6-Shogaol from Banxia Xiexin Tang: A Potent Regulator of Th17/Treg Balance to Protect Against CPT-11-Induced Intestinal Mucosal Damage

Abstract

Irinotecan (CPT-11)-induced intestinal mucosal injury is a common complication of chemotherapy, significantly affecting gastrointestinal health. This study aimed to explore the potential therapeutic effects of 6-shogaol, a key component of Banxia Xiexin Tang (BXXXT), on regulating the T helper 17 cells (Th17)/regulatory T cells (Treg) balance to alleviate CPT-11-induced intestinal mucosal injury in rats. Rats were treated with CPT-11 to induce intestinal mucosal injury and subsequently exposed to 6-shogaol or BXXXT. Body weight, disease activity index (DAI), and histopathological changes in the small intestine were assessed. Biomarkers of intestinal injury, including D-lactic acid, diamine oxidase (DAO) and endotoxin, were measured. Enzyme-linked immunosorbent assay and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) were performed to evaluate inflammatory cytokine levels in serum and small intestine tissues. Through flow cytometry, RT-qPCR and Western blot, the Th17/Treg balance was examined. Both 6-shogaol and BXXXT significantly alleviated CPT-11-induced intestinal mucosal injury, as demonstrated by increased body weight, reduced DAI, and improved histopathological results. Both treatments decreased the levels of intestinal damage-related biomarkers (D-lactic acid, DAO, and endotoxin) and suppressed the inflammatory response. Furthermore, 6-shogaol treatment restored the Th17/Treg balance by decreasing the proportion of Th17 cells and increasing the number of Treg cells. Collectively, 6-shogaol, a major component of Banxia Xiexin Tang, effectively regulates the Th17/Treg balance and attenuates CPT-11-induced intestinal mucosal injury in rats, signifying that 6-shogaol holds therapeutic potential for preventing and curing chemotherapy-induced gastrointestinal damage.

Introduction

Irinotecan (CPT-11), a semisynthetic derivative of camptothecin and a topoisomerase I inhibitor [1], exerts its potent antitumor effect by interfering with the DNA replication process. CPT-11 is often used as a monotherapy or in combination with additional chemotherapy drugs as part of the standard treatment regimen for several cancers, like colorectal cancer [2], gastric cancer [3], and small cell lung cancer [4]. However, gastrointestinal mucositis (GIM) is one of the most significant and debilitating side effects of CPT-11 [5]. It is primarily characterized by diarrhea, intestinal barrier dysfunction, and gut microbiota imbalance, which, in severe cases, can lead to secondary infections, electrolyte disturbances, and even life-threatening complications [6]. CPT-11-induced GIM not only affects patients’ quality of life, but also leads to dose-limiting toxicity, necessitating treatment interruption or dose reduction, thereby undermining its antitumor efficacy [7]. Therefore, enhancing chemotherapy tolerance and optimizing cancer treatment regimens require a thorough investigation of the mechanisms underlying CPT-11-induced intestinal mucosal damage as well as the discovery of efficacious preventative and therapeutic measures.

Banxia Xiexin Tang (BXXXT) is a classical traditional Chinese medicine formula, first recorded in the Treatise on Cold Damage Disorders, and is primarily used to treat diseases related to disorders of the middle jiao, characterized by a mixture of cold and heat and gastrointestinal dysfunction [8]. Its ingredients include 15 g of Pinellia ternata, 15 g of Licorice, 15 g of Scutellariae Radix, 15 g of Panax Ginseng C. A. Mey., 15 g of Zingiberis Rhizoma (Ginger), 5 g of Coptidis Rhizoma, and 4 Jujubae Fructus. A previous study has shown that BXXXT can effectively improve CPT-11-triggered intestinal mucosal damage in rats [9], where 6-shogaol, a bioactive compound from Zingiberis Rhizoma (Ginger)., has been established using the Herb database as a key player in this process. 6-Shogaol is a phenolic compound that exhibits protective properties against a number of inflammatory conditions [10, 11]. Moreover, it inhibits the proliferation and migration of fibroblast-like synoviocytes in rheumatoid arthritis through the phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT)/nuclear factor-kappa B (NF-κB) pathway[12]. 6-Shogaol derived from dried ginger prevents intestinal ischemia/reperfusion injury by modulating the brain-derived neurotrophic factor (BDNF)/tropomyosin receptor kinase B (TrkB)/PI3K/AKT pathway [13]. 6-Shogaol also alleviates ulcerative colitis via significant anti-inflammatory property [14, 15], and promotes Treg cell polarization [16]. In this study, using an animal model, we systematically evaluated the therapeutic effects of 6-shogaol, a key component of BXXXT, on CPT-11-induced intestinal mucosal damage, and explored its mechanisms in regulating T helper 17 cells (Th17)/regulatory T cells (Treg) immune balance. Our results not only provide a theoretical foundation for applying BXXXT to manage chemotherapy-induced gastrointestinal toxicity, but also elucidate potential molecular mechanisms, offering new insights into the treatment of intestinal injury.

Materials and Methods

Animal Ethics

Forty Wistar rats (approximately 210 g, 6 weeks old, male) were acquired from Beijing Vital River Laboratory Animal Technology Co., Ltd.,(China). The Ethics Committee of Zhejiang Baiyue Biotechnology Co., Ltd. (No. ZJBYLA-IACUC-20231115) authorized all animal research, which was carried out in compliance with the rules for the care and use of laboratory animals. The rats were kept under controlled settings (temperature: 22 ± 2°C, humidity: 55 ± 10%, 12-h light/dark cycle), and had unrestricted access to water and normal laboratory diet. To reduce the stress-related physiological alterations, the animals were acclimated for a week prior to assays.

Drug Preparation

The prescription of BXXXT includes 15 g of Pinellia ternata, 15 g of Licorice, 15 g of Scutellariae Radix, 15 g of Panax Ginseng C. A. Mey., 15 g of Zingiberis Rhizoma (Ginger), 5 g of Coptidis Rhizoma, and 4 Jujubae Fructus, which were bought from our institution's pharmacy. A total of 30 prescriptions were precisely weighed, and decocted in an eightfold volume of water for 1.5 h. The decoction was filtered and then concentrated further in a water bath. The obtained thick extract was vacuum-dried into dry extract. The final BXXXT dosage was calculated as 15 g/kg by multiplying the normal dose by seven and using the adult oral dose as a guide. A final concentration of 3 g/ml (for BXXXT) was achieved by concentrating the herbal extract.

Experimental Design

Forty rats were randomly assigned into Control, Model, 6-shogaol, Model+6-shogaol, and Model+BXXXT groups (n = 8 per group). Rats in the Model group received 10 ml/kg normal saline (ST341-500 ml, Beyotime, China) by gavage twice a day for 9 days, and intravenous injections of CPT-11 (100 mg/kg; S1198, Selleck, USA) on days 4 and 5 [17]. The Control group adopted gavage of 10 ml/kg normal saline for 9 days. The 6-shogaol group utilized treatment of 2 mg/kg 6-shogaol (HY-14616, MCE, USA) [18] for 9 days (twice a day), and injection of normal saline (volume comparable to CPT-11) on days 4 and 5. Rats in the Model+6-shogaol group and Model+BXXXT group were treated with 2 mg/kg 6-shogaol and 10 ml/kg BXXXT, respectively, by gavage twice a day for 9 days, followed by CPT-11 injections (100 mg/kg/day) on days 4 and 5. Following the final CPT-11 injection (designated as Day 0), rats were monitored for six more days. Body weight was recorded daily at a fixed time. At the experimental endpoint, blood was drawn from the orbital sinus of rats that had been sedated with sodium pentobarbital (80 mg/kg, P3761, Sigma-Aldrich, USA). The rats were then sacrificed via cervical dislocation. Lymph nodes from the mesenteric and small intestine were removed and kept at -80°C. 10% formaldehyde (50-00-0, Nanjing Reagents, China) was used to fix a portion of the small intestinal tissue.

Disease Activity Index (DAI)

DAI was assessed via a common scoring methodology [19], which included three parameters, body weight, stool consistency, and fecal occult blood. Body weight loss was scored as follows: 0 (no weight loss), 1 (1-5% weight loss), 2 (5-10% weight loss), 3 (10-20% weight loss), and 4 (>20% weight loss). Stool consistency was scored on a scale of 0 to 4, where 0 = well-formed pellets, 2 = pasty or semi-formed stools that did not adhere to the anus, and 4 = liquid stools that adhered to the anus. Fecal occult blood was scored 0 (no blood), 2 (occult blood present), and 4 (severe bleeding). The individual ratings, which ranged from 0 (healthy) to 4 (severe colitis), were added up and divided by 3 to determine the final score.

Hematoxylin and Eosin (HE) Staining

After being preserved in 4% paraformaldehyde (P0099, Beyotime), small intestinal tissues were embedded in paraffin (8002-74-2, Nanjing Reagents, China) and sectioned into 5 μm-thick slices. The slices were hydrated and stained with hematoxylin and eosin (C0105S, Beyotime) following deparaffinization with xylene (A530011-0500, Bioengineering, China). Photographs were taken with a microscope (400×, Leica, Germany).

Cellular Apoptosis

The Cell Apoptosis Detection Kit (11684817910, Roche, Germany) was adopted to gauge cell apoptosis in intestinal tissues. Paraffin-embedded sections of small intestinal tissues were soaked in xylene for 5 min twice and then washed with a gradient ethanol solution (64-17-5, Nanjing Reagents). After that, the sections were treated with proteinase K working solution (20 μg/mL) (ST533, Biotime, China) for 20 min, and with 450 μl of fluorescent-labeled deoxyuridine triphosphate (dUTP) solution and 50 μl of terminal deoxynucleotidyl transferase (TdT) for 1 h (darkness). 2-(4-amino-phenyl)-6-indole carbonamido dichloride (DAPI, C1002, Biotime) was then employed to counterstain the sections for 10 min. Fluorescence (400×, Nikon, Japan) was utilized to observe apoptotic cells (green-positive).

Intestinal Injury Biomarker Analysis

Serum was prepared by centrifuging blood samples. The levels of endotoxin (SP12712), diamine oxidase (DAO) (SP12787), and d-lactate (SP13321) were measured by enzyme-linked immunosorbent assay (ELISA) kits (Spbio, China). The microplate reader (Bio-Rad, USA) was applied to gauge absorbance at 450 nm.

Inflammatory Cytokine Levels

Blood samples were centrifuged to obtain serum. Intestinal tissues were rinsed with ice-cold phosphate-buffered saline (PBS, PH1822, Phygene, China), minced on ice, and thoroughly homogenized. To obtain the supernatant, the homogenate was centrifuged. The concentrations of interleukin (IL)-6 (SP12279), IL-17 (SP12224), tumor necrosis factor-alpha (TNF-α) (SP12250), IL-10 (SP12294), transforming growth factor-beta (TGF-β) (SP13497), and IL-22 (D731248, Sangon, China) in serum and intestinal tissues were quantified using ELISA kits (Spbio, China). A microplate reader was employed to detect absorbance at 450 nm.

Flow Cytometry

Rat mesenteric lymph node tissues were rinsed with ice-cold PBS, then finely minced and homogenized on ice [20]. The tissue suspension was filtered through a 70 μm cell strainer (84702ES50, Yeasen, China) to obtain a single-cell suspension. After being washed with cold PBS, cells were resuspended in complete culture medium. Subsequently, to enable the detection of intracellular IL-17, the cells were stimulated for 4 h with 50 ng/ml phorbol 12-myristate 13-acetate and 1 μg/ml ionomycin, with the addition of 10 μg/ml brefeldin A to retain cytokines intracellularly. Following stimulation, the cells were washed with cold PBS and cell concentration was adjusted to 1 × 10⁷ cells/ml. Later, the cells were treated for 30 min with fluorescein isothiocyanate (FITC)-conjugated cluster of differentiation (CD)4 antibody (F3100401, LiankeBio, China) and allophycocyanin (APC)-conjugated CD25 antibody (F3102503, LiankeBio). Then, the cells were fixed using fixation buffer (C1713, Beyotime, China) and permeabilized for 30 min with fixation/permeabilization working solution (HY-000544, Ys-Bio, China). After washing with permeabilization buffer, the cells were incubated with phycoerythrin-Cyanine 5.5 (PE-Cy5.5)-conjugated anti-IL-17 (560666, Pufei, China) and phycoerythrin (PE)-conjugated anti-forkhead box P3 (Foxp3) (F31FP302, LiankeBio, China) antibodies for 30 min. Finally, flow cytometry (Agilent Technology, USA) was employed to determine the proportions of CD4⁺IL-17⁺ cells and CD4⁺CD25⁺Foxp3⁺ cells. The gating strategy was applied as follows: lymphocytes were first gated based on forward scatter (FSC-A) and side scatter (SSC-A) properties. From this gate, CD4⁺ T cells were selected using FITC anti-CD4. For Th17 analysis, CD4⁺IL-17⁺ cells were identified within the CD4⁺ population. For Treg analysis, CD4⁺CD25⁺ cells were first selected, and Foxp3 expression was subsequently assessed to define CD4⁺CD25⁺Foxp3⁺ Tregs.

Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR)

Total RNA was extracted from the tissues of rat mesenteric lymph nodes using TRIzol reagent (R0016, Beyotime, China), and reverse-transcribed into complementary DNA (cDNA) with the RT-qPCR kit (RR047A, Takara, Japan). On an ABI PRISM 7300 RT-PCR machine (Applied Biosystems, USA), RT-qPCR was carried out via SYBR Green PCR Premix (4344463, Thermo Fisher, USA). The internal control was glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and the 2^−ΔΔCT technique was applied to determine the relative expression levels of the target genes. Table 1 shows the primer sequences (Tsingke, China).

Table 1.

Primers used for RT-qPCR in this study.

Genes	Forward primer (5’-3’)	Reverse primer (5’-3’)
IL-6	ACAAAGCCAGAGTCCTTCAGAGAG	TTGGATGGTCTTGGTCCTTAGCCA
IL-17	GGTCAACCTCAAAGTCTTTAACTC	TTAAAAATGCAAGTAAGTTTGCTG
TNF-α	TCAGCCTCTTCTCATTCCTGC	TTGGTGGTTTGCTACGACGTG
IL-10	GAGAACCAAGACCCAGACATCAAG	CATTCTTCACCTGCTCCACGG
TGF-β	ATACGCCTGAGTGGCTGTCT	TCTCTGTGGAGCTGAAGCAA
IL-22	GCTTGACAAGTCCAACTTCCA	GCTCACTCATACTGACTCCGT
ROR-γt	CTGCCTGTTTTCTGGGACCTA	CTTGGGACCTTATCTCCACCC
FOXP3	TCAGGAGCCCTCCAGTACA	GCTGACTTCCAAGTCTCGTG
GAPDH	CTTTGGTATCGTGGAAGGACTC	GTAGAGGCAGGGATGATGTTCT

Western Blot

Tissues of the rat mesenteric lymph nodes were lysed using Enhanced radioimmunoprecipitation assay (RIPA) lysis buffer (20101ES60, Yeasen), and centrifuged to collect the supernatant. The bicinchoninic acid protein assay kit (P0009, Beyotime) was applied to evaluate protein concentrations. Proteins (60 μg) were separated by with 10% SDS-PAGE (P0690, Beyotime) and then put onto a polyvinylidene fluoride (PVDF) membrane (FFP24, Beyotime). The membrane was blocked by 5% bovine serum albumin (B4219, MeilunBio, China) for 1 h at room temperature, and cultivated overnight (4°C) with primary antibodies, retinoic acid receptor-related orphan receptor gamma t (ROR-γt) (ab289552, 58 kDa), FOXP3 (ab215206, 47 kDa), and GAPDH (ab8245, 36 kDa) (1:1000 dilution). Next, the membrane was incubated with secondary antibodies, horseradish peroxidase-conjugated goat anti-rabbit (1:10,000, ab205718) and goat anti-mouse (1:10,000, ab205719) secondary antibodies for 1 h. Membranes were developed with enhanced chemiluminescence (A10017, Abmart, China). ImageJ software (USA) was applied to examine band intensity. Primary antibodies were sourced from Abcam (UK).

Statistical Analysis

Software called GraphPad Prism 8.0 (GraphPad, USA) was implemented to do statistical analysis. Data were presented as the mean ± standard deviation in all figures. One-way analysis of variance (ANOVA) for comparison among multiple groups and two-way repeated measures ANOVA for comparison between groups at different time points, followed by Tukey's post hoc test. Statistical significance was defined as P-value of less than 0.05.

Results

On days 4-6 following treatment, the Model group showed a substantial decrease in weight relative to the Control group (p < 0.01, Fig. 1A). Body weight was significantly higher in the 6-shogaol group (days 3-6), the Model+BXXXT group (days 5-6), and the Model+6-shogaol group (day 5) after treatment, compared to the Model group (p < 0.05, Fig. 1A). However, on days 4-6 following treatment, the Model+6-shogaol group weighted less than the 6-shogaol group alone (p < 0.05, Fig. 1A). As expected, the Model group exhibited a markedly higher DAI score than all other groups: the Control group (p < 0.001, Fig. 1B), the 6-shogaol group, Model+6-shogaol group, and Model+BXXXT group (p < 0.001, Fig. 1B). Besides, the DAI score was greater in the Model+6-shogaol group than in the 6-shogaol group (p < 0.001, Fig. 1B). In the Control group, HE staining results presented smooth villus structures with intact epithelial cells (Fig. 1C). The intestinal glands were perforated, capillaries were congested, and epithelial cells from the villus structures were heavily shed in the Model group (Fig. 1C). The 6-shogaol group presented a smooth epithelial cells similar to the Control group (Fig. 1C). In the Model+6-shogaol and Model+BXXXT groups, the intestinal glands recovered and the villus epithelial cells were partially regenerated (Fig. 1C). Apparent apoptosis was detected in the Model group compared to the Control group (p < 0.001, Fig. 1D and 1E). In contrast to the Model group, the 6-shogaol, Model+6-shogaol and Model+BXXXT groups exhibited lower apoptosis indices (p < 0.05, Fig. 1D and 1E). Compared to the 6-shogaol group, the Model+6-shogaol group had a greater apoptosis index (p < 0.001, Fig. 1D and 1E).

Fig. 1. Regulation of Irinotecan (CPT-11)-induced intestinal mucosal injury by 6-shogaol and Banxia Xiexin Tang (BXXXT).

(A) Body weight records of rats in the Control, Model, 6-shogaol, Model+6-shogaol, and Model+BXXXT groups. (B) Disease activity index (DAI) of rats in the Control, Model, 6- shogaol, Model+6-shogaol, and Model+BXXXT groups. (C) Hematoxylin and eosin (HE) staining of small intestinal tissues in the Control, Model, 6-shogaol, Model+6-shogaol, and Model+BXXXT groups. Magnification, 400×; scale bar, 100 μm. (D-E) Detection of apoptosis in small intestinal tissues of rats in the Control, Model, 6-shogaol, Model+6-shogaol, and Model+BXXXT groups. Magnification, 400×; scale bar, 20 μm. Each group consisted of 8 rats. **p < 0.01, ^***p < 0.001 vs. Control; ⁺p < 0.05, ⁺⁺p < 0.01, ⁺⁺⁺p < 0.001 vs. Model; ^{^}p < 0.05, ^{^^}p < 0.01, ^{^^^}p < 0.001 vs. 6-shogaol.

Levels of D-lactic acid, DAO, and endotoxins were significantly elevated in the Model group relative to all other groups: the Control group (p < 0.001, Fig. 2A-2C), the 6-shogaol group (p < 0.001, Fig. 2A-2C), the Model+6-shogaol group (p < 0.05, Fig. 2A-2C), and the Model+BXXXT group (p < 0.01, Fig. 2A-2C). D-lactic acid, DAO, and endotoxin levels were greater in the Model+6-shogaol group than in the 6-shogaol group (p < 0.01, Fig. 2A-2C). According to RT-qPCR data, the Model group had greater levels of IL-6, IL-17, TNF-α, and IL-22 and lower levels of IL-10 and TGF-β, when compared to the Control group (p < 0.001, Fig. 2D-2I), 6-shogaol group, Model+6-shogaol group, and Model+BXXXT group (p < 0.001, Fig. 2D-I2). In comparison to the 6-shogaol group, the Model+6-shogaol group had diminished levels of TGF-β and IL-10, and elevated levels of IL-6, IL-17, TNF-α, and IL-22 (p < 0.05, Fig. 2D-2I). ELISA data confirmed that the Model group had significantly elevated pro-inflammatory (IL-6, IL-17, TNF-α, IL-22) and reduced anti-inflammatory (IL-10, TGF-β) cytokine levels in small intestine tissue and serum relative to the Control group (p < 0.001, Fig. 3A-3L). Compared to the Model group, in small intestine tissue, the 6-shogaol and Model+BXXXT groups had upregulated IL-10 and TGF-β and downregulated IL-6, IL-17, TNF-α, and IL-22 (p < 0.001, Fig. 3A-3F). In small intestine tissue, the Model+6-shogaol group had higher TGF-β level and lower IL-6, IL-17, TNF-α, and IL-22 levels than the Model group (p < 0.001, Fig. 3A-3C and 3E and 3F). Serum IL-6, IL-17, TNF-α, and IL-22 levels were diminished, whereas IL-10 and TGF-β levels were raised in the 6-shogaol, Model+6-shogaol, and Model+BXXXT groups in contrast with the Model group (p < 0.05, Fig. 3G-3L). Furthermore, in both small intestine tissue and serum, the Model+6-shogaol group showed lower levels of IL-10 and TGF-β and greater levels of IL-6, IL-17, TNF-α, and IL-22 than the 6-shogaol group (P < 0.05, Fig. 3A-3L).

Fig. 2. Regulation of intestinal damage biomarkers and inflammatory cytokines by 6-shogaol and BXXXT.

(A-C) Quantification of serum D-lactic acid, diamine oxidase (DAO), and endotoxin in rats from the Control, Model, 6-shogaol, Model+6-shogaol, and Model+BXXXT groups by enzyme-linked immunosorbent assay (ELISA) kits. (D-I) Detection of interleukin (IL)-6, IL-17, tumor necrosis factor-alpha (TNF-α), IL-10, transforming growth factor-beta (TGF-β), and IL-22 levels in small intestine tissues of rats from the Control, Model, 6-shogaol, Model+6-shogaol, and Model+BXXXT groups by reverse transcription quantitative polymerase chain reaction (RT-qPCR). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control. Each group consisted of 8 rats. ^***p < 0.001 vs. Control; ⁺p < 0.05, ⁺⁺p < 0.01, ⁺⁺⁺p < 0.001 vs. Model; ^{^}p < 0.05, ^{^^}p < 0.01, ^{^^^}p < 0.001 vs. 6-shogaol.

Fig. 3. Regulation of inflammatory cytokines by 6-shogaol and BXXXT.

(A-F) Measurement of IL-6, IL-17, TNF-α, IL-10, TGF-β, and IL-22 levels in small intestine tissues of rats from the Control, Model, 6-shogaol, Model+6-shogaol, and Model+BXXXT groups by ELISA kits. (G-L) Measurement of IL-6, IL-17, TNF-α, IL-10, TGF-β, and IL-22 in serum of rats from the Control, Model, 6-shogaol, Model+6-shogaol, and Model+BXXXT groups by ELISA kits. GAPDH was used as an internal control. Each group consisted of 8 rats. ^***p < 0.001 vs. Control; ⁺p < 0.05, ⁺⁺p < 0.01, ⁺⁺⁺p < 0.001 vs. Model; ^{^}p < 0.05,^{^^^}p < 0.001 vs. 6-shogaol.

After modeling, a substantial rise in CD4⁺IL-17⁺ T cells and a drop in CD4⁺CD25⁺Foxp3⁺ T cells were detected in mesenteric lymph node tissues (p < 0.001, Fig. 4A-4D), which were all reversed by 6-shogaol intervention (p < 0.001, Fig. 4A-4D). Furthermore, the modeling resulted in upregulation of ROR-γt and downregulation of FOXP3 (p < 0.01, Fig. 4E-4I), but these trends were counteracted by 6-shogaol treatment (p < 0.001, Fig. 4E-4I).

Fig. 4. Regulation of Th17/Treg balance by 6-shogaol.

(A-D) Flow cytometric analysis of cluster of differentiation (CD4)⁺IL-17⁺ T cells and CD4⁺CD25⁺forkhead box P3 (FOXP3)⁺ T cells in mesenteric lymph node tissues of rats from the Control, Model, and Model+6-shogaol groups. (E-F) Determination of retinoic acid receptor-related orphan receptor gamma t (ROR-γt) and FOXP3 expression levels in mesenteric lymph node tissues of rats from the Control, Model, and Model+6-shogaol groups by RT-qPCR. GAPDH was used as an internal control. (G-I) Western blotting analysis of ROR-γt and FOXP3 expression levels in mesenteric lymph node tissues of rats from the Control, Model, and Model+6-shogaol groups. GAPDH was used as an internal control. Each group consisted of 8 rats. **p < 0.01, ^***p < 0.001 vs. Control; ⁺⁺⁺p < 0.001 vs. Model.

Discussion

In this study, we found that 6-shogaol significantly abrogated CPT-11-induced increase in the DAI, intestinal tissue damage, and upregulation of serum D-lactic acid, DAO, and endotoxin. D-lactic acid is a product of gut bacterial metabolism, and its increased levels in the blood typically indicate impaired intestinal barrier function, promoting the translocation of bacteria and their metabolites into the bloodstream [21]. Damage to the intestinal barrier boosts the production of DAO, an enzyme released by intestinal epithelial cells and intimately linked to the integrity of the intestinal mucosa [22]. Endotoxin, primarily produced by Gram-negative bacteria, is a key mediator of systemic inflammation, and its upregulation in the blood leads to increased intestinal permeability and exacerbated inflammatory responses [23]. Herein, the results suggested that 6-shogaol may exert its protective effects by improving intestinal barrier function and reducing the release of biomarkers associated with intestinal barrier damage. This further implied that 6-shogaol could be a potential candidate for mitigating chemotherapy-induced gastrointestinal mucosal damage, and provided experimental evidence for its clinical application exploration.

Enhanced inflammation is often accompanied by exacerbated intestinal tissue damage. Persistent inflammation not only disrupts intestinal barrier function but also leads to epithelial cell apoptosis, gut microbiota imbalance, and immune dysregulation [24]. In this study, we observed that 6-shogaol treatment significantly reduced IL-6, IL-17, TNF-α, and IL-22 levels, while increasing the expressions of IL-10 and TGF-β. Pro-inflammatory cytokines, including IL-6, IL-17, TNF-α, and IL-22, play pivotal roles in driving intestinal inflammation [25]. IL-6 and TNF-α are classic inflammatory mediators that promote the cascade release of inflammatory cytokines, thus exacerbating tissue damage [26]. IL-17 and IL-22, primarily secreted by Th17 cells, induce intestinal epithelial cells to produce chemokines and antimicrobial peptides [27]. However, excessive activation of these cytokines can aggravate intestinal inflammation and barrier destruction. In contrast, IL-10 and TGF-β are key anti-inflammatory factors that suppress excessive immune responses [28]. Additionally, TGF-β supports Treg cell differentiation and immunological homeostasis [29]. Our results indicated that 6-shogaol therapy considerably raised the number of Treg cells while decreasing the fraction of Th17 cells. Mechanistically, abnormal proliferation of Th17 cells leads to the continuous release of pro-inflammatory cytokines such as IL-17 and IL-22, whereas Treg cells exert immunosuppressive effects via IL-10 and TGF-β to maintain immune tolerance [30]. Disruption of the Th17/Treg balance is one of the important mechanisms underpinning inflammatory bowel diseases and chemotherapy-induced intestinal damage [31]. Collectively, these findings suggest that 6-shogaol alleviates CPT-11-induced intestinal tissue damage by modulating the Th17/Treg balance, reducing the release of pro-inflammatory cytokines, and enhancing anti-inflammatory responses. This mechanistic insights provide a novel theoretical basis and potential therapeutic direction for the prevention and treatment of chemotherapy-related intestinal damage.

This study has several limitations. First, the doses and treatment duration of 6-shogaol and BXXXT used in the study may differ from clinically applicable protocols. Since different doses and treatment time windows may influence the therapeutic effect, future work should systematically optimize these parameters. Additionally, the lack of quantification of 6-shogaol content in the BXXXT extract via HPLC limits the precise pharmacokinetic correlation between the pure compound and the herbal formula, which represents an important methodological constraint. Second, although this study explored the effects of 6-shogaol and BXXXT on the Th17/Treg balance, other relevant immune pathways and molecular mechanisms were not comprehensively examined. Future research should further investigate the effects of these treatments on other immune cell populations and signaling pathways.

In conclusion, this study demonstrates that BXXXT and its main ingredient, 6-shogaol, can alleviate CPT-11-induced intestinal mucosal injury and inflammatory responses. Specifically, 6-shogaol mitigates intestinal inflammation and damage via modulating the Th17/Treg balance, inhibiting the overactivation of Th17 cells, and promoting the enhancement of Treg cells. These results underscore the therapeutic potential of 6-shogaol in preventing and managing CPT-11-induced intestinal mucosal injury.