MiR-31 enhances porcine oocyte maturation via MAPK8/JNK-mediated cumulus expansion and cytoplasmic maturation

Abstract

This study elucidates the molecular mechanism by which porcine ovarian cumulus cell-derived miR-31 regulates oocyte IVM through the MAPK8/JNK signaling pathway, with particular emphasis on its biological roles in cumulus cell expansion and oocyte maturation quality. The experimental design comprised four treatment groups: miR-31 mimics group, mimics negative control (NC) group, miR-31 inhibition group, and inhibition NC group. The results showed: 1) miR-31 overexpression significantly enhanced cumulus cell expansion processes, upregulating PTGS2 (P < 0.05) and PTX3 (P < 0.01) gene expression, while concurrently increasing oocyte maturation rates (P < 0.05). 2) Oocyte quality analysis revealed that miR-31 overexpression induced: elevated mitochondrial membrane potential (P < 0.05); increased ATP production (P < 0.05); reduced lipid droplet size (P < 0.05) with concurrent quantity increased (P < 0.05); improved redox homeostasis (P < 0.05). Conversely, miR-31 inhibition demonstrated opposing effects: elevated cortical granule misdistribution rate (P < 0.05); Significant activation of MAPK8/JNK pathway activity (P < 0.01). In conclusion, this study demonstrates that miR-31 coordinates cumulus cell expansion with oocyte metabolic reprogramming by targeting MAPK8, thereby enhancing nuclear-cytoplasmic maturation synchrony.

This study demonstrates that cumulus cell-derived miR-31 promotes the in vitro maturation of porcine oocytes through targeting MAPK8. These results identify miR-31 as a novel regulatory target for enhancing oocyte quality in porcine reproductive technologies.

Introduction

In the mammalian reproductive system, mature oocytes within ovarian follicles acquire fertilization competence and embryonic developmental potential after ovulation (Telfer et al. 2023; Silber et al. 2024). This maturation process is regulated by multiple factors, with the paracrine interaction between oocytes and cumulus cells playing a pivotal role (Jiang et al. 2023). Cumulus cells provide microenvironmental support through the transport of small-molecule metabolites and signaling molecules to promote oocyte development (O’Brien and Wingfield 2019).

During the transition from primordial to primary follicles, the oocyte cytoplasm begins to accumulate proteins and mRNAs required for oocyte maturation and early embryonic development (Leiet et al. 2024). Cytoplasmic maturation is characterized by the functional reorganization of organelles, such as mitochondria and the endoplasmic reticulum (ER), along with the selective storage of maturation-related mRNAs, protein complexes, and transcription factors (Pham-Bui and Lee 2025). Studies showed that microRNAs (miRNAs) played essential roles in the oocyte maturation–embryonic development axis by regulating key reproductive processes, such as cell proliferation, apoptosis, and steroidogenesis (Yang et al. 2025). In bovine cumulus cells, miR-302d regulates cell cycle progression by targeting cyclin dependent kinase inhibitor 1A (CDKN1A), thereby reducing DNA damage levels and affecting the expression of steroidogenic genes and the hormonal secretion balance (Liu et al. 2023). During follicular atresia, miR-361-5p binds specifically to the 3′ untranslated region (3′UTR) of vascular endothelial growth factor A (VEGFA), suppressing its protein expression and thereby enhancing apoptotic signaling in cumulus cells (Ma et al. 2020). Certain miRNAs may improve fertilization efficiency and embryo quality by maintaining biomolecular homeostasis in oocytes (Takeuchi et al. 2022; Phillip et al. 2025), offering new strategies to enhance the yield of high-quality embryos for in vitro fertilization (IVF).

As a multifunctional regulatory factor, miR-31 participates in the regulation of apoptosis in bovine cumulus cells by targeting the follicle-stimulating hormone receptor (FSHR) gene. Its inhibition significantly increases the expression of 3β-hydroxysteroid dehydrogenase (3β-HSD) and P450scc cholesterol side-chain cleavage, thereby promoting progesterone synthesis and influencing the dynamic balance between follicular development and atresia (Zhang et al. 2019). Nadezda et al. found that knockdown of miR-31 disrupts the patterning and function of primary mesenchyme cells (Stepicheva et al. 2015). Studies have demonstrated that miR-149 and miR-31 promote porcine cumulus cell expansion and reduce oocyte apoptosis by upregulating the expression of SMAD Family Member 2 (SMAD2) and SMAD Family Member 4 (SMAD4) (Wu et al. 2024). Similarly, transfection of mouse cumulus–oocyte complexes (COCs) with a miR-31-5p inhibitor suppressed cumulus expansion by downregulating the expression of hyaluronan synthase 2 (HAS2) and pentraxin 3 (PTX3) (Han et al. 2022). MiR-31 serves as both a potential biomarker for oocyte maturation and a mechanistic probe for investigating oocyte-cumulus communication. In this study, we systematically investigated the role of miR-31 in porcine oocyte in vitro maturation (IVM) by overexpressing and inhibiting miR-31 in cumulus cells, focusing on its effects on cumulus cell function and cytoplasmic maturation. These findings aim to provide a theoretical basis for optimizing in vitro embryo production systems.

Materials and methods

Ethical statement

All animal experiments were approved by the Experimental Animal Ethics Committee of Yanbian University, China, with the approval number syxk2020-0009.

In vitro maturation of oocytes

Porcine oocyte IVM and IVF procedures were performed according to established protocols (Luo et al. 2022). Ovaries collected from Yanji Guangming Slaughterhouse were processed in compliance with ARRIVE guidelines (Kilkenny et al. 2012). Follicular fluid from 3–6 mm follicles was aspirated using a 10 mL syringe. COCs with ≥ 3 cumulus cell layers were selected under microscopy and cultured in IVM I medium (TCM199 supplemented with 10% follicular fluid, 10% FBS, 10 IU/mL HCG, 10 IU/mL PMSG, 0.06 mg/mL L-cys, 7.5 mg/mL penicillin, and 5 mg/mL streptomycin) at 37 °C under 5% CO₂ for 22 h. Subsequently, COCs were transferred to IVM II medium (TCM199 with 10% FF, 10% FBS, and antibiotics) for additional 22 h maturation.

miRNA transfection in GV-stage COCs

The miRNA mimics, inhibitors, and their negative controls (Table 1) were synthesized by Ribobio Co., Ltd, Guangzhou, Guangdong, China. COCs were transfected with mimic NC, miR-31 mimics, inhibitor NC, or miR-31 inhibitor using Lipofectamine™ 3000 (Thermo Fisher Scientific, L3000150, Waltham, MA, USA). The miRNA mimics and inhibitors were transfected at final concentrations of 100 nM. Stock solutions (100 µM) were prepared by dissolving the oligonucleotides in DEPC-treated water. For transfection, each culture well received 0.75 µL Lipofectamine™ 3000, 25 µL Opti-MEM^® Reduced Serum Medium (Thermo Fisher Scientific, 31985070), 10 µL miRNA-lipid complex, and 90 µL culture medium, along with 25–30 COCs. After 44 h culture, cumulus cells and oocytes were collected for analysis.

Table 1.

Sequences of miRNA mimic and inhibitor used in this study.

Genes	Primer sequences/（5'→3'）	Modification
ssc-miR- 31 mimics	AGGCAAGAUGCUGGCAUAGCUG	FAM
mimics negative control	UUCUCCGAACGUGUCACGUTT	FAM
ssc-miR-31 inhibitor	CAGCUAUGCCAGCAUCUUGCCU	FAM
inhibitors negative control	CAGUACUUUUGUGUAGUACAA	FAM

miRNA isolation and qRT-PCR

Total miRNA was extracted from cumulus cells isolated from 90 COCs. Total miRNA was extracted using the miRNeasy Micro Kit (Qiagen, 217004, Düsseldorf, Germany). Reverse transcription employed the MiRcute Plus Kit (TIANGEN, KR211, Beijing, China) under thermal conditions: 42 °C/60 min → 95 °C/3 min. The RNA concentrations and quality were assessed using a NanoDrop One spectrophotometer (Thermo Scientific) and the Qubit RNA HS Assay Kit (Thermo Fisher Scientific) on a Qubit 2.0 Fluorometer (Thermo Fisher Scientific), with an OD value between 1.8 and 2.0. qPCR was performed using the MiRcute Plus SYBR Green Kit (TIANGEN, FP411) with RNU6B normalization (Peltier and Latham 2008). The sample volume used during quantitative PCR was 2 µL. Primer sequences are listed in Table 2. The reaction program consisted of an initial denaturation at 95 °C for 15 min, followed by 45 cycles of denaturation at 94 °C for 20 s, and annealing at 60 °C for 34 s. Data were analyzed using the 2^-△△CT method.

Table 2.

Sequences of miRNA primers used in qRT-PCR analysis.

miRNA	Primer sequences/（5'→3'）
ssc-miR-31	F: GGCAGGCAAGATGCTGGCATAGCTG
RNU6B	F: CGCGCAAGGATGACACGCAAATTCG

RNA analysis and gene expression

We conducted total RNA isolation using CCs released from 50 COCs. Total RNA was extracted from oocytes and cumulus cells using the Total RNA Extraction Kit (Thermo Fisher Scientific, 61011). Reverse transcription was performed using the FastKing One-Step cDNA Synthesis Pre-Mix Kit (TIANGEN, KR118), with the reaction conditions set at 42 °C for 15 min and 95 °C for 3 min. The cDNA sequences of PTX3, HAS2, PGRS2, CDK1, CyclinB1, GDF9, BMP15, BCL2, BAX, CASPASE3, SOD1, GPX4, MAPK8, RIPK1, ACSL4, and GAPDH were retrieved from NCBI, and primers were designed using Primer5.0, as shown in Table 3. The reactions were performed according to the FastStart Universal SYBR Green Master (ROX) Kit (Roche, 4913914001, Basel, Switzerland). Each 20 μL qRT–PCR system included 1 μL of cDNA, 7 μL of deionized water, 10 μL of FastStart Universal SYBR Green Realtime PCR Master Mix, and 1 μL of each forward and reverse primer. The reaction program was as follows: 95 °C for 10 min, followed by 40 cycles of 95 °C for 5 s, 60 °C for 30 s, and 72 °C for 15 s. The amplification and melting curves were analyzed using the PCR instrument software to determine the specificity and efficiency of amplification products. Data were analyzed using the 2^-△△CT method.

Table 3.

Primer sequences for target gene amplification.

Genes	Primer sequences（5'→3'）	Product size (bp)
GAPDH	F：GATTCCACCCACGGCAAGTTCC	129
	R：AGCACCAGCATCACCCCATTTG
HAS2	F：CACACCATGCTTGACCCT	135
	R：CACACTGCTGAGGAAGGAG
PTGS2	F：GGGCATGAGGTCTTTGG	102
	R：CGGGTGCTCCTGTTTAAG
PTX3	F：TTTGTGCTCTCTGGTCTGC	185
	R：CCGCATCTGGGAGTTCT
SOD1	F：AAGGCCGTGTGTGTGCTGAA	279
	R：AGTGGCCACACCATCTTTGC
GPX4	F：ATTCTCAGCCAAGGACATCG	250
	R：TTTGACGTTGTAGCCAGCAG
CyclinB1	F：CACTGCCATGTTTATTGCC	188
	R：TCTTGGATGCTCTCCGAA
CDK1	F：CTATCCCTCCTGGTCAGTTC	85
	R：GAGTGACAAAACACAATCCCT
BMP15	F：GCCCTTGGTGCTTGTTT	157
	R：GCCAGACCCCTGGATAG
GDF9	F：CACTGCCATGTTTATTGCC	188
	R：TCTTGGATGCTCTCCGAA
BAX	F：CCCTTTTGCTTCAGGGTTTCAT	239
	R：GCCGTCAGCAAACATTTCGG
BCL2	F：CGTCCCAGCTCCACATCACC	124
	R：AGTGCCCCACCGAAGGAGAA
CASPASE3	F：GGATTGAGACGGACAGTG	109
	R：CGCCAGGAATAGTAACCAG
MAPK8	F：TCAGGAGCTCAAGGAATAGTATG	88
	R：TCTGAAATGGCCGGCTTAAC
RIPK1	F：CACTCGGAGAAATCAAGGCAG	86
	R：CTGCGCCCTGATGGTTACAAAA
ACSL4	F：ACTCTGTTCAAGATAGGGTATG	189
	R：GCAGCAGAAGCAGACATTC

Cumulus expansion assessment

Cumulus cell spreading was observed after 44 h of IVM culture, and COCs were imaged under a microscope. Assessment of the cumulus cell expansion was performed as described previously (Lopes et al. 2019). Measurements were performed using ImageJ software, and a mean of three measurements of each oocyte (longest, shortest, and a medium distance between the zona pellucida and the extreme of the cumulus cells) was calculated. Results represent the percentage increase in cumulus cell expansion after 44 h of IVM. Three replicates were measured with a total of 476 oocytes examined.

Cortical granule staining of oocytes

Metaphase II (MII) oocytes were washed three times with PBS and then fixed in 4% paraformaldehyde at room temperature for 1 h. After washing three times with PBS-0.1% polyvinyl alcohol (PVA), the oocytes were permeabilized in 0.5% Triton X-100 for 30 min. The oocytes were washed three times and then blocked with 5% bovine serum albumin (BSA) for 1 h. Finally, after washing three times, the oocytes were incubated with 100 µg/mL peanut agglutinin conjugated with fluorescein isothiocyanate (PNA-FITC) at room temperature in the dark for 30 min for staining. Afterward, the oocytes were washed and observed under a fluorescence microscope for imaging. The excitation wavelengths used for PNA-FITC were 465-495 nm, and the emission wavelengths used for PNA-FITC were 512–558 nm.

Measurement of mitochondrial membrane potential in oocyte

MII oocytes were washed three times with PBS-0.1% PVA, and each group of oocytes was then placed in a mixture of 100 µL IVM medium and 100 µL JC-1 working solution (Beyotime, C2006, Shanghai, China). The oocytes were incubated in the dark at 37 °C in a 5% CO₂ incubator for 30 min, followed by two washes with 100 µL of pre-prepared JC-1 staining buffer. The oocytes were then transferred to a second wash well containing 100 µL IVM medium and observed under a fluorescence microscope in the dark for imaging. Each group consisted of 20–30 oocytes, and the experiment was repeated three times. The excitation wavelengths used for JC-1 were 520–565 nm and emission wavelengths used for JC-1 were 570–590 nm.

Mitochondrial staining of oocytes

MII oocytes were washed three times with PBS-0.1% PVA and then incubated in 200 nM Mito-Tracker Red (Beyotime, C1071S) working solution for 30 min in the incubator. The oocytes were observed under a fluorescence microscope and imaged. Each group consisted of 20–30 oocytes, and the experiment was repeated three times. The excitation wavelengths used for Mito-Tracker Red were 540–599 nm and emission wavelengths used for Mito-Tracker Red were 600–660 nm.

ROS and GSH staining of oocytes

MII oocytes were washed three times with PBS-0.1% PVA and then incubated in 1 µM DCFH-DA and 1 µM CMF2HC staining solutions (HY-D0940, MCE, Monmouth Junction, NJ, USA) for 30 min in the dark at 37 °C in a 5% CO₂ incubator. The oocytes were observed under a fluorescence microscope. Each group consisted of 20–30 oocytes, and the experiment was repeated three times. The excitation wavelengths used for DCFH-DA were 492 nm and emission wavelengths used for DCFH-DA were 517 nm.

Lipid droplet and ATP staining of oocytes

BODIPY 493/503 (Thermo Fisher Scientific, D3922) is a neutral lipid dye that has been recently used to detect lipid droplets in oocytes. It has been shown to bind with adipose differentiation-related protein in mice and cattle. MII oocytes were washed three times with PBS-0.1% PVA and then fixed in 4% paraformaldehyde at room temperature for 1 h. After three washes with PBS, the oocytes were incubated in 10 µg/mL BODIPY 493/503 and 500 nM BODIPY FL ATP staining solutions at room temperature in the dark for 30 min. Following three washes, the oocytes were observed under a microscope. Each group consisted of 20–30 oocytes, and the experiment was repeated three times.

Endoplasmic reticulum staining of oocytes

ER Tracker Red 587⁄615 (Thermo Fisher Scientific, E34250) is a red dye that specifically binds to the ER within cells. After live staining of oocytes, it reveals the distribution of the ER in the oocyte cytoplasm. MII oocytes were washed three times with PBS-0.1% PVA and then incubated in 1 µM ER Tracker Red staining solution in the dark at 37 °C in a 5% CO₂ incubator for 30 min. The oocytes were observed under a fluorescence microscope. Each group consisted of 20–30 oocytes, and the experiment was repeated three times.

MiR-31 target genes analysis

The software programs miRanda (https://anaconda.org/bioconda/miranda), TargetScan (http://www.targetscan.org/mamm_31/) and RNAhybride (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid) were used to predict the targets of miRNAs. Only genes that were predicted positive by two or three software programs were selected as the target genes.

Dual luciferase reporter assay

The 3ʹUTR sequence of MAPK8, including the seed sequence (Figure S1—see online supplementary material for a color version of this figure), was amplified by qRT-PCR. The recombinant dual-luciferase psiCHECK-2 vector (wild type, WT) was constructed after the amplified fragment was digested and connected to the downstream of the Renilla luciferase translation termination codon, and the control recombinant psiCHECK-2 vector (mutant, MUT) with a mutated seed sequence was also constructed by the same method. After the 293 T cell were grown to 90% confluence, plasmids (blank plasmids, WT, and MUT) and miRNA (mimics and the corresponding NCs) were transfected into them. After 48 h, the activities of renilla luciferase and firefly luciferase were detected with a luciferase detection kit. The luciferase ratio in the empty plasmid transfection group was set to 1, and the relative value of the luciferase ratio in other groups was calculated.

Western blot analysis

Total proteins from 50 COCs were lysed in 40 µL RIPA buffer. The protein concentration was determined using a BCA kit (Beyotime, P0012). Proteins (20 μg/lane) were detached by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis for 1 h at 120 V, then transferred to a 0.22 µM polyvinylidene difluoride membrane for 1.5 h. After transfer, the membranes were blocked with 5% BSA for 1 h. Next, the membranes were incubated with primary antibodies against JNK (1:3000, Proteintech, 66210-1-Ig, Wuhan, China), p-JNK (1:1000, Proteintech, 80024-1-RR), and MAPK8 (1:1000, Affinity Biosciences, AF6318, Cincinnati, OH, USA) overnight at 4 °C, followed by HRP-labeled Goat Anti-Rabbit IgG secondary antibody (1:1000, Beyotime, A0208). The protein bands were detected with the ECL kit (Beyotime, P0018M) in a chemiluminescence imaging system and qualified by Image J. Each treatment was repeated 3 times.

In vitro fertilization

In vitro, maturation of pig oocytes and IVF were conducted following the lab’s established protocols (Cheng et al. 2024). COCs were transfected with miRNA at the germinal vesicle (GV) stage and then further cultured for 44 h to the MII stage. MII oocytes were rinsed three times with modified Tris-buffered medium (mTBM) (113.1 mM NaCl, 3.0 mM KCl, 20.0 mM Tris, 7.5 mM CaCl2, 5.0 mM glucose, and 0.5 mM sodium pyruvate). Then, 10–15 oocytes were transferred into 50 µL droplets of IVF medium (mTBM supplemented with 0.4% BSA and 2 mM caffeine) under mineral oil pre-equilibrated at 38.5 °C in 5% CO₂ in air. Semen samples were washed three times with a solution comprising 50 mL PBS, 7.5 µg streptomycin, and 1% polyvinyl alcohol. Subsequently, the semen and mature oocytes were transferred to an IVF medium and incubated in an incubator containing 5% CO₂ at 38.5 °C. After 6–8 h, the oocytes were removed from outside the zona pellucida and transferred to the in vitro embryo medium (0.4% BSA, 0.1 mM 2-ME, 0.5 mM sodium pyruvate, and 10 mM sodium lactate in NCSU-37 basal medium), followed by incubation at 38.5 °C under 5% CO₂ at maximum saturated humidity, the cleavage rate was determined.

Statistical analysis

Data from three biological replicates were analyzed by IBM SPSS Statistics (version 23.0). One-way analysis of variance was used for comparisons among three or more groups, followed by Tukey’s test. Student’s t-test was used to compare the scores between two groups. The first polar body extrusion rate and the cleavage rate of oocytes were compared between the two groups using the Chi-square test. Statistical analysis was performed using SPSS software (version 22.0, Armonk, NY, USA). The graphs were made with GraphPad Prism software (V 8.4.0, GraphPad Software LLC; San Diego, CA, USA). The fluorescence intensity of each sample was measured using the same scanning settings. Fluorescence intensity and western blot band intensity were measured in Image J (NIH, Bethesda, MD, USA). Significance thresholds: ^*P < 0.05; ^**P < 0.01.

Results

Expression of miR-31 in porcine COCs

The expression levels of miR-31 in cumulus cells and oocytes within COCs were analyzed using qRT-PCR during the GV and MII stages. As shown in Figure 1, miR-31 expression was significantly downregulated in both MII-stage oocytes and cumulus cells compared to GV-stage oocytes (P < 0.05).

Figure 1.

Expression of miR-31 in cumulus cells and oocytes before and after maturation in COCs. ^*Significant difference (P < 0.05); ^**Highly significant difference (P < 0.01).

Transfection efficiency of miR-31 in COCs

To investigate the functional role of miR-31 in porcine COCs, FAM-labeled miR-31 mimics and inhibitors were transfected into COCs (Figure 2A). The fluorescence signal confirmed successful transfection of miR-31 into cumulus cells. Compared to the control group, transfections with miR-31 mimics significantly increased miR-31 expression in cumulus cells and oocytes (P < 0.05), while transfection with miR-31 inhibitors markedly reduced its expression (P < 0.05) (Figure 2B and C).

Figure 2.

miR-31 expression in cumulus cells and oocytes post-transfection. (A) Merged bright-field and fluorescence micrographs of transfected COCs. (B) miR-31 expression levels in cumulus cells. (C) miR-31 expression levels in oocytes. Scale bar = 500 µm. ^*P < 0.05; ^**P < 0.01.

Effects of miR-31 on cumulus cell expansion

Cumulus cell expansion was significantly enhanced in the miR-31 mimic group compared to controls (P < 0.05), whereas the inhibitor group exhibited reduced expansion (Figure 3A and B). Analysis of expansion-related genes revealed that PTGS2 and PTX3 expression levels were significantly upregulated in the mimic group (P < 0.05), while HAS2 remained unchanged. Conversely, all three genes (HAS2, PTGS2, and PTX3) were downregulated in the inhibitor group (P < 0.05). Additionally, the mimic group showed increased BCL2 (anti-apoptotic) and decreased BAX (pro-apoptotic) expression (P < 0.05), whereas the inhibitor group exhibited the opposite trend, along with elevated Caspase3 levels (P < 0.05) (Figure 3E and F). These results suggest that miR-31 overexpression enhances cumulus cell expansion and anti-apoptotic activity.

Figure 3.

Impact of miR-31 on cumulus cell expansion in COCs. (A) Cumulus cell expansion post-transfection. Scale bar = 500 µm. (B) Percentage of cumulus cell expansion after 44 hours of IVM. (C, D) Expression of cumulus cell expansion markers after miR-31 transfection. (E, F) Effect of miR-31 on anti-apoptotic gene expression in cumulus cells. ns: Not significant; ^*P < 0.05; ^**P < 0.01.

Role of miR-31 in oocyte nuclear maturation

The nuclear maturation rate was significantly higher in the miR-31 mimic group than in the mimic NC group (P < 0.05) and significantly lower in the miR-31 inhibitor group than in the inhibitor NC group (P < 0.05) (Figure 4A). Furthermore, the expression of nuclear maturation markers (GDF9, BMP15, CDK1, and CyclinB1) was significantly upregulated in the mimic group (P < 0.05) and downregulated in the inhibitor group (P < 0.05) (Figure 4B–D). These findings indicate that overexpression of miR-31 promotes oocyte nuclear maturation.

Figure 4.

Role of miR-31 in oocyte maturation. (A) Oocyte maturation rate post-transfection. Values are presented as percentage (number matured/total). P value was calculated by Chi-square test. (B, C) Expression of developmental competence-related genes in oocytes. ^*P < 0.05.

Effects of miR-31 on oocyte cytoplasmic maturation

Cortical granule distribution

The percentage of oocytes with abnormal cortical granule distribution was significantly lower in the miR-31 mimic group (P < 0.05) and higher in the inhibitor group (P < 0.05) (Figure 5A and B), indicating improved cytoplasmic maturation upon miR-31 overexpression.

Figure 5.

miR-31 regulates oocyte cortical granule distribution, endoplasmic reticulum (ER) levels, and lipid droplet dynamics. (A) Cortical granule fluorescence patterns. Scale bar = 50 µm. (B) Percentage of oocytes with abnormal cortical granule distribution. Scale bar = 100 µm. (C, D) ER fluorescence intensity. (E–G) Lipid droplet quantification and size analysis. Scale bar = 50 µm. ns: Not significant; ^*P < 0.05; ^**P < 0.01.

Endoplasmic reticulum function

Staining with ER-Tracker Red indicated that the miR-31 mimics group had no significant change in fluorescence intensity (P > 0.05), whereas the miR-31 inhibitor group exhibited a significant increase compared to the inhibitor NC group (P < 0.01) (Figure 5C and D).

Lipid droplet dynamics

The mimic group exhibited increased lipid droplet numbers and reduced droplet size (P < 0.05), while the inhibitor group showed fewer lipid droplets with larger sizes (P < 0.05) (Figure 5E and G).

ATP levels

ATP content was significantly higher in the mimic group (P < 0.05) and lower in the inhibitor group (P < 0.05) (Figure 6A and B).

Figure 6.

miR-31 modulates oocyte ATP content, mitochondrial distribution, and membrane potential. (A, B) ATP fluorescence intensity. Scale bar = 50 µm. (C, D) Mitochondrial fluorescence patterns. Scale bar = 100 µm. (E, F) Mitochondrial membrane potential . Scale bar = 100 µm. ^*P < 0.05.

Mitochondrial function

Mitochondrial fluorescence intensity and membrane potential were significantly elevated in the mimic group (P < 0.05) but reduced in the inhibitor group (P < 0.05) (Figure 6C–F).

miR-31 modulates oxidative stress in oocytes

The miR-31 mimic group showed significantly lower reactive oxygen species (ROS) levels (P < 0.05) and higher glutathione (GSH) levels (P < 0.05), along with upregulated expression of antioxidant genes (SOD1 and GPX4) (P < 0.01). Conversely, the inhibitor group exhibited reduced GSH levels and downregulated antioxidant gene expression (P < 0.05) (Figure 7A–F).

Figure 7.

miR-31 influences oxidative stress markers in mature oocytes. (A, B) Reactive oxygen species (ROS) fluorescence levels. Scale bar = 100 µm. (C, D) Glutathione (GSH) fluorescence intensity. e, f) miR-31 mimics and inhibitor effects. Scale bar = 100 µm. ns: Not significant; ^*P < 0.05; ^**P < 0.01.

Evolutionary conservation of miR-31

Sequence alignment using miRBase revealed high conservation of mature miR-31 across mammals, including pigs, humans, mice, cattle, and chickens. Notably, the seed sequence (positions 2–8) was identical among these species (Table 4).

Table 4.

Cross-species alignment of miR-31 sequences.

Species	miRNA	sequences/（5'→3'）
ssc	miR-31	AGGCAAGAUGCUGGCAUAGCUG
hsa	miR-31-5p	AGGCAAGAUGCUGGCAUAGCU
mmu	miR-31-5p	AGGCAAGAUGCUGGCAUAGCUG
bta	miR-31	AGGCAAGAUGCUGGCAUAGCU
eca	miR-31	AGGCAAGAUGCUGGCAUAGCU
ocu	miR-31	AGGCAAGAUGCUGGCAUAGCUGU
cfa	miR-31	AGGCAAGAUGCUGGCAUAGCUGU
gga	miR-31	AGGCAAGAUGUUGGCAUAGCUG

Note: Comparison of miR-31 sequences among different species (the yellow region represents the seed sequence).

Identification and validation of miR-31 target genes

Bioinformatic predictions and experimental validation identified MAPK8, RIPK1, and ACSL4 as potential targets of miR-31. The mimic group showed significantly reduced MAPK8 and RIPK1 mRNA levels (P < 0.05), while the inhibitor group exhibited upregulated expression of all three genes (P < 0.05 for MAPK8 and RIPK1; P < 0.01 for ACSL4) (Figure 8D and E). To further confirm the targeting relationship between miR-31 and MAPK8, a dual luciferase reporter assay was performed by transfecting constructed plasmids into 293 T cells. The transfection with miR-31 mimics significantly reduced the luciferase activity of the WT recombinant plasmid (P < 0.05), while no inhibitory effect was observed on either the mutant or the no-load plasmids (Figure 8F). These results demonstrate that miR-31 can directly target the 3ʹUTR of the porcine MAPK8 gene and plays a regulatory role in its expression.

Figure 8.

Target gene prediction and validation for miR-31. (A–C) Predicted binding sites between miR-31 and MAPK8, RIPK1, and ACSL4. (D, E) Validation of target gene expression in cumulus cells. (F) Detection of double luciferase reporter gene. ns: Not significant; ^*P < 0.05; ^**P < 0.01.

miR-31 regulates MAPK/JNK signaling

Western blot analysis demonstrated that miR-31 mimics reduced MAPK8 protein levels and phosphorylated JNK (P-JNK)/JNK ratios (P < 0.05), whereas inhibitors increased these levels (P < 0.05) (Figure 9A–D), suggesting that overexpression of miR-31 suppresses the MAPK/JNK pathway.

Figure 9.

miR-31 regulates MAPK8 and JNK signaling in cumulus cells. (A, B) MAPK8 protein expression. (C, D) Phosphorylated JNK (P-JNK) to total JNK ratio. ^*P < 0.05.

Effect of miR-31 on cleavage rate of porcine oocytes

Compared to the control group, the cleavage rate was significantly reduced in the inhibitor group (P < 0.05) but significantly enhanced in the mimics group (P < 0.05), demonstrating that miR-31 overexpression promotes oocyte cleavage efficiency (Figure 10).

Figure 10.

Effect of miR-31 on cleavage rate of oocytes. (A) mimics NC. (B) miR-31 mimics. (C) inhibitor NC. (D) miR-31 inhibitor. (E) Statistical chart. Scale bar = 200 µm. ^*P < 0.05.

Discussion

As a multifunctional regulatory molecule, miR-31 has been demonstrated to participate in critical biological processes, including reproductive regulation, embryonic development, and bone metabolism (Stepicheva and Song 2016; Sampilo et al. 2021; Remsburg et al. 2024). However, its specific mechanism in porcine oocyte maturation remains elusive. Previous studies reported differential expression of miR-31 between atretic and healthy follicles in cattle, with upregulation observed in healthy follicles, suggesting that miR-31 may be involved in germ cell quality control by regulating the follicular selection threshold (Yao et al. 2022). We examined the expression of miR-31 in GV and MII stage oocytes and found that miR-31 expression was significantly lower in both cumulus cells and oocytes at the MII stage compared to the GV stage, indicating its differential regulatory mechanism during oocyte maturation.

Cumulus cells play a pivotal role in oocyte maturation by facilitating intercellular communication, protecting oocytes from oxidative stress, and modulating apoptotic signaling (Richani et al. 2021; Coxir et al. 2023). At the molecular level, they maintain oocyte developmental competence through PTGS2-mediated pathways and regulate cumulus expansion via extracellular matrix components, such as PTX3 and HAS2, both of which are essential for hyaluronic acid synthesis and female fertility (Machado et al. 2015). Dysregulation of apoptosis-related genes, including Caspase3, BCL2, and BAX, has been associated with impaired oocyte quality, particularly in atretic follicles (Song et al. 2025). In this study, overexpression of miR-31 significantly increased the expansion area of cumulus cells, with concomitant upregulation of key expansion markers PTGS2 and PTX3. Additionally, miR-31 overexpression promoted cumulus cell homeostasis by increasing the expression of the anti-apoptotic gene BCL2 and suppressing the pro-apoptotic gene BAX. These results collectively reveal a novel regulatory mechanism by which miR-31 facilitates nuclear and cytoplasmic maturation of porcine oocytes during IVM.

Oocytes have been shown to prevent apoptosis of surrounding granulosa and cumulus cells by maintaining the expression of bone morphogenetic protein 15 (BMP15) (Delgado et al. 2021). In human granulosa cells, the expression levels of growth differentiation factor 9 (GDF9) and BMP15 have been positively correlated with oocyte maturation, fertilization potential, and embryo quality (Cadenas et al. 2022; Huang et al. 2023). Additionally, the oocyte maturation process is tightly regulated by maturation-promoting factor (MPF), which consists of cyclin-dependent kinase 1 (CDK1) and cyclin B1 (CyclinB1) (Kim et al. 2023; Xia et al. 2025); together, these components orchestrate the progression of both mitotic and meiotic cell cycles through complex regulatory networks (Kim et al. 2023). In the present study, overexpression of miR-31 significantly increased the first polar body extrusion rate of oocytes and up-regulated the expression levels of GDF9, BMP15, CDK1, and CyclinB1 in oocytes. These findings suggest that miR-31 may promote porcine oocyte maturation during IVM by modulating key molecular pathways associated with developmental competence and meiotic regulation.

Regarding cytoplasmic maturation, overexpression of miR-31 demonstrated multidimensional regulatory advantages: 1) Significantly improving mitochondrial membrane potential, ATP synthesis, and mitochondrial biomass to optimize energy metabolism; 2) Precisely regulating lipid droplet quantity and size distribution to prevent lipotoxicity; 3) Enhancing cortical granule positioning to establish fertilization competence. Particularly, overexpression of miR-31 constructed an antioxidant defense system by enhancing GSH synthesis, upregulating SOD1 and GPX4 activities, thereby significantly reducing intracellular ROS levels.

Acyl-CoA Synthetase Long-Chain Family Member 4 (ACSL4) is an important isoenzyme in polyunsaturated fatty acid metabolism that determines ferroptosis sensitivity, accelerating the generation of lipid peroxides and promoting ferroptosis (Zhou et al. 2023). Receptor-interacting serine/threonine protein kinase 1 (RIPK1) mediates cell death and inflammation (Xu et al. 2018). In bovine atretic follicles, the expression level of RIPK1 is significantly higher compared to healthy follicles (McEvoy et al. 2021). Mitogen-activated protein kinase 8 (MAPK8) is an apoptosis-related gene. The upregulation of MAPK8 is associated with oocyte dysfunction and is involved in various signaling pathways in granulosa cells (Xu et al. 2021). MAPK8 is an important signaling molecule in the JNK signaling pathway. Its functions involve mechanisms such as cell proliferation, cell differentiation, and apoptosis. Zheng et al. discovered that miR-31 regulates JNK signaling pathway overactivation by targeting and suppressing cell division cycle protein 42 (Cdc42), forming a JNK/miR-31/Cdc42 negative feedback mechanism (Zheng et al. 2021). The findings of this study demonstrate that overexpression of miR-31 inhibits cumulus cell apoptosis by negatively regulating the expression of ACSL4, MAPK8, and RIPK1. And compared with the control group, overexpression of miR-31 increased the cleavage rate of oocytes, while inhibition of miR-31 decreased the oocyte cleavage rate. These results provide new insights into the potential mechanisms by which miR-31 regulates oocyte developmental competence during IVM.

Conclusion

This study demonstrates that miR-31 indirectly promotes porcine oocyte maturation by regulating cumulus cells and directly targets MAPK8 to suppress the MAPK8/JNK signaling pathway, thereby improving the quality of oocytes matured in vitro.

Glossary

Abbreviations

NC

negative control

miRNAs

microRNAs

CDKN1A

cyclin dependent kinase inhibitor 1A

3′UTR

3′ untranslated region

VEGFA

vascular endothelial growth factor A

IVF

in vitro fertilization

FSHR

follicle-stimulating hormone receptor

3β-HSD

3β-hydroxysteroid dehydrogenase

COCs

cumulus–oocyte complexes

IVM

in vitro maturation

ER

endoplasmic reticulum

WT

wild type

MUT

mutant

mTBM

modified Tris-buffered medium

GV

germinal vesicle

MII

metaphase II

GSH

glutathione

BMP15

morphogenetic protein 15

GDF9,

growth differentiation factor 9

MPF

maturation-promoting factor

CDK1

cyclin-dependent kinase 1

CyclinB1

cyclin B1

ROS

oxygen species

ACSL4

Acyl-CoA synthetase long-chain family member 4

MAPK8

mitogen-activated protein kinase 8

RIPK1

receptor-interacting serine/threonine protein kinase 1

JNK

C-Jun N-terminal kinase

P-JNK

phosphorylated JNK

Cdc42

cell division cycle protein 42

CDK1

cyclin-dependent kinase 1

HSA2

hyaluronan synthase 2

PTX3

pentraxin 3

SMAD2

SMAD Family Member 2

SMAD4

SMAD family member 4

BMP15

bone morphogenetic protein 15

MAPK8

mitogen-activated protein kinase 8

PVA

polyvinyl alcohol

BSA

bovine serum albumin

PNA-FITC

peanut agglutinin conjugated with fluorescein isothiocyanate

Acknowledgments

The authors express their deepest gratitude to Dr. Yi Jin. This study was supported by the National Natural Science Foundation of China (NSFC) [32360834] and Natural Science Foundation of Jilin Province (YDZJ202501ZYTS496).

Author contributions

Yuyang Zhang (Data curation, Formal analysis, Methodology, Validation, Writing—original draft, Writing—review & editing), Weiyu Gu (Data curation, Formal analysis, Investigation, Methodology, Software, Validation, Writing—review & editing), Zhiwei Yao (Validation, Visualization, Writing—review & editing), Jie Wang (Resources, Validation), Xuan Chen (Conceptualization, Funding acquisition, Project administration, Resources, Supervision), and Yi Jin (Conceptualization, Funding acquisition, Project administration, Resources, Supervision)

Supplementary data

Supplementary data is available at Journal of Animal Science online.

Conflict of interest statement. The authors declare that have no competing interests.

Data availability

The data underlying this article will be shared on reasonable request to the corresponding author.