingly, in contrast to the ubiquitous knockdown of Nup107, nuclear localization of EcR remained unaffected in salivary gland-specific Nup107 knockdown (Figure 3A and B and Figure 3—figure supplement 1). Interestingly, the PG-specific Nup107 knockdown phenocopied ubiquitous Nup107 knockdown-induced EcR nuclear localization defects (Figure 3C, Figure 3—figure supplement 1). Quantification of EcR signals from Nup107-depleted late third instar salivary gland cells and comparison with control salivary glands indicates that the nuclear/cytoplasmic ratios are drastically reduced in case of PG-specific depletion but unaltered in salivary gland-specific Nup107 depletion (Figure 3D, Figure 3—figure supplement 1). Consistent with these observations, expression levels of ecdysone-inducible genes Eip75A and Eip74EF were significantly reduced in PG-specific Nup107 knockdown (Figure 3E and F, Figure 3—figure supplement 1). In accordance with unperturbed EcR nuclear translocation, salivary gland-specific depletion of Nup107 yielded no discernible differences in larval growth and pupariation compared to the control (Figure 3—figure supplement 2). However, the PG-specific knockdown induced an extended third instar stage lifespan (10–12 days AEL, Figure 3—figure supplement 2). The observed decrease in ecdysone-inducible gene expression during late third-instar developmental stages can explain the potential impairment of metamorphosis induction seen upon ubiquitous or PG-specific Nup107 knockdown. In addition to the reduced size of the salivary gland and brain complex, we also noticed a compromise in the size of the PG upon Nup107 knockdown (Figure 3—figure supplement 3).

Figure 3. Targeted knockdown of Nup107 in the prothoracic gland (PG) perturbs ecdysone signaling pathway.

Analyzing the impact of tissue-specific Nup107 depletion on ecdysone receptor (EcR) signaling in third instar larval salivary glands. (A–C) Detection and quantitation of nucleocytoplasmic distribution of EcR (anti-EcR antibody, red) and Nup107 (anti-Nup107 antibody, green) in control (A), salivary gland-specific Nup107 depletion (B), and prothoracic gland-specific Nup107 depletion (C) from third instar larval salivary gland nuclei. DNA is stained with DAPI. Scale bars, 20 μm. Charts represent the line scan intensity profile of EcR (red) and DAPI (cyan) in the salivary gland nucleus region. (D) EcR nucleocytoplasmic quantification ratio from the salivary gland and prothoracic gland-specific Nup107 knockdown, respectively. At least 45 nuclei were analyzed from seven to eight pairs of salivary glands. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ****p=<0.0001, and ns is nonsignificant. (E–F) Quantitation of expression of Eip75A (E) and Eip74EF (F) ecdysone-inducible genes at the onset of metamorphosis (RNA isolated from late third instar larvae of control and prothoracic gland-specific Nup107 depletion). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. **p=<0.008 and ****p=<0.0001.

Figure 3—figure supplement 1. Nup107^GD RNA interference (RNAi)-mediated Nup107 depletion regulates ecdysone receptor (EcR)-dependent signaling.

(A–C) Detection and quantitation of nucleocytoplasmic distribution of EcR (anti-EcR antibody, red) and Nup107 (anti-Nup107 antibody, green) in control (A), salivary gland-specific Nup107^GD depletion (B), and prothoracic gland-specific Nup107^GD depletion (C) from third instar larval salivary gland nuclei. DNA is stained with DAPI. Scale bars, 20 μm. Charts represent the line scan intensity profile of EcR (red) and DAPI (cyan) in the salivary gland nucleus region. (D) EcR nucleocytoplasmic quantification ratio from salivary gland and prothoracic gland-specific Nup107 knockdown. At least 45 nuclei were analyzed from seven to eight pairs of salivary glands. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ****p=<0.0001, and ns is nonsignificant. (E–F) Quantitation of expression of Eip75A (E) and Eip74EF (F) ecdysone-inducible genes at the onset of metamorphosis (RNA isolated from late third instar larval stage). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ****p=<0.0001.

Figure 3—figure supplement 2. Nup107 regulates metamorphosis via ecdysone synthesis.

(A) Growth profile of third instar larvae from AB1-Gal4-driven control and Nup107 knockdowns (Nup107^KK and Nup107^GD RNA interference [RNAi] lines) at 96 hr AEL (hours after egg laying) and 120 hr AEL. (B) Growth profile of third instar larvae from Phm-Gal4-driven control and Nup107 knockdowns (Nup107^KK and Nup107^GD RNAi lines) at 96 hr AEL and 120 hr AEL. (C) Comparison of pupariation profiles of control and Nup107 knockdown organisms.

Figure 3—figure supplement 3. Nup107 depletion compromises the prothoracic gland (PG) size.

(A–C) PG-specific driver Phm-Gal4-driven expression of GFP in the PGs of the third instar larva image of control (A), Nup107^KK RNA interference (RNAi) (B), and Nup107^GD RNAi (C). DNA stained with DAPI. Scale bars, 20 µm.

These observations suggest that Nup107 exerts a regulation on ecdysone biosynthesis and active 20E-EcR complex formation rather than playing a direct role in EcR nuclear translocation.

Nup107 exerts control on the EcR pathway through ecdysone level regulation

We reasoned that Nup107 may regulate the ecdysone biosynthesis in PG to induce the larval stage growth arrest. We delved into analyzing the effect of Nup107 knockdown on ecdysone production. The considerable decrease in PG size due to Nup107 knockdown (Figure 3—figure supplement 3) can potentially reduce 20E production. This prompted us to explore the potential role of Nup107 in influencing ecdysone production, and we assessed the impact of Nup107 knockdown on ecdysone biosynthesis.

Utilizing an enzyme-linked immunosorbent assay (ELISA)-based detection method, we assessed 20E levels in larvae at 96 and 120 hr AEL. Larvae from different experimental conditions, including control, ubiquitous Nup107 depletion, and PG-specific Nup107 depletion, were used in this analysis. Strikingly, the results indicated a substantial decrease in total 20E levels upon Nup107 knockdown (approximately threefold and ninefold, respectively, for ubiquitous and PG-specific knockdown), particularly at 120 AEL, which coincides with the 20E surge seen during metamorphosis (Figure 4A, Figure 4—figure supplement 1). This observation is crucial and suggests a potential defect in ecdysone biosynthesis in Nup107-depleted organisms.

Figure 4. Nup107 critically regulates the expression of ecdysone-biosynthetic genes.

(A) Enzyme-linked immunosorbent assay (ELISA) measurements of whole-body 20-hydroxyecdysone (20E) levels in control, ubiquitous (Actin5C-Gal4), and prothoracic gland-specific (Phm-Gal4) Nup107 depletion at 96 and 120 hr after egg laying (AEL). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. *p=<0.032, **p=<0.0078, and ns is nonsignificant. (B) Schematic representation of a prothoracic gland cell showing genes involved in ecdysone biosynthesis from cholesterol. (C–G) Quantification of ecdysone-biosynthetic gene expression levels of spookier (C), phantom (D), disembodied (E), shadow (F), and shade (G) in cDNA isolated from control and Nup107 knockdown late third instar larvae. Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. **p=<0.001, ***p=<0.0005, and ****p=<0.0001. Created with BioRender.com.

Figure 4—figure supplement 1. Nup107^GD RNA interference (RNAi)-mediated depletion of Nup107 critically regulates the expression of ecdysone-biosynthetic genes.

(A) Enzyme-linked immunosorbent assay (ELISA) measurements of whole-body 20-hydroxyecdysone (20E) levels in control and prothoracic gland-specific (Phm-Gal4) Nup107^GD depletion at 96 and 120 hr after egg laying (AEL). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. **p=<0.0025, and ‘ns’ is nonsignificant. (B–F) Quantification of ecdysone-biosynthetic gene expression levels of spookier (B), phantom (C), disembodied (D), shadow (E), and shade (F) in cDNA isolated from control and Nup107 knockdown late third instar larvae. Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ****p=<0.0001, ***p=<0.0005, **p=<0.001, and *p=<0.03.

As depicted in Figure 4B, the PTTH hormone signaling in the PG upregulates the expression of Halloween genes (spookier, phantom, disembodied, and shadow) responsible for ecdysone biosynthesis, and the shade gene product is required for active 20E generation in peripheral tissues (Christensen et al., 2020; McBrayer et al., 2007; Shimell et al., 2018). We analyzed the Halloween genes transcript level in Nup107-depleted larvae and observed a significant downregulation for each of the Halloween quartet genes mentioned earlier (Figure 4C−F, Figure 4—figure supplement 1). Further, the level of the shade gene was also reduced twofold in Nup107-depleted larvae (Figure 4G, Figure 4—figure supplement 1).

20E rescues Nup107-dependent EcR localization defects

The observed correlation between the expression levels of ecdysone biosynthetic genes and reduced levels of 20E upon Nup107 knockdown strongly suggests a role for Nup107 in 20E biosynthesis, active 20E-EcR complex formation, and subsequent nuclear translocation. It is not surprising in this context that exogenous ecdysone supplementation through larval food rescues pupariation blocks arising from ecdysone deficiency (Garen et al., 1977; Ou et al., 2016; Shimell et al., 2018). We experimented the same under Nup107 depletion conditions and supplemented exogenous ecdysone to PG-specific Nup107-depleted larvae by feeding them a diet enriched with 20E (0.2 mg/ml). Supplementation of 20E to Nup107-depleted larvae significantly alleviated the developmental arrest, and the onset of pupariation was comparable to the control (Supplementary file 1). However, none of the pupae could eventually eclose successfully, probably due to other effects of Nup107 depletion. We asked if nuclear translocation of EcR can also be rescued by exogenous supplementation of 20E. While incubation of salivary glands of late third instar larva in S2 media control alone did not rescue EcR localization in any of the Nup107 knockdown genotypes (Figure 5A−C, Figure 5—figure supplement 1), we noticed a complete EcR nuclear translocation rescue in ubiquitous, as well as PG-specific Nup107-depleted salivary glands when incubated with 20E (Figure 5D−F, Figure 5—figure supplement 1).

Figure 5. 20-Hydroxyecdysone (20E) supplementation rescues Nup107 depletion-specific ecdysone receptor (EcR) signaling defects.

Immunofluorescence analysis of EcR localization in 20E supplemented and non-supplemented third instar larval salivary glands. (A–F) Visualization of the nucleocytoplasmic distribution of EcR (anti-EcR antibody, red) without 20E (A–C) and with 20E (D–F) treatment in larval salivary glands of control, ubiquitous (Actin5C-Gal4) Nup107 knockdown, and prothoracic gland-specific (Phm-Gal4) Nup107 knockdown. DNA is stained with DAPI. Scale bars, 20 μm. Charts represent the line scan intensity profile of EcR (red) and DAPI (cyan) in the salivary gland nucleus region. (G–H) Comparative quantification of expression ecdysone-inducible genes Eip75A (G) and Eip74EF (H) from 20E-treated salivary glands. Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. *p=<0.02, **p=<0.002, ***p=<0.0008, and ns is nonsignificant.

Figure 5—figure supplement 1. Ecdysone (20-hydroxyecdysone [20E]) supplementation rescues Nup107^GD-dependent Nup107 depletion-specific ecdysone receptor (EcR) signaling defects.

(A–B) Visualization of the nucleocytoplasmic distribution of EcR (anti-EcR antibody, red) without 20E (A) and with 20E (B) treatment in larval salivary glands of control, ubiquitous (Actin5C-Gal4) Nup107^GD knockdown, and prothoracic gland-specific (Phm-Gal4) Nup107^GD knockdown. DNA is stained with DAPI. Scale bar, 20 μm. Charts represent the line scan intensity profile of EcR (red) and DAPI (cyan) in the salivary gland nucleus region.

We reason that the exogenous supplementation of 20E leads to active 20E-EcR complex formation as mRNA levels of the Eip75A and Eip74EF target genes were rescued significantly back to normal levels (Figure 5G and H). Overall, these findings highlight the important regulatory function of Nup107 in the ecdysone signaling pathway.

Torso is an effector of Nup107-mediated functions in metamorphosis

Next, we explored the mechanism of Nup107-driven regulation of 20E levels and metamorphosis. The cell surface receptors of the tyrosine kinase family bind to ligands (growth factors and hormones) and activate signaling to regulate metabolism, cell growth, and development. Among these RTKs, the Torso, belonging to the platelet-derived growth factor receptor class, plays a significant role during metamorphosis by serving as a receptor for the neuropeptide PTTH in the Drosophila brain (Sopko and Perrimon, 2013).

Functional engagement of PTTH-Torso activates the MAP kinase pathway, involving components of Ras, Raf, MEK, and ERK, thereby initiating metamorphosis (Figure 6A). The torso knockdown in the PGs resulted in a significant delay in the onset of pupariation, extending the developmental period by approximately 6 days, resembling the developmental arrest seen with Nup107 knockdown. Feeding 20E to torso-depleted larvae completely rescued developmental delay and normal growth phenotypes (Rewitz et al., 2009). We observed a significant decrease in the torso levels (approximately fourfold) when Nup107 was depleted ubiquitously using Actin5C-GAL4 (Figure 6B), suggesting an epistatic regulation by Nup107 on the torso. Further, the phenotypic similarity between Nup107 and torso depletion scenarios and diminished torso level upon Nup107 depletion prompted us to investigate whether the torso is an effector of Nup107.

Figure 6. Torso and Nup107 act synergistically to activate the ecdysone signaling.

(A) A model of the Torso pathway and its components. (B) Quantitation of torso transcript levels from control and Nup107-depleted larvae (ubiquitous depletion using Actin5C-Gal4). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ****p=<0.0001. (C–D) Comparison of pupariation profiles of control, Nup107 knockdown, and torso and rasV12 overexpressing rescue organisms. (E–G) Detection and quantitation of nucleocytoplasmic distribution of EcR (anti-EcR antibody, red) and Nup107 (anti-Nup107 antibody, green) in control, torso overexpressing ubiquitous Nup107 knockdown (Actin5C-Gal4>Nup107KK; UAS-torso) and torso overexpressing PG-specific Nup107 knockdown (Phm-Gal4>Nup107KK; UAS-torso) third instar larval salivary gland nuclei. DNA is stained with DAPI. Scale bars, 20 μm. Charts show the line scan intensity profiles of EcR (red) and DAPI (cyan) in the salivary gland nucleus region. (H–I) Quantification of expression of Eip75A (H) and Eip74EF (I) ecdysone-inducible genes, respectively. Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. *p=<0.03, **p=<0.008, ****p=<0.0001, and ns is nonsignificant. Created with BioRender.com.

Figure 6—figure supplement 1. Torso rescues metamorphic defects of Nup107 knockdown.

(A) Growth profile of third instar larvae from different genotypes (control, Nup107^KK, Nup107^KK;UAS-torso, and Nup107^KK;UAS-ras^V12) at 96 hr AEL (after egg laying). (B–E) Quantification of ecdysone-biosynthetic gene expression levels of spookier (B), phantom (C), disembodied (D), and shadow (E) in cDNA isolated from control and Nup107-depleted torso overexpressing larvae (by using Actin5C-Gal4 and Phm-Gal4). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. (*) represents p<0.03, and ‘ns’ is nonsignificant.

Overexpression of the torso and/or ras^V12 has been utilized to rescue torso pathway-mediated defects (Cruz et al., 2020; Rewitz et al., 2009). We probed the possibility of Nup107 phenotype rescue by ubiquitous or PG-specific overexpression of the torso and ras^V12. Overexpression of either torso or ras^V12 in Nup107 depletion background completely rescued the pupariation defects (Figure 6C and D). Interestingly, the overexpression of Egfr (another RTK linked to Drosophila metamorphosis) and Usp (co-receptor with EcR) in Nup107 depletion background could not rescue the pupariation defects (data not shown), indicating that the torso overexpression-mediated rescue of Nup107 depletion phenotypes is specific. Overexpression-dependent rescue prompted us to analyze the status of EcR nuclear translocation, ecdysone biosynthesis, and ecdysone-inducible gene expression. The restoration of EcR nuclear translocation (Figure 6E−G), the ecdysone biosynthesis genes, spookier, phantom, disembodied, and shadow (Figure 6—figure supplement 1), and ecdysone target genes Eip75A and Eip74EF (Figure 6H and I) to control levels indicated that torso could efficiently rescue Nup107 phenotypes.

These observations suggest that the torso is a downstream effector of Nup107 functions, and torso-dependent signaling, responsible for 20E synthesis in PG and metamorphosis, is regulated by Nup107 levels.

Discussion

Apart from its importance in mRNA export and cell division at the cellular level, the NPCs Y-complex member Nup107, when mutated, correlates with developmental abnormalities such as microcephaly and nephrotic syndrome (Miyake et al., 2015; Zheng et al., 2012). In several human cancer types, Nup107 exhibits high expression and serves as a biomarker for hepatocellular carcinoma. A strong structural and functional conservation between human and Drosophila Nup107 proteins can help us model human diseases and gain mechanistic insights in Nup107 functions in Drosophila (Shore et al., 2022; Weinberg-Shukron et al., 2015). We observe that Nup107 is involved in critical developmental transitions from larva to pupa during Drosophila development as pupariation is completely arrested (Figure 1). The foraging third instar larva must acquire a critical weight and sufficient energy stores before it can metamorphose into a non-feeding pupa, molting into a healthy adult. The activation of the Torso receptor and sequent surge in ecdysone synthesis are essential for larval-to-pupal transition (Christensen et al., 2020; Hao et al., 2021; Luo et al., 2024). The elevated ecdysone levels trigger the translocation of the heterodimeric EcR (in complex with ultraspiracle [Usp]) into the nucleus to induce pupariation-specific transcriptional programming (Johnston et al., 2011). Similarly, when Nup107 is depleted, nuclear translocation of EcR is abolished, arresting metamorphosis at the level of the third instar larval stage (Figure 2).

Translocation of nuclear receptor proteins like the EcR to the nucleus is a crucial step for transcriptional activation. The marked absence of EcR from the nucleus was intriguing as Nup107 generally participates in the nuclear export process. Perhaps Nup107 regulates pupariation by modulating ecdysone synthesis, ecdysone signaling, and nuclear translocation of EcR. Surprisingly, Nup107 is dispensable for the nuclear translocation of EcR in the target tissue, the salivary glands (Figure 3). Nup107 exerts strong control over the expression of Halloween genes involved in ecdysone biosynthesis, resulting in diminished 20E titer, poor EcR activation, and delayed larva-to-pupa transition (Figure 4, Figure 3—figure supplement 2). The effect of Nup107 on Halloween genes adheres well to pupariation defects. These observations are in concurrence with reports of low ecdysone levels disrupting the pupariation process, leading to a halt in insect development (Christensen et al., 2020; Cruz et al., 2020).

In addition to ecdysone signaling, insect metamorphosis also has a strong contribution from RTK pathway signaling. Notably, Torso signaling is essential for embryonic development and metamorphosis in Drosophila. The receptor expression level impacts the signaling output: high receptor levels trigger a robust and transient signal, while lower levels result in a weaker, sustained signal (Jenni et al., 2015; Konogami et al., 2016). Accordingly, the reduced ecdysone levels in the torso knockdown PGs induced pupariation delays (Rewitz et al., 2009). We observe a similar defect with Nup107 knockdown, indicating a possible reduction in torso levels. Interestingly, we observed significantly reduced torso levels in Nup107-depleted organisms, suggesting an essential upstream function for Nup107 in regulating RTK pathway activation and the associated Drosophila metamorphosis process. In the contrasting observation, Nup107-depleted larval tissues (salivary gland, brain complex, and PG) are significantly smaller in size (Figure 2—figure supplement 1, Figure 3—figure supplement 3). It is important to know how Nup107 contributes to organ size maintenance and if a crosstalk with RTK signaling is required in this context.

The developmental delays observed in Nup107 knockdown larvae can be restored by exogenous supplementation of 20E, suggesting that Nup107 can modulate directly or indirectly the Torso receptor activity for ecdysone production and developmental regulation. Accordingly, we successfully rescued developmental delays by ubiquitous and PG-specific torso overexpression. Perhaps overexpression of the torso pathway mediator molecules can rescue the Nup107 developmental delay phenotypes. The oncogenic variant of the Ras-GTPase (ras^V12) has been explored in a similar analysis with torso pathway mutants (Cruz et al., 2020; Rewitz et al., 2009). The alleviation of the developmental delays in the Nup107 knockdown background upon ras^V12 overexpression is an indication of Nup107 serving as an epistatic regulator of the torso pathway in metamorphic transitions (Figure 6).

In essence, our findings indicate that Nup107 influences pupariation timing by regulating the torso levels, its signaling, and ecdysone biosynthesis (Figure 7). Previous research has shown that NPCs are essential for maintaining global genome organization and regulating gene expression (Capelson et al., 2010a; Capelson et al., 2010b; Iglesias et al., 2020). Particularly, Nup107 interacts with chromatin and targets active gene domains to regulate gene expression (Gozalo et al., 2020). Thus, Nup107 exerting its effects on torso transcription is the primary regulatory event in the Drosophila metamorphosis. It is important to note that the synthesis and availability of Torso ligand, PTTH, may not be affected by the Nup107 since torso or downstream effector ras^V12 overexpression is sufficient to rescue the developmental arrest phenotype. It is thus crucial to further delineate the mechanism of Nup107-dependent regulation on torso pathway activation. The whole-genome transcriptomics from PG can help shed more light on the regulatory roles of Nup107. This information will offer valuable insights into how Nups regulate gene expression and serve as a model for elucidating how they govern the temporal specificity of developmental processes in organisms. Furthermore, these analyses will help establish a link between Nup107, the PTTH-PG axis, and the regulation of developmental transition timing. Our observations indicate critical roles for Nup107 in both torso-ecdysone interplay in metamorphosis and torso-independent mechanism for organ size maintenance. Together they add valuable information to hitherto unknown functions of the Nup107 in organismal development. Further investigations are required to identify the interactors of Nup107 involved in these coordination mechanisms in developmental transition.

Figure 7. Theoretical model of Nup107 functions in metamorphosis.

During metamorphosis, the prothoracic gland (PG) responds to prothoracicotropic hormone (PTTH) via Torso receptors. The MAP kinase pathway involving Raf, MEK, and ERK, initiated by Ras, leads to Halloween gene expression responsible for ecdysone synthesis and release. Ecdysone is converted to active 20-hydroxyecdysone (20E) in peripheral tissues. The binding of 20E to the ecdysone receptor (EcR) allows EcR nuclear translocation and EcR pathway activation, culminating in target gene expression facilitating the metamorphic transition. Nup107 depletion negatively impacts Torso levels and Torso pathway activation, inducing pupariation arrest, which can be rescued by autonomous activation of the Torso pathway. Created with BioRender.com.

Materials and methods

Fly stocks and genetics

Experimental Drosophila melanogaster stocks were reared on a standard cornmeal diet (Nutri-Fly Bloomington formulation) under controlled conditions of 25°C and 60% relative humidity unless otherwise specified. Fly lines used in this study were sourced from the Bloomington Drosophila Stock Centre (BDSC) at Indiana University or from the Vienna Drosophila Resource Center (VDRC), which are listed in the Key resources table. The UAS-GFP lines were received as a gift from Dr. Varun Chaudhary (IISER Bhopal, India). Control groups were generated through crosses between the driver line and w¹¹¹⁸ flies. For RNAi experiments, crosses were maintained at 29°C to optimize GAL4 expression. The Nup107^GD line, in conjunction with Actin5C-GAL4, was specifically cultivated at 23°C to generate third instar larvae for experimental purposes. Various genetic combinations were generated as per the need of the experiment following the standard Drosophila genetics cross schemes.

Transgenic fly generation

In the generation of transgenic flies containing gRNA, we employed a systematic approach. The online tool available at http://targetfinder.flycrispr.neuro.brown.edu was used for the initial sgRNA design, ensuring zero predicted off-targets. Subsequently, we utilized an additional tool available at https://www.flyrnai.org/evaluateCrispr/ to evaluate and score the predicted efficiency of sgRNAs in the targeted region. The most efficient sgRNAs, demonstrating high specificity with no predicted off-targets, were selected and cloned into the pCFD4 vector. The Fly Facility Services at the Centre for Cellular and Molecular Platforms, National Center for Biological Sciences (C-CAMP-NCBS), Bengaluru, India, were utilized to clone and generate transgenic flies. Primer sequences employed in this study can be found in the Key resources table.

CRISPR-Cas9-mediated mutant generation

Virgin nanos.Cas9 (BL-54591) flies were crossed with males of gRNA transgenic lines, and approximately 10 F1 progeny males were crossed with balancer flies specific for the gene of interest. A single-line cross was established using the F2 progeny to assess the deletion of nup107. Subsequently, F3 progeny were subjected to nested PCR to confirm deletions. Positive individuals were further tested for the presence of gRNA and Cas9 transgenes, and flies lacking both were propagated into stocks.

Genomic DNA isolation

Approximately 10 flies were homogenized in 250 µL of solution A, comprising 0.1 M Tris-HCl, pH 9.0, 0.1 M EDTA, and 1% SDS, supplemented with Proteinase K. The homogenate was incubated at 70°C for 30 min. Subsequently, 35 µL of 8 M potassium acetate was added, mixed gently without vortexing, and incubated on ice for 30 min. The homogenate was then centrifuged at 13,000 rpm at 4°C for 15 min, and the supernatant was carefully collected without disturbing precipitates or the interphase. 150 µL of isopropanol was added to the supernatant and incubated on ice for 15 min. After centrifugation at 13,000 rpm for 5 min, the supernatant was discarded, and the pellet was washed with 1 mL of 70% ethanol by centrifuging at 13,000 rpm for 5 min. The supernatant was again discarded, and the pellet was dried at 55°C until the ethanol evaporated. Finally, the pellet was resuspended in 50 µL of Tris-EDTA buffer and incubated at 37°C.

Nested PCR

Nested PCR was employed to assess the presence of deletions in flies, utilizing genomic DNA as the template. 1 µL of DNA was used for the initial PCR with an outer set of primers (Key resources table). Following this, 1 µL of the initial PCR product was employed for a subsequent PCR with an inner set of primers. The resulting PCR products were then resolved on 0.8% agarose gel to visualize the desired bands indicative of deletions.

Measurement of developmental timing and pupariation

Flies were permitted to lay eggs for 3 hr on agar plates supplemented with yeast, synchronizing the larvae. Newly hatched L1 larvae were then collected and transferred to vials. Pupariation times and dates were recorded daily during the light cycle. Data from 8 to 10 vials were aggregated, organized by pupariation time and cumulative percentage pupariation, and analyzed using Microsoft Excel.

Antibody generation and western blotting

To generate antibodies against Drosophila Nup107 (CG6743), the N-terminal 210 amino acids, recognized as the most unique and antigenic region, were sub-cloned into the modified tag-less pET28a(+) vector, pET28a(+)-JK vector. The protein was expressed in Escherichia coli BL21 (DE3) cells, induced with 200 μM IPTG (Sigma), and incubated at 30°C for 4 hr. Following cell pelleting, the pellet was resuspended in lysis buffer (50 mM Tris pH 8.0, 1 mM EDTA, and 25% sucrose) with 1× protease inhibitor mixture (Roche Applied Science), and lysozyme (from 50 mg/mL stock) was added to facilitate bacterial lysis. After sonication and centrifugation, the pellet was successively resuspended in inclusion body buffer I (20 mM Tris pH 8.0, 0.2 M NaCl, 1% sodium deoxycholate, and 2 mM EGTA) and buffer II (10 mM Tris pH 8.0, 0.25% sodium deoxycholate, and 1 mM EGTA) and centrifuged. This process was repeated three times within inclusion body buffer II, and the final pellet was dissolved in 8 M urea buffer (10 mM Tris-HCl pH 8.0, 8 M urea, 0.1 mM NaN₃, and 1 mM EGTA), diluted to 6 M urea, and centrifuged. The supernatant was loaded onto SDS-PAGE, and the desired band was cut for protein elution. Rabbit polyclonal antibodies against Nup107 were generated at Bio Bharati Life Sciences Pvt. Ltd., Kolkata, West Bengal, India. The antibodies obtained were subjected to affinity purification. The purification involved the chemical cross-linking of purified antigens to N-hydroxy succinimidyl-Sepharose beads (Sigma). The elution process was carried out under low pH conditions, followed by neutralization. Subsequently, the eluted antibodies were dialyzed against phosphate-buffered saline (PBS) overnight at 4°C to remove any remaining impurities and optimize their stability and functionality for subsequent experimental use.

Larval brain complexes from third instar larvae were dissected, lysed in Laemmli buffer, and resolved on 8% SDS-PAGE. Two equivalent head complexes were loaded per well. After transfer to a polyvinylidene difluoride membrane, blocking was performed with 5% fat-free milk. The membrane was then incubated with polyclonal anti-Nup107 antibody (1:500) and anti-α-tubulin (DSHB, 12G10) (1:5000) at 4°C overnight. Following three washes with TBS-T buffer (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.1% Tween-20), the membrane was incubated with secondary antibodies, anti-rabbit-Alexa Fluor Plus 680 (Thermo Fisher Scientific #A32734) and anti-mouse-Alexa Fluor Plus 800 (Thermo Fisher Scientific #A32730). Following incubation with secondary antibodies, the membrane was washed three times for 10 min each with Tris-buffered saline containing Tween-20 (TBS-T) to remove unbound antibodies. The washed membrane was then subjected to imaging using the Li-COR IR system (Model: 9120), allowing for the visualization and analysis of the protein bands on the membrane.

Immunostaining

For immunostaining Drosophila salivary glands, the previously reported protocol was followed (Mehta et al., 2021). The larvae were dissected in cold PBS to isolate salivary glands. Glands underwent pre-extraction with 1% PBST (PBS+1% Triton X-100), then fixation in freshly prepared 4% paraformaldehyde for 30 min at room temperature. Subsequently, the glands were thoroughly washed with 0.3% PBST (0.3% Triton X-100 containing PBS). Blocking was performed for 1 hr with 5% normal goat serum (#005-000-001, The Jackson Laboratory, USA). The glands were stained with the following primary antibodies: anti-Nup107 (1:100), mAb414 (1:500, BioLegend), and anti-EcR (1:20, DDA2.7, DSHB) overnight at 4°C. Tissues were washed three times with 0.3% PBST (PBS+0.3% Triton X-100), followed by incubation with secondary antibodies: anti-rabbit Alexa Fluor 488 (1:800, #A11034, Thermo Fisher Scientific), anti-rabbit Alexa Fluor 568 (1:800, #A11036, Thermo Fisher Scientific), anti-mouse Alexa Fluor 488 (1:800, #A11029, Thermo Fisher Scientific), anti-mouse Alexa Fluor 568 (1:800, #A11004, Thermo Fisher Scientific), and anti-rabbit Alexa Fluor 647 (1:800, Jackson ImmunoResearch). Following secondary antibody incubation, tissues were washed three times with 0.3% PBST (PBS+0.2% Triton X-100) and mounted with DAPI-containing Fluoroshield (#F6057, Sigma). The same protocol was followed for staining of the brain complex and PG.

Fluorescence intensity quantification

Images were acquired using an Olympus Confocal Laser Scanning Microscope FV3000. Subsequent image processing was conducted using the Fiji software, and signal intensities were averaged using GraphPad software (Prism). To quantify the EcR nuclear-to-cytoplasmic ratio, three distinct regions of interest (ROIs) were designated per nucleus and its surrounding cytoplasm. Fiji software measured the average intensity in each ROI, and the mean of these intensities was determined per nucleus and its adjacent cytoplasm. The final graph depicts the ratio of the mean intensities observed in the nucleus to that in the cytoplasm. All experiments were conducted with a minimum of three independent replicates.

Quantitative RT-PCR

Total RNA was extracted from various genotypes (control, ubiquitously depleted Nup107, and PG-specific depletion of Nup107) of whole late third instar larvae utilizing the total tissue RNA isolation kit (Favorgen Biotech). One microgram of total RNA was employed for cDNA synthesis with the iScript cDNA synthesis kit (Bio-Rad). The resulting cDNA was diluted fivefold, and 1 μL from each genotype was utilized as a template. RT-PCR was conducted using SYBR Green PCR master mix on an Applied Biosystems QuantStudio 3 Real-Time PCR System. The Rpl69 gene served as the control, and relative transcript levels were determined using the CT value (2^-ΔΔCT). Differences in gene expression were analyzed using Student’s t-test, with a p-value<0.05 considered significant. The primers used are detailed in the Key resources table. The resultant graph illustrated the fold change in gene expression, plotted using GraphPad software (Prism).

20E level measurements

Three biological replicates of 25 mg larvae from each genotype were collected at the specified times AEL. The larvae were washed, dried, and weighed before being flash-frozen on dry ice and stored at –80°C. Ecdysone extraction was done by thoroughly homogenizing the frozen samples in 300 µL ice-cold methanol with a plastic pestle. After centrifugation at 17,000 × g for 10 min, the supernatant was divided into two Eppendorf tubes containing approximately 150 µL supernatant. Methanol from both tubes was evaporated in a vacuum centrifuge for 60 min, and the resulting pellets were redissolved by adding 200 µL enzyme immunoassay (EIA) buffer to one of the tubes. After vortexing, the same 200 µL EIA buffer was transferred to the second tube, followed by another round of vortexing. The ELISA was performed using a 20E ELISA kit (#EIAHYD) from Thermo Fisher Scientific.

20E rescue experiment

20E (#H5142, Sigma) was dissolved in ethanol to achieve a 5 mg/mL concentration. Salivary glands from third instar larvae of different genotypes were extracted and then incubated for 6 hr in Schneider’s S2 media with 50 μM 20E. After the incubation, the glands underwent procedures for immunostaining and RNA extraction.

To facilitate the rescue of the larvae through feeding, 30 third instar larvae, Nup107-depleted larvae cultured at 29°C incubator, were first washed with water. They were then transferred to vials containing either 20E (at a final concentration of 0.2 mg/mL) or 95% ethanol (in the same amount as the 20E). Once the larvae were added to the vials, these were returned to the 29°C incubator and observed for pupariation, recording the time of this developmental stage.

Appendix 1

Appendix 1—key resources table.

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Genetic reagent (D. melanogaster)	w1118	Bloomington Drosophila Stock Center	BDSC:3605; FLYB: FBst000360; RRID:BDSC_3605	w[1,118]
Genetic reagent (D. melanogaster)	w1118; P{GD12024}v22407	Vienna Drosophila Resource Center	VDRC: v22407; FLYB: FBst0454535; RRID:FlyBase_ FBst0454535	P{GD12024}v22407 (Nup107GD RNAi)
Genetic reagent (D. melanogaster)	P{KK108047}VIE-260B		VDRC: v110759; FLYB: FBst0482324; RRID:FlyBase_FBst0482324	P{KK108047}VIE-260B (Nup107KK RNAi)
Genetic reagent (D. melanogaster)	y[1] w[*]; P{w[+mW.hs]=GawB}AB1	Bloomington Drosophila Stock Center	BDSC:1824; FLYB: FBti0001249; RRID:BDSC_1824	AB1-Gal4
Genetic reagent (D. melanogaster)	y[1] w[*]; P{w[+mC]=phtm-GAL4.O}22		BDSC:80577; FLYB: FBti0201787; RRID:BDSC_80577	Phm-Gal4
Genetic reagent (D. melanogaster)	y[1] w[*]; P{Act5C-GAL4-w}E1/CyO		BDSC:25374; FLYB: FBti0127834; RRID:BDSC_25374	Actin5C-Gal4
Genetic reagent (D. melanogaster)	w[*]; wg[Sp-1]/CyO; P{w[+mC]=mRFP-Nup107.K}7.1		BDSC:35517; FLYB: FBti0130064; RRID:BDSC_35517	mRFP-Nup107
Genetic reagent (D. melanogaster)	y[1] M{w[+mC]=nanos-Cas9.P}ZH-2A w[*]	Bloomington Drosophila Stock Center	BDSC:54591; FLYB: FBti0159183; RRID:BDSC_54591	Nanos.Cas9
Genetic reagent (D. melanogaster)	w[*]; TI{w[+mW.hs]=TI}trk[Delta]/CyO; P{w[+mC]=UASp-tor.G}5.7		BDSC:92604; FLYB: FBti0216047; RRID:BDSC_92604	UAS-torso
Genetic reagent (D. melanogaster)	w[1118]; P{w[+mC]=UAS-Ras85D.V12}TL1		BDSC:4847; FLYB: FBti0012505; RRID:BDSC_4847	UAS-rasV12
Genetic reagent (D. melanogaster)	Nup107KK;UAS-GFP			Generated in the RKM (corresponding authors) laboratory and details are reported in the Materials and methods under Fly stocks and genetics section.
Genetic reagent (D. melanogaster)	UAS-GFP;Nup107GD
Genetic reagent (D. melanogaster)	UAS-GFP;Phm-Gal4/TM6.Tb
Genetic reagent (D. melanogaster)	Nup107 gRNA line
Genetic reagent (D. melanogaster)	Nup107KK;UAS-torso
Genetic reagent (D. melanogaster)	Nup107KK;UAS-rasV12
Antibody	Anti-Nup107 (Rabbit polyclonal)	This study		WB (1:500), IF (1:100) Generated in the RKM (corresponding authors) laboratory and details are reported in the Materials and methods under antibody generation and western blotting section.
Antibody	Anti-Nuclear Pore Complex Proteins (Mouse monoclonal)	BioLegend	Cat#902902 (MAb414)	IF (1:500)
Antibody	Anti-EcR (Mouse monoclonal)	DSHB	Cat#DDA2.7	IF (1:20)
Antibody	Anti-α tubulin (Mouse monoclonal)	DSHB	Cat#12G10	IB (1:5000)
Antibody	Goat anti-rabbit Alexa Fluor Plus 680	Thermo Fisher Scientific	Cat#A32734	IB (1:40,000)
Antibody	Goat anti-mouse Alexa Fluor Plus 800		Cat#A32730	IB (1:40,000)
Antibody	Goat anti-rabbit Alexa Fluor 488		Cat#A11034	IF (1:800)
Antibody	Goat anti-rabbit Alexa Fluor 568		Cat#A11036	IF (1:800)
Antibody	Goat anti-mouse Alexa Fluor 488		Cat#A11029	IF (1:800)
Antibody	Goat anti-mouse Alexa Fluor 568		Cat#A11004	IF (1:800)
Antibody	Goat anti-rabbit Alexa Fluor 647	Jackson ImmunoResearch	Cat#111-605-045	IF (1:800)
Sequence-based reagent	Nup107_gRNA1	Generated in the RKM (corresponding authors) laboratory and details are reported in the material and methods under antibody generation and western blotting, Nested PCR, Quantitative RT-PCR, Transgenic fly generation sections	PCR primers (5'–3'):	TGGCCGACAGCCCGTTCCCG
Sequence-based reagent	Nup107_ gRNA2		PCR primers (5'–3'):	GGAGCTGCTCAACTCGAAACTGG
Sequence-based reagent	5’UTR Primer1_F		PCR primers (5'–3'):	GCTCCCAAATACTCGCTGCC
Sequence-based reagent	3’UTR Primer1_R		PCR primers (5'–3'):	CTTCTGCCGGCGGATTTGTT
Sequence-based reagent	5’UTR Primer2_F		PCR primers (5'–3'):	GGTACCCCATACTAATGATTC
Sequence-based reagent	3’UTR Primer2_R		PCR primers (5'–3'):	CATGTTGTTTGTCTCGCTACT
Sequence-based reagent	Nup107 (for antibody generation)		PCR primers (5'–3'):	Forward: ATCGGATCCATGGCCGACAGCCCGTTC Reverse: ATCGAATTCCTACCACGCCATCATACGATC
Sequence-based reagent	Nup107_RT		PCR primers (5'–3'):	Forward: GCAGGCTCACCGATCGGAAG Reverse: TCCATCTGCAGTAGGCGATG
Sequence-based reagent	EcR_RT		PCR primers (5'–3'):	Forward: AAGAGGATCTCAGGCGTATAA Reverse: GGCCTTTAGTAACGTGATCTG
Sequence-based reagent	Eip75A_RT		PCR primers (5'–3'):	Forward: ACCACAGCACCACCCATTT Reverse: TGTTTGGCGGTAGTTTCAGG
Sequence-based reagent	Eip74EF_RT		PCR primers (5'–3'):	Forward: CTCTGCTCCACATAAAGACG Reverse: CCGCTAAGCAGATTGTGG
Sequence-based reagent	Phm_RT		PCR primers (5'–3'):	Forward: GGATTTCTTTCGGCGCGATGTG Reverse: TGCCTCAGTATCGAAAAGCCGT
Sequence-based reagent	Spok_RT		PCR primers (5'–3'):	Forward: TATCTCTTGGGCACACTCGCTG Reverse: GCCGAGCTAAATTTCTCCGCTT
Sequence-based reagent	Dib_RT		PCR primers (5'–3'):	Forward: TGCCCTCAATCCCTATCTGGTC Reverse: ACAGGGTCTTCACACCCATCTC
Sequence-based reagent	Sad_RT		PCR primers (5'–3'):	Forward: CCGCATTCAGCAGTCAGTGG Reverse: ACCTGCCGTGTACAAGGAGAG
Sequence-based reagent	Shd_RT		PCR primers (5'–3'):	Forward: CGGGCTACTCGCTTAATGCAG Reverse: AGCAGCACCACCTCCATTTC
Sequence-based reagent	Torso_RT		PCR primers (5'–3'):	Forward: CAGCTACTGCGACAAGGTCATCG Reverse: CTCGGTTGCAGCTTGCAGTTG
Sequence-based reagent	Rpl49_RT		PCR primers (5'–3'):	Forward: CGTTTACTGCGGCGAGAT Reverse: GTGTATTCCGACCACGTTACA
Commercial assay or kit	RNA isolation kit	Favorgen Biotech	Cat#FATRK-001–2
Commercial assay or kit	iScriptTM cDNA synthesis kit	Bio-Rad	Cat#170–8891
Commercial assay or kit	20-Hydroxyecdysone ELISA kit	Thermo Fisher Scientific	Cat#EIAHYD
Chemical compound, drug	Fluoroshield	Sigma-Aldrich	Cat#F6057
Chemical compound, drug	Triton X-100		Cat#X100-1L
Chemical compound, drug	Tween-20		Cat#274348
Chemical compound, drug	Paraformaldehyde		Cat#158127
Chemical compound, drug	iTaq Universal SYBR Green Supermix	Bio-Rad	Cat#1725122
Chemical compound, drug	G9 Taq Polymerase 10× buffer with MgCl2	GCC Biotech	Cat#G7115
Chemical compound, drug	dNTPs	SBS GENETECH	Cat#EN-2
Chemical compound, drug	20-Hydroxyecdysone	Sigma-Aldrich	Cat# H5142
Chemical compound, drug	EDTA	Sigma-Aldrich	Cat#03690
Chemical compound, drug	SDS	HIMEDIA	Cat#GRM886
Chemical compound, drug	Proteinase K	MP Biomedicals	Cat#193981
Chemical compound, drug	Tris	HIMEDIA	Cat#MB029
Chemical compound, drug	Potassium acetate	HIMEDIA	Cat#MB042
Chemical compound, drug	Isopropanol	MP Biomedicals	Cat#194006
Chemical compound, drug	Ethanol	Merck	Cat#100983
Chemical compound, drug	Sucrose	ANJ Biomedicals	Cat#100314
Chemical compound, drug	IPTG	Sigma-Aldrich	Cat#I6758
Chemical compound, drug	Protease inhibitor cocktail (PIC)	Roche	Cat#04693132001
Chemical compound, drug	NaCl	Emparta ACS	Cat#1.93206.0521
Chemical compound, drug	EGTA	Sigma-Aldrich	Cat#E4378
Chemical compound, drug	Sodium deoxycholate		Cat# 30970
Chemical compound, drug	Sodium azide		Cat#438456
Chemical compound, drug	N-Hydroxy-succinimidyl (NHS) Sepharose	Sigma-Aldrich	Cat#H8280
Chemical compound, drug	Urea	MP Biomedicals	Cat#194857
Software, algorithm	ImageJ/Fiji	National Institutes of Health, USA		http://imagej.nih.gov/ij/
Software, algorithm	GraphPad Prism software	GraphPad		https://www.graphpad.com/
Software, algorithm	Adobe Photoshop 2023	Adobe		https://www.adobe.com/in/products/photoshop.html
Software, algorithm	QuantStudio Design & Analysis Software	Applied Biosystems		https://www.thermofisher.com/in/en/home/products-and-services/promotions.html

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Funding Information

This paper was supported by the following grants:

• Science and Engineering Research Board to Ram Kumar Mishra.

• Indian Council of Medical Research to Ram Kumar Mishra.

• Indian Institute of Science Education and Research, Bhopal to Ram Kumar Mishra.

• University Grants Commission to Jyotsna Kawadkar.

• Science and Engineering Research Board CRG/2020/000496 to Ram Kumar Mishra.

Data availability

All relevant data and resources can be found within the article and its supplementary information.