Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Mar 11.
Published in final edited form as: Methods Enzymol. 2025 Feb 7;712:143–181. doi: 10.1016/bs.mie.2025.01.032

Purification and in vivo, cell-free, and in vitro characterization of CRISPR-Cas12a2

Friso Schut 1,*, Thomson Hallmark 2,*, Oleg Dmytrenko 1, Ryan N Jackson 2,@, Chase L Beisel 1,3,@
PMCID: PMC12975306  NIHMSID: NIHMS2149307  PMID: 40121071

Abstract

The CRISPR-associated (Cas) nuclease Cas12a2 from Sulfuricurvum sp. PC08–66 (SuCas12a2) binds RNA targets with a complementary guide (g)RNA. Target RNA binding causes a major conformational rearrangement in Cas12a2 that activates a RuvC nuclease domain to collaterally cleave ssRNA, ssDNA and dsDNA, arresting growth and providing population-level immunity. Here, we report in vivo, cell-free, and in vitro methods to characterize the collateral cleavage activity of SuCas12a2 as well as a protocol for gRNA design. As part of the in vivo methods, we describe how to capture growth arrest through plasmid interference and induction of an SOS DNA damage response in the bacterium Escherichia coli. We further apply cell-free transcription-translation to affirm collateral cleavage activity triggered by an expressed RNA target. Finally, as part of the in vitro methods, we describe how to purify active nuclease and subsequently conduct biochemical cleavage assays. In total, the outlined methods should accelerate the exploration of SuCas12a2 and other related Cas nucleases, revealing new features of CRISPR biology and helping develop new CRISPR technologies for molecular diagnostics and other applications.

Keywords: Cas12a2, protein purification, guide design, collateral cleavage, growth arrest, TXTL

2. Introduction

CRISPR-associated (Cas)12a2 is a newly discovered single-effector nuclease distinct from the more well known Cas nucleases used in gene editing. Unlike Cas9 and Cas12a, Cas12a2 recognizes target RNA instead of DNA, and RNA target binding activates the collateral degradation of RNA, ssDNA and dsDNA (Dmytrenko et al., 2023). Furthermore, triggered Cas12a2 indiscriminately cleaves invasive and genomic DNA, activating the SOS response and arresting cell growth. Additionally, the distinct Cas12a2 mechanism of RNA-triggered DNA shredding represents a new programmable tool that could be developed for use in molecular diagnostics and programmable cell killing.

The CRISPR-Cas12a2 immune system is composed of the Cas12a2 RNA-guided nuclease and a CRISPR array composed of unique guide sequences called spacers interspersed by short repeat regions. Cas12a2 binds and cleaves RNA transcribed from the CRISPR array through the 5′ pseudoknot secondary structure formed by the repeat, cleaving the CRISPR transcript into individual guide (g)RNAs. Once Cas12a2 is loaded with a gRNA, it surveils the cell for RNA targets containing two features: (i) sequence complementarity to the 24-nt gRNA guide sequence and (ii) the presence of a protospacer-flanking sequence (PFS) on the 3′ flank of the target RNA. Cas12a2 can be activated by a range of PFS sequences (Dymtrenko et al. 2023), but the common profile is 5′-BAAAN-3′ (where B indicates not adenine) positioned at the 3′ end of the target sequence.

Similar to other class 2 CRISPR nucleases, Cas12a2 has a bilobed architecture comprising a recognition (Rec) lobe and a nuclease (Nuc) lobe (Bravo et al., 2023; Liu et al., 2017; Swarts & Jinek, 2018; Yamano et al., 2016). The Rec lobe contains the Rec1 and Rec2 domains, while the Nuc lobe contains the RuvC nuclease, PFS-interacting (PI) and wedge (WED) domains along with a Zinc Ribbon (ZR) and novel insertion domain (Bravo et al., 2023). Recognition of an appropriate RNA target by Cas12a2 activates sequence non-specific collateral cleavage of ssRNA, ssDNA and dsDNA through large-scale conformational changes in the Rec lobe that open a large, positively charged binding pocket around the RuvC active site.

Here, we describe methods with supporting experimental data to design gRNAs and characterize collateral cleavage activity of Cas12a2 from Sulfuricurvum sp. PC08–66 (SuCas12a2) using various in vitro and in vivo methods. The growth-arrest phenotype caused by the collateral cleavage activity of SuCas12a2 is confirmed in E. coli through plasmid interference assays and growth-based assays, which involve detecting an SOS response using a GFP reporter plasmid. Furthermore, the prerequisites for activating the collateral cleavage activity of SuCas12a2, namely the presence of a PFS flanking the target and the target being in RNA form rather than DNA, are confirmed using a cell-free transcription-translation (TXTL) system. We also outline the necessary steps for conducting in vitro cleavage assays to probe collateral cleavage activities on ssRNA, ssDNA and dsDNA substrates. This includes the purification of the nucleases and the design of synthetic gRNAs. Collectively, the methods outlined in this chapter offer an approach for characterizing collateral cleavage by SuCas12a2, paving the way for the exploration of other CRISPR-Cas subtypes and variants with collateral cleavage activity that could advance CRISPR technologies, including diagnostics and the molecular biology toolkit.

3. gRNA design for Cas12a2

The activity of Cas12a2 depends on target recognition by a gRNA guide with a 24-nt long guide sequence and a 5′ pseudoknot (Dmytrenko et al., 2023). Cas12a2 processes the gRNA upstream of the 5′ pseudoknot. The 3′ end of the gRNA is processed to different lengths, presumably by RNases in the cell, to a minimum activating length of 24 nts.

The processing activities of Cas12a2 allows gRNAs to be co-expressed in vivo from DNA constructs, chemically synthesized or transcribed in vitro. When designing the gRNA, first identify the potential PFS sequences (e.g., conservatively 5′-BAAAN-3′ based on our characterization efforts to-date) within your target gene (Figure 1). Candidate target sequences are then the 24-nt immediately upstream on the 5′ side of each PFS. The guide sequence of the gRNA is then the reverse complement of the target sequence converted to RNA (i.e. change T to U). Finally, include the sequence of the 5′ pseudoknot (5′-AUUUCUACUGUUGUAGAU-3′) on the 5′ side of the 24-nt guide sequence. When designing CRISPR arrays, the spacer sequence should be 25- to 30-nt long, identified in the same way as the gRNA guide sequence described above, and the full repeat sequence (5′-GTCAATACGACTTTAAAAATTTCTACTATTGTAGAT-3′) should flank both sides of a spacer. The last repeat can be excluded to prevent extraneous gRNA production (Liao et al., 2019). Flanking sequences added to the 5′ and 3′ ends of the guide will respectively be cleaved by Cas12a2 processing or not impact targeting activity (Dmytrenko et al., 2023). For in vitro-transcribed gRNAs, DNA templates can be designed to include extra sequence on the 5′ sequence (e.g., a T7 promoter), upstream of the processing site, with the 3′ end designed for run-off transcription as has been described for other type V nucleases (Martin et al., 2023).

Figure 1. gRNA design strategy.

Figure 1.

a, Schematic of the gRNA design strategy. First, identify the potential PFSs within a target gene (e.g., BAAAN) then identify the preceding 24 nucleotides as the target sequence. Take the reverse complement of the target RNA sequence as the sequence of the guide region of the gRNA. Finally add the Cas12a2 gRNA hairpin sequence to the 5′ end of the guide sequence. b, Overview of the gRNA - target RNA pair with the gRNA oriented 5′ - 3′ from left to right.

4. Cas12a2 activity in E. coli

Previous work has demonstrated that SuCas12a2 drives a growth-arrest phenotype upon gRNA-directed recognition of a RNA target flanked by a PFS (Dmytrenko et al., 2023). Hybridization of a gRNA to the target RNA activates the collateral trans-cleavage activity of Cas12a2, leading to the non-specific degradation of ssRNA, ssDNA and dsDNA (Dmytrenko et al., 2023; Bravo et al., 2023). Cas12a achieves antiphage immunity through a distinct mechanism, where hybridization of its gRNA with a double-stranded DNA (dsDNA) target flanked by a protospacer adjacent motif (PAM) leads to on-target cis-cleavage of dsDNA (Zetsche et al., 2015).

Similar to Cas12a2, Cas12a also shows promiscuous collateral trans-cleavage of ssDNAs (Li et al., 2018). We selected Cas12a as a control to observe growth arrest via plasmid interference by SuCas12a2, because the reported collateral trans-cleavage activity of Cas12a does not play a role in bacterial immunity by inducing a growth-arrest or abortive-infection phenotype (Marino et al., 2022). Specifically, we picked the Cas12a gene from the microbial community of Microcerotermes parvus (MpCas12a), which can use the same gRNA as SuCas12a2 and recognize the PAM present in the target sequence.

In the plasmid interference assay, nuclease plasmids with SuCas12a2 or MpCas12a are transformed into E. coli carrying a target plasmid from which a DNA target flanked by a PFS/PAM sequence and a complementary gRNA are expressed. Subsequently, a reduction in colony counts with or without selection for the target plasmid is compared between SuCas12a2 and MpCas12a. In a similar setup, we show that the collateral activity of SuCas12a2 impairs cell growth and activates the SOS DNA damage response in E. coli.

4.1. Plasmid interference assay

In this assay, a nuclease-expressing plasmid is introduced into E. coli cells already containing a target- and gRNA-expressing plasmid. To measure the reduction in transformation efficiency, a non-targeting gRNA without complementarity to any cellular RNAs is used as a benchmark. After transformation, selection is performed for both plasmids (nuclease and target selection) or solely for the nuclease-expressing plasmid (nuclease selection) (Figure 2a). We anticipate a reduction in colony count for the dsDNA-cleaving MpCas12a under nuclease and target selection, as clearance of the target plasmid by the nuclease induces antibiotic susceptibility, leading to cell death. However, no colony count reduction is expected for MpCas12a under nuclease selection, since we do not select for the presence of the cleared target plasmid. In contrast, the collateral activity of SuCas12a2 should elicit a growth-arrest phenotype that is expected to result in a reduction of colony count, even when not selecting for the target plasmid.

Figure 2. A plasmid interference assay captures the growth-arrest phenotype induced by SuCas12a2 in E. coli.

Figure 2.

a, Diagram of the plasmid interference assay. After electroporation of the nuclease plasmid in target plasmid-carrying E. coli BL21 (AI) cells (1), transformants are recovered in inducing LB medium with IPTG and L-arabinose (2). Selection of the transformants is performed on LB agar plates with IPTG and L-arabinose supplemented with either kanamycin (Kan) and chloramphenicol (Cm) or kanamycin only (3). b, The reduction in plasmid transformation efficiency for SuCas12a2 and MpCas12a when selecting for the target plasmid and the nuclease plasmid. The dots correspond to replicates. For a and b, the data represent mean and standard deviation each initiated from at least three different colonies. P values were determined using a two-tailed Welch’s t-test assuming unequal variances.

Supporting this expectation, SuCas12a2 reduced colony counts under nuclease and target selection as well as under nuclease selection, while MpCas12a reduced colony counts only during nuclease and target selection (Figure 2b). Together, these in vivo results show that this method can be used to assess the growth-arrest phenotype by SuCas12a2 in E. coli, at least under antibiotic selection for the nuclease.

4.1.1. Design of the DNA constructs

SuCas12a2 and MpCas12a were both placed under the expression of an IPTG-inducible T7-lac promoter on a plasmid backbone with a Col1E origin of replication and a kanamycin (Kan) resistance marker. The E. coli BL21 (AI) strain used in this method has a genomically-integrated T7 RNA polymerase (T7RNAP) gene under the expression of a L-arabinose-inducible araBAD promoter, which is required for nuclease expression. The target plasmids contain the target sequence and an array of five gRNAs, each controlled by its own J23119 constitutive promoter. Furthermore, the target plasmids harbor a chloramphenicol (Cm) resistance marker and a p15A origin of replication. Similar target plasmids are used for SuCas12a2 and MpCas12a since the nucleases can utilize the same gRNA sequence and both recognize the TTTG PAM present in the target sequence (Dmytrenko et al., 2023). As a control, we use a strain with a target plasmid containing a non-targeting gRNA that has no complementary to the target sequence.

4.1.2. Materials for the plasmid interference assay

  • E. coli Top10 strains with nuclease-expressing plasmids (CBS-5043, CBS-6648)

  • E. coli BL21 (AI) strains with target- and gRNA-expressing plasmids (CBS-6117, CBS-6118)

  • MiniPrep kit (e.g., ZymoPURE Plasmid Miniprep Kit, #D4212 Zymo Research)

  • Nanodrop spectrophotometer for DNA concentration measurements

  • Spectrophotometer for OD measurements at 600 nm

  • 10-mL culture vials

  • LB medium (10 g/L tryptone, 5 g/L yeast extract, 5 g/L of NaCl) with Kan (50 μg/mL) or Cm (50 μg/mL)

  • Incubator at 37°C

  • 50-mL tubes (e.g., Falcon tubes)

  • Centrifuge for 50-mL tubes

  • Sterile nuclease-free water (distilled and deionized H2O) at 4°C

  • Sterile glycerol (10% v/v) at 4°C

  • Pre-cooled electroporation cuvettes (at 4°C or preferably −20°C)

  • Electroporation system (e.g., Bio-rad Gene Pulser Xcell)

  • IPTG stock solution (1 M)

  • L-arabinose stock solution (20%)

  • 96-well plate (e.g. Corning® 96-well Clear Flat Bottom Polystyrene TC-treated Microplates Cat #3598)

  • 1x filter-sterilized PBS solution (80 g/L NaCl, 2 g/L KCl, 17.7 g/L Na2HPO4*2 H2O, 2.27 g/L KH2PO4)

  • LB agar plates (10 g/L tryptone, 5 g/L yeast extract, 5 g/L of NaCl, 18 g/L agar) with Cm (50 μg/mL) and Kan (50 μg/mL) or only Kan (50 μg/mL).

4.1.3. Protocol for the plasmid interference assay

  1. Purify the plasmid DNA from E. coli Top10 overnight cultures with nuclease-expressing plasmids (CBS-5043, CBS-6648) by following the protocol of a MiniPrep kit. Measure the DNA concentration using a standard nanodrop spectrophotometer and dilute the plasmid DNA to a concentration of 50 ng/μL.

  2. Inoculate a single colony from the E. coli BL21 (AI) strains with target- and gRNA-expressing plasmids (CBS-6117, CBS-6118) in 2 mL of LB medium with Cm (50 μg/mL). Inoculate a total of four separate colonies into individual cultures to serve as biological replicates for each strain. Incubate the cultures overnight at 37°C with shaking at 220 rpm.

  3. Back-dilute 500 μL of the overnight culture into 50 mL of LB medium with Cm (50 μg/mL).

  4. Incubate at 37°C with shaking at 220 rpm until the optical density (OD) at 600 nm reaches ~0.8. This is approximately after 2.5 hours.

  5. Transfer each culture to a 50-mL conical tube kept on ice, then centrifuge the cells at 4,000 xg at 4°C for 15 minutes. After decanting the supernatant, resuspend the pellet in 50 mL of sterile ice-cold H2O by gently pipetting up and down.

  6. Centrifuge the cells at 4,000 xg at 4°C for 15 minutes before carefully removing the supernatant with a serological pipette without disturbing the pellet, and resuspend the pellet in 1 mL of sterile ice-cold glycerol.

  7. Transfer the cells to a 1.5 mL tube and centrifuge them at 14,000 xg at 4°C for 1 minute in a tabletop centrifuge. Then resuspend the pellet in 240 μL of ice-cold 10% glycerol.

  8. For each reaction, electroporate 1 μL of the 50 ng/μL nuclease plasmids in 40 μL of cells. Recover the transformed cells in 460 μL of LB with 1 mM IPTG and 0.2% L-arabinose at 37°C for approximately 1 hour.

  9. Create serial dilutions from 10−1 to 10−5 in 1x PBS using a 96-well plate. Plate 5 μL of each dilution on selective LB agar plates containing:
    1. 1 mM IPTG, 0.2% L-arabinose, 50 μg/mL Kan.
    2. 1 mM IPTG, 0.2% L-arabinose, 50 μg/mL Kan and 50 μg/mL Cm.

4.2. Growth-based assays

According to the plasmid interference assay, SuCas12a2 reduces E. coli colony counts under nuclease selection. Here, we show a method demonstrating that the collateral activity of SuCas12a2 impairs cell growth even in the absence of any antibiotic selection. Figure 3a presents a comprehensive overview of the steps involved in the growth-based assays in E. coli, which can be used to measure the growth effect of SuCas12a2 under different antibiotic regimes. As can be seen in Figure 3b, gRNA-directed SuCas12a2 hampers cell growth of E. coli upon recognition of a target during the first 8 hours compared with a nuclease guided by a non-targeting gRNA.

Figure 3. Growth-based assays with SuCas12a2 show an SOS DNA damage response in E. coli.

Figure 3.

a, Diagram of the growth-based assays that can be used to show SuCas12a2 impairs cell growth and elicits a SOS response in E. coli. b, Growth inhibition of E. coli when SuCas12a2 plasmids are present across various targeting conditions and antibiotic treatments. Cell turbidity was measured by absorbance at 600 nm (ABS600). NT, non-target plasmid; T, target plasmid. Data are mean ± s.d. of at least three independent experiments starting from separate colonies. c, SOS-responsive expression of GFP in E. coli after 4 hours of plasmid targeting by SuCas12a2 without antibiotic selection. Fluorescence was measured at wavelength 485 nm and 528 nm for excitation and emission respectively. RFU, relative fluorescence units. ABS600, absorbance at 600 nm. Data are mean ± s.d. of at least four independent experiments started from separate colonies. The dots correspond to replicates. The statistical analysis was performed using a one-tailed t-test assuming unequal variances.

4.2.1. Measuring the SOS response

The collateral activity of activated Cas12a2 against dsDNA was tied to the growth-arrest phenotype through damage to the host’s chromosomal DNA (Dmytrenko et al., 2023). Here, we present a method to measure the corresponding SOS DNA damage response in E. coli. In this assay, we co-transform a plasmid expressing SuCas12a2 with an E. coli SOS-biosensor plasmid expressing GFP as a reporter protein under the control of the recA promoter (Chen et al., 2012). As can be seen in Figure 3c, SuCas12a2 significantly induces GFP expression from the SOS-construct compared with a nuclease guided by a non-targeting gRNA. This method can effectively be used to measure a SOS-response in E. coli resulting from the collateral activity of SuCas12a2.

4.2.2. Design of DNA expression constructs

In this assay, SOS-biosensor plasmids and nuclease plasmids are introduced in E. coli BL21 (AI) strains previously used in the plasmid clearance assay. The aforementioned strains each contain a target- and gRNA-expressing plasmid. Three antibiotics are used for selection since the nuclease-expressing plasmid contains a kanamycin resistance marker; the target plasmid contains a chloramphenicol resistance marker and the SOS-biosensor plasmid contains an ampicillin (Amp) resistance marker. As controls, we use strains with target plasmids containing non-targeting gRNAs and introduce SOS-biosensor plasmids without a gfp gene.

4.3.3. Materials

  • E. coli Top10 strains with nuclease plasmids (CBS-5043, CBS-6648)

  • E. coli Top10 strains with SOS-biosensor plasmids (CBS-3611, CBS-3616)

  • E. coli BL21 (AI) strains with target- and gRNA-expressing plasmids (CBS-6177, CBS-6178)

  • MiniPrep kit (e.g., ZymoPURE Plasmid Miniprep Kit, #D4212 Zymo Research)

  • Pre-cooled electroporation cuvettes (at 4°C)

  • Electroporation system (e.g., Bio-rad Gene Pulser Xcell)

  • S.O.C. recovery medium (20 g/L tryptone, 5 g/L yeast extract, 0.5 g/L of NaCl, 2.50 mM KCl, 10 mM MgCl2.6H2O, 20 mM glucose)

  • Selective LB agar plates with Cm (50 μg/mL), Kan (50 μg/mL), Amp (50 μg/mL) and 0.2% glucose

  • 10-mL culture vials

  • LB medium (10 g/L tryptone, 5 g/L yeast extract, 5 g/L of NaCl) with Cm (50 μg/mL) or Kan (50 μg/mL) or Amp (50 μg/mL)

  • LB medium (10 g/L tryptone, 5 g/L yeast extract, 5 g/L of NaCl) with Cm (50 μg/mL), Kan (50 μg/mL), Amp (50 μg/mL) and 0.2% glucose

  • Nanodrop spectrophotometer for DNA concentration measurements

  • Spectrophotometer for OD measurements at 600 nm

  • 1.5 mL tubes

  • Nuclease and target selection medium: LB (10 g/L tryptone, 5 g/L yeast extract, 5 g/L of NaCl) with Cm (50 μg/mL), Kan (50 μg/mL), Amp (50 μg/mL) and 0.1 mM IPTG and 0.2% L-arabinose

  • Target selection medium: LB (10 g/L tryptone, 5 g/L yeast extract, 5 g/L of NaCl) with Kan (50 μg/mL), Amp (50 μg/mL) and 0.1 mM IPTG and 0.2% L-arabinose.

  • No selection medium: LB (10 g/L tryptone, 5 g/L yeast extract, 5 g/L of NaCl) with 0.1 mM IPTG and 0.2% L-arabinose

  • 96-well plate (e.g., Corning® 96-well Clear Flat Bottom Polystyrene TC-treated Microplates Cat #3598)

  • Fluorescence plate reader (e.g., Biotek Synergy Neo2 plate reader)

4.2.4. Protocol

  1. Purify the plasmid DNA from E. coli Top10 overnight cultures with nuclease plasmids (CBS-5043, CBS-6648) and SOS biosensor plasmids (CBS-3611, CBS-3616) by following the protocol of a MiniPrep kit. Measure the DNA concentration using a standard nanodrop spectrophotometer and dilute the clean and concentrated plasmid DNA to reach a concentration of 10 ng/μL.

  2. Electroporate 0.5 μL of both the nuclease plasmids (CBS-5043 or CBS-6648) and SOS-biosensor plasmids (CBS-3611 or CBS-3616) in 40 μL electrocompetent E. coli BL21 (AI) strains with target- and gRNA-expressing plasmids (CBS-6177, CBS-6178).

  3. Recover the transformed cells in 460 μL of S.O.C. medium for approximately 1 hour at 37°C with shaking at 220 rpm. S.O.C. medium is used because the glucose represses the T7 promoter of the nuclease.

  4. Plate 100 μL of each reaction on selective LB agar plates with Cm (50 μg/mL), Kan (50 μg/mL), Amp (50 μg/mL) and 0.2% glucose.

  5. The next day, select four colonies from each plate to serve as biological replicates and inoculate them into separate 10-mL culture vials. Each vial should contain 3 mL of selective LB medium supplemented with chloramphenicol (Cm, 50 μg/mL), kanamycin (Kan, 50 μg/mL), ampicillin (Amp, 50 μg/mL), and 0.2% glucose. Incubate the cultures overnight at 37°C with shaking at 220 rpm.

  6. Measure the optical density (OD) of all cultures at 600 nm the next morning using a spectrophotometer with according cuvettes.

  7. Transfer 1 mL from each culture to a 1.5 mL tube and spin the tubes down at 5,000 xg for 3 minutes.

  8. Remove the supernatant and resuspend the cells in 1 mL of fresh LB medium.

  9. Dilute the suspension with fresh LB medium to reach an OD of 0.1.

  10. Distribute 20 μL of the diluted LB-only cultures into a 96-well plate with 180 uL of:
    1. Nuclease and target selection medium.
    2. Target selection medium.
    3. No selection medium.
  11. Grow at 37°C with continuous shaking for 15 hours. Measure the OD at 600 nm and fluorescence (Ex 485 nm, Em 528 nm) with 5-minute intervals with vigorous shaking in-between.

  12. To calculate the change in fluorescence, first subtract the background fluorescence originating from the medium from the fluorescence values of all cultures. Next, subtract the fluorescence values of cultures lacking gfp from the fluorescence values of cultures with gfp at the time point where the fluorescence values peak. We chose the 4.5 hour time point because gfp fluorescence was approaching its peak; however, another time point can also be selected. Next, divide the difference in fluorescence by the OD value of the corresponding culture (with a recA promoter with a gfp gene) at time point 4.5 hours.

5. Cas12a2 activity in Cell-Free Transcription-Translation (TXTL)

Here, we demonstrate how a Cell-Free TXTL system can be used for in vitro characterization of SuCas12a2. TXTL is a reaction mixture comprising an E. coli lysate, salts, and buffers that supply all 20 amino acids and an ATP regeneration system (Garamella et al., 2016; Shin and Noireaux, 2012). TXTL facilitates rapid functional expression of RNA and protein, circumventing the requirements for cell culturing or protein purification.

In this assay, collateral cleavage activity of SuCas12a2 is measured using a reporter plasmid bearing a gfp gene (Figure 4a). After hybridization of a PFS-flanked RNA target molecule to a gRNA-directed SuCas12a2, non-specific degradation of the dsDNA GFP reporter plasmid by the nuclease will follow. By measuring the fluorescence of the TXTL reaction over time using a plate reader, we can detect the repression of GFP production as a result of collateral activity. As a control for this assay, we use a RNA target without a recognized PFS (non-PFS: 5′-TAGAT-3′), which is not expected to unleash collateral activity. To show that a DNA target will not activate collateral cleavage activation of SuCas12a2, a terminator is placed upstream of the DNA target, since the terminator will prevent transcription of the RNA target. Consistent with our expectation, the repression of GFP production in TXTL by SuCas12a2 is observed only when the target has a PFS and is expressed (Figure 4b). This in vitro method can thus be used to characterize the collateral cleavage activity of SuCas12a2 in a swift and straightforward manner using TXTL.

Figure 4. A cell-free TXTL system validates collateral cleavage activity of SuCas12a2 triggered by an expressed PFS-flanked RNA target.

Figure 4.

a, Diagram of the cell-free TXTL reactions used to measure GFP reporter silencing by the collateral trans-cleavage activity of SuCas12a2. A pre-expression step of the nuclease and gRNA in TXTL precedes a GFP reporter-silencing assay in TXTL. b, Collateral silencing by SuCas12a2 is evaluated by the presence of either a promoter or terminator upstream of the target expression site. Non-PFS, a dysfunctional protospacer flanking sequence. PFS, a functional protospacer flanking sequence. Scatter plots represent averages and standard deviations of at least three independent experiments started from separate colonies.

5.1. Design of DNA expression constructs for TXTL reactions

The DNA constructs used in TXTL to express the SuCas12a2 nuclease, gRNA, target DNA and GFP reporter can be in linear or plasmid form as long as a strong E. coli promoter is used (Marshall et al., 2017). An example is the Sigma 70 consensus promoter P70a used to express an adapted form of eGFP specifically designed for TXTL systems (Shin and Noireaux, 2010). It is recommended to use E. coli strain KL740 cl857+ for maintaining plasmids with a P70a promoter, because cI represses expression of the strong P70a promoter at temperatures below 30°C (Shin and Noireaux, 2010). Alternatively, the inducible T7 promoter can be utilized to achieve adequate gRNA expression (Wandera et al., 2020). When using the T7 promoter, however, an additional DNA construct encoding for the otherwise absent T7 RNA polymerase must be added (Wandera et al., 2020). Because plasmid maintenance does not have to be accounted for in TXTL, the same plasmid backbone can be used for different constructs (Wandera et al., 2020). Using linear DNA to avoid time-consuming cloning steps is possible only when GamS or DNA encoding for Chi sites is added to inhibit linear DNA degradation by the RecBCD system present in the E. coli lysate-derived TXTL reactions (Marshall et al., 2017; Sitaraman et al., 2004). The DNA sequence of deGFP has been modified through truncation to augment translation and enhance gfp expression (Shin and Noireaux, 2012).

5.2. DNA preparation for for TXTL reactions

We have learned that highly pure DNA must be provided to the TXTL mix to avoid interference of other components with the transcription-translation machinery. Suitable plasmid DNA is obtained by first using a MidiPrep kit for purification, followed by a separate DNA cleanup protocol. This approach is necessary because MiniPrep kits do not provide DNA of comparable cleanliness and yield more variable results in TXTL experiments. When using linear DNA from a PCR reaction, the DNA is purified using a standard DNA cleanup protocol.

5.2.1. Materials for DNA preparation for TXTL reactions

  • E. coli strains with nuclease plasmid (CBS-5043), gRNA plasmid (CBS-5044) and T7RNAP plasmid (CBS-338), target plasmids (CBS-3619, CBS-3621, CBS-6650, CBS-6651) and GFP reporter plasmid (CBS-6649)

  • 50-mL shake flasks

  • LB medium with the appropriate antibiotic (10 g/L tryptone, 5 g/L yeast extract, 5 g/L of NaCl)

  • 50-mL tubes (e.g., Falcon tubes)

  • Midiprep kit (e.g., ZymoPURE II Plasmid Midiprep Kit, #D4201 Zymo Research)

  • DNA cleanup kit (e.g., DNA Clean & Concentrator-25, #D4033 Zymo Research)

  • Incubator at 37°C

  • Centrifuge for 50-mL tubes

5.2.2. Protocol for DNA preparation for TXTL reactions

  1. Inoculate a single colony from E. coli strains with nuclease plasmid (CBS-5043), gRNA plasmid (CBS-5044) and T7RNAP plasmid (CBS-6048), target plasmids (CBS-3619, CBS-3621, CBS-6650, CBS-6651) and GFP reporter plasmid (CBS-6649) in a shake flask with selective LB (~50 mL) with the appropriate antibiotic. Place the culture shaking in an incubator overnight at 37°C and 220 rpm.

  2. Transfer the cultures to 50-mL tubes the next day and pellet the cells using centrifugation at 3,200 xg for 30 minutes.

  3. Purify the plasmid DNA from the cells by following the protocol of a MidiPrep kit followed by an additional purification step using a DNA cleanup kit. Measure the DNA concentration and dilute the clean and concentrated plasmid DNA to meet the desired stock concentration mentioned in Table 5 and Table 6.

Table 5.

Components for the TXTL pre-expression reaction. The table states the reaction volume needed for one experiment. We recommend the preparation of a master mix to account for multiple reactions.

Component Volume (μL) Stock concentration (nM) Final concentration (nM)
myTXTL® 9 - -
Cas12a2 plasmid 0.8 30 2
gRNA plasmid 1.6 30 4
T7RNAP plasmid 0.12 20 0.2
IPTG 0.12 20 0.2
Water 0.36 - -
Table 6.

Components for TXTL collateral cleavage assay. The table indicates the reaction volume necessary for a single experiment. We advise preparing a master mix with myTXTL® and water first to cover a multitude of reactions. Typically, the deGFP plasmid is added as the final step.

Component Volume (μL) Stock concentration (nM) Final concentration (nM)
myTXTL® 8 - -
Pre-expressed Cas12a2 & gRNA 2 - -
Target plasmid 0.6 40 2
deGFP plasmid 1.2 12 1.2
Water 0.20 - -

5.3. TXTL pre-expression of SuCas12a2 with a gRNA

To ensure the complete formation of active SuCas12a2 RNPs, we pre-express the SuCas12a2 nuclease and gRNA in a commercially available TXTL mix (myTXTL® Sigma 70 Master Mix Kit, Daicel Arbor Biosciences). However, it is also possible to prepare an efficient endogenous E. coli-based TXTL system in-house following an established protocol (Sun et al., 2013). A plasmid encoding T7 RNA polymerase is added to ensure gRNA transcription, as this enzyme is not present in the myTXTL® Sigma 70 Master Mix Kit.

5.3.1. Materials for TXTL pre-expression of SuCas12a2 with a gRNA

  • myTXTL® Sigma 70 Master Mix Kit (Daicel Arbor Biosciences)

  • Clean and concentrated nuclease, gRNA and T7RNAP plasmids from the previous step

  • IPTG (1 M)

  • PCR tubes

  • Bucket with ice

  • Incubator or thermocycler at 29°C

5.3.2. Protocol for TXTL pre-expression of SuCas12a2 with a gRNA

  1. Calculate the volume of pre-expression TXTL mix that is required for the subsequent DNA cleavage assay. We usually use 2 μL of the pre-expression mixture in a 12-μL GFP reporter cleavage assay.

  2. Mix the reaction carefully in a PCR tube by slow pipetting and place the reaction in a thermocycler or incubator for 16 hours at 29°C. We recommend making a master mix with myTXTL® mix, IPTG and T7 RNAP plasmid, before aliquoting it to a PCR tube with Cas12a2 plasmid and gRNA plasmid.

  3. The final pre-expression reaction can be used directly after or kept frozen at −20 °C for future use.

5.4. TXTL collateral cleavage assay

When the pre-expression reaction has been incubated for 16 hours, an aliquot of the reaction can be mixed with fresh myTXTL® mix, a target plasmid, a GFP reporter plasmid and water. After mixing all of the components, we measure the production of GFP or the repression thereof over time using a plate reader.

5.4.1. Materials for TXTL collateral cleavage assay

  • myTXTL® Sigma 70 Master Mix Kit (Arbor Biosciences myTXTL®)

  • Pre-expression TXTL mix from the previous step

  • Clean and concentrated target and deGFP reporter plasmids from the previous step

  • 96-well plate (e.g., Corning® 96-well Clear V-Bottom, Cat #3363)

  • Cover mat (e.g., Fisher Scientific, Corning™ Storage Mat III, Cat #10428571)

  • Fluorescence plate reader (e.g., Biotek Synergy Neo2 plate reader)

  • 1.5-mL tube

  • PCR tubes

  • PCR plate cooling-block

  • Bucket with ice

5.4.2. Protocol for TXTL collateral cleavage assay

  1. To prepare for the assay, turn on the plate reader and allow it to warm up until the internal temperature reaches 29°C.

  2. Add pre-expression TXTL mix to a PCR tube for every reaction and keep the tube on ice. Repeat this three times per reaction to include biological replicates.

  3. Prepare a master mix with myTXTL® and water in a 1.5-mL tube and keep it on ice.

  4. Transfer an aliquot of the master mix to the PCR tubes with the pre-expression mixture. Make sure to keep the reaction on ice as much as possible.

  5. Add the target plasmid to the PCR tubes first, followed by the addition of the deGFP reporter plasmid. Gently mix the mixture by pipetting slowly up and down.

  6. Transfer two times 5 μL of each reaction into two separate wells of a 96-well V-bottom plate to include technical replicates. Ensure no bubbles are introduced by pressing the pipet to the first stop only. To keep the reaction from starting, we recommend placing the 96-well V-bottom plate in or on a cooling block (pre-cooled at −20°C).

  7. Cover the plate with a sealing mat to prevent evaporation of the reaction mix in the plate reader. When the 96-well V-bottom plate touches the ice, make sure to wipe it dry before placing it in the plate reader.

  8. Incubate the reactions for 10–16 hours at 29°C and monitor GFP fluorescence at three-minute intervals (Ex 485 nm, Em 528 nm).

6. Expression and Purification of Cas12a2

While in vivo assays and TXTL can provide important insights into the function of immunity, in vitro cleavage assays with recombinantly expressed protein allows for the direct characterization of each of the biochemical activities of Cas12a2. These assays can be performed with apo Cas12a2, or, because Cas12a2 processes its own crRNA, with Cas12a2 co-expressed with a CRISPR array. Expression and purification of SuCas12a2 co-expressing the gRNA is a time- and cost-effective alternative to purchasing or transcribing large quantities of synthetic gRNA. However, we have not had success using co-expressed Cas12a2 RNPs in structural studies and co-expressed RNPs at times can be contaminated with activating RNAs.

Purification of apo protein has been essential to determining high-resolution structures and is critically important in leveraging the programmability of SuCas12a2 as a CRISPR–Cas system. For these reasons, we have found it useful to express and purify both apo Cas12a2 and Cas12a2 expressing a CRISPR array. Various methods describing the expression and purification of SuCas12a2 have previously been reported (Bravo et al., 2023; Dmytrenko et al., 2023; Domgaard, 2022; Keiser, 2022). Here we provide a detailed and optimized expression and purification protocol for both apo and co-expressed RNA, along with methods used to reconstitute RNPs using apo Cas12a2 and synthetic guide RNA for structure determination. A schematic overview of the entire method with supporting results can be found in Figure 5.

Figure 5. Expression and purification of Cas12a2.

Figure 5.

a, Outline of Cas12a2 expression protocol. b, Outline of Cas12a2 purification protocol. c. The individual steps of Cas12a2 purification over nickel affinity chromatography, including a representative gel of the resulting protein. Samples from different stages of the purification are indicated by letters A - D. The Cas12a2 band is indicated with the black arrow. d, representative chromatogram of Cas12a2 desalting over a HiPrep 26/10 column after nickel chromatography. e, Representative chromatogram of Cas12a2 ion exchange purification over HiTrap SP HP column. Peaks of the chromatogram are labeled with letters A - D. f, Representative chromatogram of Cas12a2 purification by size exclusion over a Superdex 200 pg 26/60 column. Peaks of the chromatogram are labeled with letters A - D. g, Diagram of the usual buffer setup used for purification steps after nickel chromatography. h, Representative SDS-PAGE of ion exchange chromatography over HiTrap SP HP column. Samples from different peaks are labeled as in e. Cas12a2 is indicated with the black arrow. g, Representative SDS-PAGE of size exclusion chromatography over Superdex 200 pg 26/60. Samples from different peaks are labeled as in f. Cas12a2 is indicated with the black arrow.

6.2. Cas12a2 expression

6.2.1. Materials

  • E. coli strain NiCo21 (DE3) (NEB) or E. coli strain HMS174 (DE3) (Novagen)

  • Cas12a2 expression plasmid

  • LB medium, autoclaved (GoldBio)

  • LB agar plates (Fisher)

  • TB media, autoclaved (24 g yeast extract (Fischer), 20 g tryptone (Fischer), 5 g glycerol (Pharmco), 900 mL H2O)

  • Sterile phosphate buffer (0.17 M KH2PO4, 0.72 M K2HPO4), filtered 0.22 μm.

  • 1.0 M Isopropyl ß-D-1-thiogalactopyranoside (IPTG) (Fisher)

  • 2 – 3 gallons of ice

6.2.2. Protocol

  1. Thaw 50 μL aliquot of chemically competent E. coli NiCo21 (DE3) or HMS173 (DE3) cells on ice for 30 minutes.

  2. Add ~20 ng of purified plasmid DNA of Cas12a2 expression vector. Mix DNA with the cells by flicking the end of the tube three times and incubate on ice for 30 minutes.

  3. Heat-shock cells in 42°C water bath for 45 seconds then return to ice for 2 minutes. The tube containing cells should be buried in the ice after heat-shock.

  4. Add 250 μL of LB media to the transformations and allow the cells to recover at 37°C with 200 rpm shaking for 45 minutes. SOC media can also be used at this step, but it has not been shown to make a difference.

  5. Plate 60 μL of the recovered cells on agar plates with the appropriate antibiotics.

  6. Leave the plates to incubate at 37°C for 16 – 18 hours (overnight).

  7. After plates have incubated overnight, remove them from the incubator and place them at room temperature. The protocol may also be paused at this point by placing the plates at 4°C until ready to continue. Plates may be stored up to 3 weeks before a new transformation needs to be made.

  8. At the end of the day, use a single colony from the transformation plate to inoculate 20 mL of LB media treated with the appropriate antibiotic. This growth is best performed in a 50 mL conical tube (VWR) or small 250 mL culture flask. For multiple liters of growth, add an additional 20 mL of LB media for each additional liter of growth (e.g., 60 mL overnight for 3 L of growth). The screw lids of 50-mL conical tubes should be left a quarter turn loose, then secured with a piece of lab tape.

  9. Incubate the culture at 37°C with 200 rpm shaking overnight.

  10. Prepare for expression on Day 3 by autoclaving 900 mL of fresh TB media (omitting phosphate buffer) for each liter of growth. Prepare the phosphate buffer for TB media separately and sterilize by vacuum filtration through a 0.22 μm filter into a sterile bottle.

  11. Aseptically combine 100 mL of sterile phosphate buffer with 900 mL of TB media then supplement with the appropriate antibiotic.

  12. Inoculate each liter of TB media with 20 mL of overnight culture and allow cells to grow at 37°C with 200 rpm shaking until an OD600 of 0.6 – 0.8. Usually, this takes about 6 – 8 hours, but some mutant constructs can reach OD600 in less than 4 hours.

  13. After cells have reached the appropriate optical density, cold shock the growths in ice for 15 minutes. The flasks are placed on top of ice then buried by shoveling additional ice over and around the sides of the flask. We recommend cold shocking in a large sink to contain the mess of melting ice.

  14. While cells are cold-shocking, cool the incubator to 18°C.

  15. After cells have sat on ice for 15 minutes, induce expression by adding 100 μL of 1 M Isopropyl ß-D-1-thiogalactopyranoside (IPTG) for a final concentration of 0.1 mM and grow cells for 16 – 18 hours (overnight) at 18°C.

  16. To harvest cells, centrifuge at 8,000 rpm for 25 minutes at 4°C.

  17. While the centrifuge runs, add bleach to each growth flask to begin sterilizing. Cleaning of any other dirty equipment that may also begin at this time.

  18. After cells spin down, decant the media supernatant from the centrifuge tube into the bleached growth flasks. Leave the centrifuge tube inverted on a paper towel for ~2 minutes to allow excess media to drain away.

  19. Using a spatula transfer the cell pellet from the bottom of the centrifuge tube into a 50 mL conical tube.

  20. Weigh the mass of the cell pellet and record on the outside of the tube along with the plasmid id number and your initials. Cells may be stored in the −80°C freezer for 6 months.

6.3. Cas12a2 purification

6.3.1. Materials

  • Buffers prepared according to Table 7, filtered 0.22 μm and chilled to 4°C.

  • Protease inhibitors (0.5μg/mL aprotinin (GoldBio, A-655–25), 0.7μg/mL pepstatin A (Fisher, BP26715), 0.5μg/mL leupeptin (Alfa Aesae, AAJ61188MB), 0.2 mM AEBSF (GoldBio, A-540–500))

  • Nickel resin (ThermoFisher, PI88221)

  • CrystalCruz Chromatography Column (Kimble, sc-205558)

  • HiPrep 26/10 desalting column (Cytiva, 17508701)

  • HiTrap SP HP ion exchange column (Cytiva, 17115201)

  • HiTrap Q HP column (Cytiva, 17115401).

  • Superdex 200 pg 26/60 sizing column (Cytiva, 28989336)

  • Superdex 200 10/300 increase GL sizing column (Cytiva, 28990944)

  • 100 kDa MWCO spin concentrators (Corning)

  • 250 mL Metal beaker chilled on ice.

  • Sonifier

  • AKTA pure pump system (Cytiva)

Table 7.

Buffers used in SuCas12a2 purification

Reagents Lysis Nickel Wash Nickel Elution Low Salt High Salt SEC Cryo-EM
Tris pH 7.2 (mM) 25 25 25 25 25 0 0
HEPES pH 7.2 (mM) 0 0 0 0 0 25 12.5
NaCl (mM) 500 500 500 50 150 0 0
KCl (mM) 0 0 0 0 0 150 150
MgCl2 (mM) 2 2 2 2 2 2 2
Imidazole (mM) 50 50 250 0 0 0 0
Glycerol (%) 10 10 10 10 10 5 0

6.3.1. Protocol

  1. Resuspend cell pellets in 50 mL of lysis buffer treated with 10uL aprotinin, 50uL pepstatin, 50uL leupeptin, 500uL AEBSF, 125uL lysozyme. Allow the pellet to thaw on ice for 30 minutes.

  2. After thawing, mix the cell pellet with the lysis buffer until smooth, trying to avoid bubbles. Transfer slurry to a metal beaker on ice.

  3. Sonicate cell mixture with sonifier at 5/50 in 10 second intervals followed by 10 seconds rest until the cell mixture color darkens and the viscosity becomes like water. Sonication power settings may need to be adjusted to prevent foaming or overheating of the lysate. Periodic adjustments will be required to ensure that the sonicator probe does not leave the lysate as the ice melts and the metal beaker sinks.

  4. Clarify lysate by centrifugation of 16,000 rpm for 35 minutes at 4°C.

  5. While lysate clarifies, transfer 2 – 3 mL of Ni-NTA resin into a flex column and equilibrate by first rinsing with filtered water, followed by 10 mL of lysis buffer.

  6. Incubate clarified lysate with Ni-NTA resin in flex column for 30 min at 4°C with rocking.

  7. Flow lysate over the column, collecting the flowthrough, then re-flow the lysate over the column two more times.

  8. Wash resin with 500 mL of Nickel Wash Buffer. Washes can be expedited by pushing the buffer through the flex column with an air filled syringe or by siphoning the buffer through a silicone tube.
    1. Note: Cas12a2 with co-expressed RNA should be washed with 100 mL of Lysis Buffer instead of Nickel Wash Buffer. Washing with Nickel Wash Buffer will wash away the bound gRNA.
  9. After washing the Ni-NTA resin, elute Cas12a2 from the column with ten, 4 mL fractions of nickel elution buffer. Incubate the first three elutions for 30 minutes before collecting each elution. Usually most of the protein comes off in the first three elutions. The remaining seven elutions can be collected with or without incubation.

  10. Collect samples of each stage of the nickel purification (eg. lysis, flowthrough, washes, etc.) and analyze the protein content by SDS-PAGE.

  11. Prepare the pump system with Low Salt Buffer on line A1 and High Salt buffer on line B1. Perform a pump wash for both buffers and then equilibrate the whole system in Low Salt Buffer.

  12. Load fractions containing Cas12a2 from nickel affinity chromatography over a Hiprep 26/10 desalting column. The 26/10 column has a capacity of 16 mL per run, so larger purifications may require desalting of the nickel elutions in multiple batches.

  13. Collect fractions of desalted protein and pool to load over ion exchange.
    1. Note: Apo Cas12a2 is purified with a HiTrap SP HP ion exchange column (Cytiva) while Cas12a2 co-expressed with a gRNA guide is purified with the HiTrap Q HP column (Cytiva).
  14. Flush the sample pump with a low salt buffer and then load the desalted protein sample over the ion exchange column. Collect the flowthrough.

  15. After the sample has been loaded over the ion exchange column, continue to wash with low salt until the UV absorbance returns to baseline.

  16. Wash the column with 5 CV of 10% B and collect fractions.

  17. Elute protein from column with a 5 CV gradient to 100% B (High Salt Buffer) with the system in up-flow. Collect the elution peaks in 2 mL fractions.

  18. Collect and analyze samples from desalting and ion exchange by SDS-PAGE to identify fractions containing Cas12a2.

  19. Pool fractions containing clean Cas12a2 as determined by SDS-PAGE.

  20. Concentrate Cas12a2 in a 100 kDa MWCO spin concentrator by centrifugation between 1200 and 2500 rpm in 9 minute intervals at 4C. Speed may need to be adjusted during the course of concentration as fast speeds with highly concentrated proteins can lead to precipitation. Concentrate Cas12a2 down to 1 mL.

  21. While concentrating, start the Size Exclusion Chromatography program on the AKTA. It will take several hours for the column to be equilibrated before the sample is injected from the sample loop. While the column is equilibrating, attach the 1 mL sample loop to the column and flush with 5 mL of filtered water followed by 5 mL of Low Salt Buffer.

  22. Load concentrated Cas12a2 into the sample loop through the injection port. Important! One end of the sample line is open to the waste position to allow injection of a sample. Make sure to leave the syringe used to load Cas12a2 in the injection port even after injection to prevent siphoning of the sample into the waste.

  23. Analyze peak fraction from SEC by SDS-PAGE.

  24. Cryo-EM structures are prepared with apo Cas12a2 complexed with synthetic gRNA.

  25. Pool and concentrate SEC fractions that contain clean apo Cas12a2 in a 100 kDa MWCO spin concentrator. Quantify by nano-drop when the protein sample reaches ~500 μL.

  26. Prepare gRNA for complexation by incubating a 500 μM aliquot of synthetic gRNA at 65 °C for 3 min followed by cooling 1 °C min−1 to room temperature.

  27. Combine heated gRNA with apo Cas12a2 in a 1:1.2 molar ratio to a final volume of 500 μL.

  28. While forming the binary complex, start the Size Exclusion Chromatography program on the AKTA to equilibrate a Superdex 200 10/300 increase GL sizing column (Cytiva) into Cryo-EM Buffer. While the column is equilibrating, attach the 0.5 mL sample loop to the column and flush with 5 mL of filtered water followed by 5 mL of Size Exclusion Buffer.

  29. Load Cas12a2 binary complex into the sample loop through the injection port using a microtip injection needle (Hampton).

7. Cas12a2 In vitro cleavage assays

Characterizing the in vitro activity of Cas12a2 requires purified protein (as described above) along with gRNA, target RNA and/or sequence non-specific substrates. In the following sections we provide a description of how to design sequence specific and non-specific cleavage substrates, along with providing detailed methods for testing the biochemical activity of SuCas12a2. A schematic overview of the different in vitro cleavage assay with supporting results can be found in Figure 6.

Figure 6. Cas12a2 in vitro cleavage assays.

Figure 6.

a, graphical representation of the components needed for Cas12a2 target (top), collateral (middle) and plasmid (bottom) cleavage assays including final concentrations for each reaction component. b, Representative time course for supercoiled plasmid cleavage by Cas12a2. Time points were collected at 0, 1, 2, 5, 10, 20, 30, 45 min and 60 min.

7.1. Cas12a2 cleavage visualization

Denaturing PAGE analysis is the preferred method to observe nucleic acid cleavage by Cas12a2. Denaturing PAGE conditions like 7 M urea PAGE is a common method used to demonstrate nucleic acid cleavage and is used below to visualize sequence non-specific collateral cleavage. However, we found that 7 M urea-PAGE was often insufficient for consistent denaturation of the guide-target duplex leading to multiple, shifted bands making interpretation difficult. We found that FDF-PAGE, as described previously, was more effective at denaturing the guide-target duplex. (Harris et al., 2015). FDF-PAGE mainly differs from traditional urea-PAGE by the inclusion of higher concentrations of formamide and formaldehyde in the loading buffer accompanied by a 15-minute denaturing step at 55°C.

Cleavage products could be visualized by either radiolabeled or fluorescein (FAM) labeled cleavage substrate. We chose to visualize our cleavage experiments using FAM labeled target RNA because of increased stability of the FAM label. An additional method used to visualize sequence non-specific cleavage activity is running cleaved plasmid DNA on an agarose gel treated with ethidium bromide (EtBr).

7.2. Sequence-specific target RNA design

As mentioned above, sequence specific target RNA cleavage, and activation of sequence non-specific collateral cleavage, depend on guide-target binding and the recognition of an activating PFS (Bravo et al., 2023; Dmytrenko et al., 2023). There is inherent flexibility in the activating PFS profile, but the common profile is 5′-BAAAN-3′ (where B indicates not adenine) positioned at the 3′ end of the target sequence (Dmytrenko et al., 2023). The minimal target consists of a 24-nt spacer complement flanked on the 3′ side by the PFS. While additional flanking sequence at the 5′ or 3′ ends is not strictly required for Cas12a2 activation, substrates between 50–75-nt result in dramatic shifts during polyacrylamide gel electrophoresis and are thus preferred when analyzing sequence specific target cleavage.

7.1.2. Materials for target cleavage assay

  • NEB 3.1 Buffer

  • Purified Cas12a2

  • gRNA

  • Target RNA (5′ FAM labeled)

  • Nuclease Free Water (DEPC treated)

  • Phenol-chloroform (pH 6.0)

  • Denaturing Buffer (for 990 μl, 267.3 μl 37% formaldehyde, 655.2 μl formamide, 67.5 μl 10x MOPS buffer)

  • FDF-PAGE (4.2 g urea, 0.5 mL 10 x MOPS buffer, 3 mL 40% acrylamide, fill to 10 mL with ddH2O, per gel)

  • 10x MOPS buffer (200 mM MOPS, 50 mM sodium acetate, 10 mM EDTA)

  • 10% ammonium persulfate

  • Tetramethylethylenediamine (TEMED)

7.1.1. Protocol for target cleavage assay

  1. Prepare FDF-PAGE gels as described in (Harris et al., 2015). Polymerize FDF-PAGE mix (4.2 g urea, 0.5 mL 10 x MOPS buffer, 3 mL 40% acrylamide, fill to 10 mL with ddH2O, per gel) with 80 μL 10% APS and 10 μL TEMED. Allow gels to polymerize for at least 30 minutes.

  2. After gels are polymerized, flush the wells of the gel with a p1000 pipet and pre-run the gel in 0.5 x MOPS buffer (10 mM MOPS, 2.5 mM sodium acetate, 0.5 mM EDTA) for at least 30 minutes.

  3. Prepare individual reactions as described in Table 8.

  4. Combine all reaction components in a PCR tube and incubate for 1.0 hour at 37°C. Prepare a no cleavage control by omitting the gRNA from the mix and replacing its volume with water.

  5. Quench reactions by adding 10 μL of acidic (pH 6.0) phenol-chloroform. Securely close the tube and mix by flicking the end of the tube 3 times. Separate aqueous and organic layers of the quenched reactions by briefly centrifuging the tubes for 1 minute.

  6. Extract 4 μL from the aqueous layer of the quenched reactions and combine with 13 μL of formaldehyde denaturing buffer. Incubate extracted samples at 55°C for 15 minutes in a thermocycler.

  7. Re-flush the wells of the FDF-PAGE gel with the p1000 pipet. Then load 15 μL of sample into FDF - PAGE wells. If not all the wells are being used, load 15 μL of formaldehyde denaturing buffer to prevent “smiling” in the gel.

  8. Run the gel at 50 V for 15 minutes to allow samples to enter the gel, then adjust the voltage to 150 V for 1 hour. Cover the gel box with a cardboard box to protect FAM labeled substrates from photobleaching. Usually, 1 hour is sufficient to fully resolve the cleaved and uncleaved target RNA.

Table 8.

Target cleavage reaction condition.

Components [Initial] [Final] Volume (μL)
NEB 3.1 Buffer (X) 10 1 1.0
Cas12a2 (μM) 5 0.6 1.2
gRNA (μM) 2 0.72 3.6
FAM Target RNA (μM) 2 0.3 1.5
H2O 2.7
Total 10.0

Note: For Cas12a2 co-expressing gRNA, replace the volume of gRNA with H2O

7.3. Sequence non-specific, collateral substrate design

Sequence non-specific collateral substrates may be ssRNA, ssDNA, dsDNA and cleavage has been observed using either synthetic, linear substrates or supercoiled (SC) plasmid DNA. Synthetic substrates are designed to contain no sequence complementarity with the gRNA guide and can be any other sequence, usually 50–75-nt to maximize the shift observed by PAGE analysis. Example sequences can be found in Table 9 Similarly, a SC plasmid is selected for sequence non-specific cleavage assays by identifying a plasmid with no complementarity to the gRNA guide that is large enough to produce significant shifts when run on an agarose gel.

Table 9.

Representative collateral cleavage sequences

Name Sequence
Collateral ssRNA 5′-CAGAGAUAAGUGACGCGCGGCGAGUGGCGCGCCACGUCGGAAAUCUAGAGGCG-3′
Collateral ssDNA 5′-AACTGATATGACAATTGCGCGTAGCACGACGACGATATGACACTTGCGCATAACGACGACGATACAATGAT-3′
Collateral dsDNA 5′-AACTGATATGACAATTGCGCGTAGCACGACGACGATATGACACTTGCGC
3′-TTGACTATACTGTTAACGCGCATCGTGCTGCTGCTATACTGTGAACGCG
ATAACGACGACGATACAATGAT-3′
TATTGCTGCTGCTATGTTACTA-5′

Note: All substrates are FAM labeled on the 5’ end. Labeled dsDNA can be made by annealing the unlabeled complement to the Collateral ssDNA substrate.

7.3.1. Materials for sequence non-specific, collateral cleavage assay

  • NEB 3.1 Buffer

  • Purified Cas12a2

  • gRNA

  • Target RNA

  • Collateral Substrate - ssRNA, ssDNA, or dsDNA (5′ FAM labeled)

  • Nuclease Free Water (DEPC treated)

  • Phenol-chloroform (pH 6.0)

  • 50% glycerol solution

  • 12% urea-PAGE (4.8 g urea, 2 mL 5x TBE, 3 mL 40% acrylamide, fill to 10 mL with ddH2O, per gel)

  • 5 x TBE buffer (450 mM Tris-borate, 10 mM EDTA)

  • 10% ammonium persulfate (APS)

  • Tetramethylethylenediamine (TEMED)

7.3.2. Protocol for sequence non-specific, collateral cleavage assay

  1. Prepare 12% urea-PAGE gels by polymerize urea-PAGE mix (4.8 g urea, 2 mL 5x TBE, 3 mL 40% acrylamide, fill to 10 mL with ddH2O, per gel) with 80 μL 10% APS and 10 μL TEMED. Allow gels to polymerize for at least 30 minutes.

  2. After gels are polymerized, flush the wells of the gel with a p1000 pipet and pre-run the gel in 1 x TBE buffer (90 mM Tris-borate, 2 mM EDTA) for at least 30 minutes.

  3. Prepare individual reactions as described in Table 10.

  4. Combine all reaction components in a PCR tube and incubate for 1.0 H at 37°C. Prepare a no cleavage control by omitting the gRNA from the mix and replacing its volume with water.

  5. Quench reactions by adding 10 μL of acidic (pH 6.0) phenol-chloroform. Securely close the tube and mix by flicking the end of the tube 3 times. Separate aqueous and organic layers of the quenched reactions by briefly centrifuging the tubes for 1 minute.

  6. Extract 5 μL from the top aqueous layer and combine with 5 μL of 50% glycerol.

  7. Re-flush the wells of the urea-PAGE gel with the p1000 pipet. Then load 9 μL of sample into urea - PAGE wells. If not all the wells are being used, load 9 μL of 25% glycerol to prevent “smiling” in the gel.

  8. Run the gel at 50 V for 15 minutes to allow samples to enter the gel, then adjust the voltage to 150 V for 1 hour. Cover the gel box with a cardboard box to protect FAM labeled substrates from photobleaching. Usually, 1 hour is sufficient to fully resolve the cleaved and uncleaved target RNA.

Table 10.

Sequence non-specific, collateral cleavage reaction conditions.

Components [Initial] [Final] Volume (μL)
NEB 3.1 Buffer (X) 10 1 1.0
Cas12a2 (μM) 5 0.6 1.2
gRNA (μM) 2 0.72 3.6
Target RNA (μM) 2 0.3 1.5
FAM non-target RNA, ssDNA or dsDNA (μM) 2 0.3 1.5
H2O 1.2
Total 10.0

Note: For Cas12a2 co-expressing gRNA, replace the volume of gRNA with H2O

7.3.3. Materials for plasmid cleavage assay

  • NEB 3.1 Buffer

  • Purified Cas12a2

  • Target RNA

  • Supercoiled pUC19 plasmid (or similar), isolated by Miniprep (e.g., E.Z.N.A. Plasmid DNA mini kit, Omega Bio-tek, D6942–00), then supercoiled fraction gel extracted from a 1% agarose and purified (e.g., E.Z.N.A. gel extraction kit. Omega Bio-tek, D2500–02)

  • Nuclease Free Water (DEPC treated)

  • Phenol-chloroform (pH 7 – 8)

  • 50% glycerol solution

  • Agarose (GoldBio)

  • TAE buffer (40 mM Tris pH 8.5, 20 mM glacial acetic acid, 1 mM EDTA)

  • Ethidium bromide (Apex)

7.3.4. Protocol for plasmid cleavage assay

  1. Prepare a 1% agarose gel by combining 0.5 g agarose (GoldBio) with 50 mL of 1 x TAE buffer (40 mM Tris pH 8.5, 20 mM glacial acetic acid, 1 mM EDTA). Microwave in 30 second increments until all agarose is dissolved.

  2. Before agarose gel polymerizes, spike the solution with one drop of ethidium bromide solution (Apex) and mix in. Then pour the agarose gel mixture into a mold and let it cool.

  3. While agarose gel cools, prepare reaction mixtures as described in Table 11.

  4. Combine all the reagents except target RNA in a PCR tube and incubate at 37°C for 30 minutes. For assays with a single time point combine all the reagents and incubate for 1.0 H.

  5. For time course assays, prepare 9 PCR tubes, each with 10 μL of pH 8.0 phenol-chloroform. For end-point assays, reactions will be quenched directly in the reaction tube.

  6. Before initiating the time course, prepare a zero time point by adding 0.5 μL of ddH2O to the first tube (T=0), then add 9.5uL of the incubated reaction mixture and mix by flicking the tube 3 times.

  7. Add 4.5 μL target RNA to initiate the reaction. Quench each time point by transferring 10 μL of the reaction mixture to the prepared tubes of phenol-chloroform and mix by flicking 3 times. Time points are collected at T=1, 2, 5, 10, 20, 30, 45, and 60 minutes.

  8. After collecting all the time points, ensure that all the tubes are securely closed before mixing again, then spin down for at least 30 seconds.

  9. Extract 5 μL from the aqueous layer of the phenol-chloroform and add to 5 μL of 50% glycerol.

  10. Prepare markers for SC, OC and LN plasmid in the gel by diluting each sample to 12.2 ng/μL then diluting again 1:1 in 50% glycerol.

  11. Load 9 μL of topological markers and time course samples into the agarose gel in chronological order. Load 2 μL of 1 kbp + DNA ladder (GoldBio).

  12. Run the gel at 100 V until the blue dye front in the DNA ladder lane reaches about halfway down the gel.

Table 11.

Plasmid cleavage assay reaction conditions

Reagent [Initial] [Initial] Volume (μL)
NEB 3.1 (X) 10 1 10
Cas12a2 (nM) 500 14 2.8
gRNA (nM) 500 14 2.8
SC-pUC19 (ng/μL) 25 12.2 48.8
H2O 30.6
Target RNA (nM) 500 25 4.5
Total 100

Note: The table above is for a time course assay. A 10 μL total volume can be used for single time points.

Table 1.

DNA sequences of gRNAs and corresponding target sequences used for in vivo experiments and TXTL.

Description DNA sequence from 5′ to 3′
CAO1 target flanked by PFS (underlined) CATCAAGCCTTCCTTCAGGTGTTGCTCCAGAAAG
CAO1 target flanked by non-PFS (underlined) CATCAAGCCTTCCTTCAGGTGTTGCTCCAATCTA
CAO1-targeting gRNA (Direct repeat is bold) GTCAATACGACTTTAAAAATTTCTACTATTGTAGATTGGAGCAACACCTGAAGGAAGGCTTG
Non-CAO1 targeting gRNA (Direct repeat is bold) GTCAATACGACTTTAAAAATTTCTACTATTGTAGATGAGGGATCTCGCTCCTGGAAGATGGTGAT

Table 2.

Strains used in the plasmid interference assay.

Strain ID E. coli strain Plasmid Description Link
CBS-5043 Top10 SuCas12a2, T7 promoter, Kan https://benchling.com/s/seq-O5MD7dRC9e3Ev4Z3KeSY?m=slm-tVcy34Iwv2QWhtB7WZzd
CBS-6648 Top10 MpCas12a, T7 promoter, Kan https://benchling.com/dmytrenko/f/lib_E3sOPw9k-plasmids/seq_1sesOHHO-pod1597-pod987–771775/edit
CBS-6177 BL21 (AI) CAO1 Target + CAO1 5x array (Targeting), Cm https://benchling.com/m-krebel/f/lib_oxiZPobk-plasmids/seq_zKO1Sf2V-pod2110/edit
CBS-6178 BL21 (AI) CAO1 Target + GAPDH T17 5x array (Non-targeting), Cm https://benchling.com/m-krebel/f/lib_oxiZPobk-plasmids/seq_8h4ED0T3-pod2111/edit

Table 3.

Strains used in the growth-based assays

Strain ID E.coli strain Plasmid description Link
CBS-3611 KL740 GFP expressing plasmid under recA promoter, sc101 ori, Amp https://benchling.com/s/seq-NiQkIzIGb2BwghqjyUKo?m=slm-gwuhBiHAcXtos5SNCU1D
CBS-3616 Top10 Plasmid with recA promoter without gfp gene, sc101 ori, Amp https://benchling.com/s/seq-rJXYotGTKZivfgIYCY4E
CBS-5043 Top10 SuCas12a2, T7 promoter, Kan https://benchling.com/s/seq-O5MD7dRC9e3Ev4Z3KeSY?m=slm-tVcy34Iwv2QWhtB7WZzd
CBS-6648 Top10 MpCas12a, T7 promoter, Kan https://benchling.com/dmytrenko/f/lib_E3sOPw9k-plasmids/seq_1sesOHHO-pod1597-pod987–771775/edit
CBS-6177 BL21 (AI) CAO1 Target + CAO1 5x array (Targeting), Cm https://benchling.com/m-krebel/f/lib_oxiZPobk-plasmids/seq_zKO1Sf2V-pod2110/edit
CBS-6178 BL21 (AI) CAO1 Target + GAPDH T17 5x array (Non-targeting), Cm https://benchling.com/m-krebel/f/lib_oxiZPobk-plasmids/seq_8h4ED0T3-pod2111/edit

Table 4.

Strains used in the Cell-Free Transcription/Translation (TXTL) assay.

Strain ID E. coli strain Description Link
CBS-6649 KL740 Expression Vector for T7 RNA Polymerase for TXTL, Amp https://benchling.com/s/seq-kowzukmKhKmA8w1ACt2b?m=slm-bh2zFBLFVsnzknVghsfQ
CBS-338 KL740 cI857+ deGFP under P70a promoter, Amp https://benchling.com/s/seq-EezkMaIVjmNgFxmLrDKd?m=slm-x3SrqrkOUBLsyJAfemfm
CBS-3619 Top10 CAO1 target under PJ23119 promoter, AUCUA PFS https://benchling.com/dmytrenko/f/lib_lTlqBtqV-cas-manuscript/seq_eI6f0lAW-pod988/edit
CBS-3621 Top10 CAO1 target under PJ23119 promoter, GAAAG PFS, Kan https://benchling.com/dmytrenko/f/lib_lTlqBtqV-cas-manuscript/seq_P9BG93fJ-pod1006/edit
CBS-6650 Top10 CAO1 target under terminator, GAAAG PFS, Kan https://benchling.com/schutfriso/f/lib_JcQTShos-plasmids/seq_9wVdevcb-pod990/edit
CBS-6651 Top10 CAO1 target under terminator, AUCUA PFS, Kan https://benchling.com/schutfriso/f/lib_JcQTShos-plasmids/seq_1AH7RWWv-pod1007/edit
CBS-5043 Top10 SuCas12a2, T7 promoter, Kan https://benchling.com/s/seq-O5MD7dRC9e3Ev4Z3KeSY?m=slm-tVcy34Iwv2QWhtB7WZzd
CBS-5044 Top10 CAO1 guide, Amp https://benchling.com/dmytrenko/f/lib_E3sOPw9k-plasmids/seq_tBdz9uBI-pod1591-pod1323-cao1/edit

References

  1. Altae-Tran Han, Kannan Soumya, Suberski Anthony J., Mears Kepler S., Demircioglu F. Esra, Moeller Lukas, Kocalar Selin, et al. 2023. “Uncovering the Functional Diversity of Rare CRISPR-Cas Systems with Deep Terascale Clustering.” Science 382 (6673): eadi1910. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bravo Jack P. K., Hallmark Thomson, Naegle Bronson, Beisel Chase L., Jackson Ryan N., and Taylor David W.. 2023. “RNA Targeting Unleashes Indiscriminate Nuclease Activity of CRISPR-Cas12a2.” Nature 613 (7944): 582–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chen Zhilan, Lu Meiling, Zou Dandan, and Wang Hailin. 2012. “An E. Coli SOS-EGFP Biosensor for Fast and Sensitive Detection of DNA Damaging Agents.” Journal of Environmental Sciences 24 (3): 541–49. [DOI] [PubMed] [Google Scholar]
  4. Dmytrenko Oleg, Neumann Gina C., Hallmark Thomson, Keiser Dylan J., Crowley Valerie M., Vialetto Elena, Mougiakos Ioannis, et al. 2023. “Cas12a2 Elicits Abortive Infection through RNA-Triggered Destruction of dsDNA.” Nature 613 (7944): 588–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Domgaard Hannah. 2022. “Investigations of Prokaryotic Defense Systems.” Utah State University. 10.26076/cebb-fa0a. [DOI] [Google Scholar]
  6. Garamella Jonathan, Marshall Ryan, Rustad Mark, and Noireaux Vincent. 2016. “The All E. Coli TX-TL Toolbox 2.0: A Platform for Cell-Free Synthetic Biology.” ACS Synthetic Biology 5 (4): 344–55. [DOI] [PubMed] [Google Scholar]
  7. Harris C. Jake, Molnar Attila, Müller Sebastian Y., and Baulcombe David C.. 2015. “FDF-PAGE: A Powerful Technique Revealing Previously Undetected Small RNAs Sequestered by Complementary Transcripts.” Nucleic Acids Research 43 (15): 7590–99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Keiser Dylan J. 2022. “Functional Characterization of the Newly Discovered Type V CRISPR-Cas Protein Cas12a2.” Utah State University. 10.26076/7ac8-f685. [DOI] [Google Scholar]
  9. Li Shi-Yuan, Cheng Qiu-Xiang, Liu Jia-Kun, Nie Xiao-Qun, Zhao Guo-Ping, and Wang Jin. 2018. “CRISPR-Cas12a Has Both Cis- and Trans-Cleavage Activities on Single-Stranded DNA.” Cell Research 28 (4): 491–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Liao Chunyu, Ttofali Fani, Slotkowski Rebecca A., Denny Steven R., Cecil Taylor D., Leenay Ryan T., Keung Albert J., and Beisel Chase L.. 2019. “Modular One-Pot Assembly of CRISPR Arrays Enables Library Generation and Reveals Factors Influencing crRNA Biogenesis.” Nature Communications 10 (1): 2948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Liu Liang, Li Xueyan, Ma Jun, Li Zongqiang, You Lilan, Wang Jiuyu, Wang Min, Zhang Xinzheng, and Wang Yanli. 2017. “The Molecular Architecture for RNA-Guided RNA Cleavage by Cas13a.” Cell 170 (4): 714–26.e10. [DOI] [PubMed] [Google Scholar]
  12. Makarova Kira S., Wolf Yuri I., Iranzo Jaime, Shmakov Sergey A., Alkhnbashi Omer S., Brouns Stan J. J., Charpentier Emmanuelle, et al. 2020. “Evolutionary Classification of CRISPR-Cas Systems: A Burst of Class 2 and Derived Variants.” Nature Reviews. Microbiology 18 (2): 67–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Marino Nicole D., Pinilla-Redondo Rafael, and Bondy-Denomy Joseph. 2022. “CRISPR-Cas12a Targeting of ssDNA Plays No Detectable Role in Immunity.” Nucleic Acids Research 50 (11): 6414–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Marshall Ryan, Maxwell Colin S., Collins Scott P., Beisel Chase L., and Noireaux Vincent. 2017. “Short DNA Containing χ Sites Enhances DNA Stability and Gene Expression in E. Coli Cell-Free Transcription-Translation Systems.” Biotechnology and Bioengineering 114 (9): 2137–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Shin Jonghyeon, and Noireaux Vincent. 2010. “Efficient Cell-Free Expression with the Endogenous E. Coli RNA Polymerase and Sigma Factor 70.” Journal of Biological Engineering 4 (June): 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Shin Jonghyeon, and Noireaux Vincent. 2012. “An E. Coli Cell-Free Expression Toolbox: Application to Synthetic Gene Circuits and Artificial Cells.” ACS Synthetic Biology 1 (1): 29–41. [DOI] [PubMed] [Google Scholar]
  17. Sun Zachary Z., Hayes Clarmyra A., Shin Jonghyeon, Caschera Filippo, Murray Richard M., and Noireaux Vincent. 2013. “Protocols for Implementing an Escherichia Coli Based TX-TL Cell-Free Expression System for Synthetic Biology.” Journal of Visualized Experiments: JoVE, no. 79 (September): e50762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Swarts Daan C., and Jinek Martin. 2018. “Cas9 versus Cas12a/Cpf1: Structure-Function Comparisons and Implications for Genome Editing.” Wiley Interdisciplinary Reviews. RNA 9 (5): e1481. [DOI] [PubMed] [Google Scholar]
  19. Swarts Daan C., van der Oost John, and Jinek Martin. 2017. “Structural Basis for Guide RNA Processing and Seed-Dependent DNA Targeting by CRISPR-Cas12a.” Molecular Cell 66 (2): 221–33.e4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Wandera Katharina G., Collins Scott P., Wimmer Franziska, Marshall Ryan, Noireaux Vincent, and Beisel Chase L.. 2020. “An Enhanced Assay to Characterize Anti-CRISPR Proteins Using a Cell-Free Transcription-Translation System.” Methods 172 (February): 42–50. [DOI] [PubMed] [Google Scholar]
  21. Yamano Takashi, Nishimasu Hiroshi, Zetsche Bernd, Hirano Hisato, Slaymaker Ian M., Li Yinqing, Fedorova Iana, et al. 2016. “Crystal Structure of Cpf1 in Complex with Guide RNA and Target DNA.” Cell 165 (4): 949–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Zetsche Bernd, Gootenberg Jonathan S., Abudayyeh Omar O., Slaymaker Ian M., Makarova Kira S., Essletzbichler Patrick, Volz Sara E., et al. 2015. “Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System.” Cell 163 (3): 759–71. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES