A Cohort Study of 38 Classic Wiskott-Aldrich Syndrome Cases with Six Novel Mutations

Abstract

Purpose

Wiskott-Aldrich syndrome (WAS) is an X-linked immunodeficiency characterized by eczema, microthrombocytopenia, and recurrent infections. This study evaluates the frequency of clinical manifestations and overall outcomes in WAS patients, comparing those who received hematopoietic stem cell transplantation (HSCT) with those who did not.

Methods

Thirty-eight boys with a definite diagnosis of WAS were retrospectively evaluated in the Immunology, Asthma, and Allergy Research Institute registry in Tehran from 2006 to 2023.

Results

The median ages at symptom onset, diagnosis, and delay to diagnosis were 3.5, 7.5, and 4.5 months, respectively. The clinical presentations include allergies in 38 (100%), infection in 37 (97.4%), hemorrhage in 36 (94.7%), autoimmunity in 14 (36.8%), and malignancies or myelodysplasia syndrome in 3 (7.9%) patients. Although microthrombocytopenia is a hallmark of WAS, 34.4% of our cases had normal platelet size. The WAS gene analysis in 36 of 38 patients identified six novel mutations. Sixteen patients underwent HSCT. Disease-free survival was reported in 10 (62.5%) of them, whereas 6 (37.5%) of them were deceased. The mortality rate in non-transplant patients was 15/22 (68.2%).

Conclusion

Most WAS patients experienced atopy, recurrent infections, and bleeding. Moreover, autoimmunity and malignancies have increased relative to the general population. Moreover, the mortality rate is high, especially among those who did not receive HSCT. Keeping in mind that thrombocytopenia alongside eczema and/or infection in a male infant can be the presentation of this fatal disease. Early diagnosis and treatment could be lifesaving and prevent severe morbidities.

Introduction

Wiskott-Aldrich syndrome (WAS) is a rare X-linked inborn error of immunity with an incidence of 1 in 100,000 live births [1, 2]. However, its prevalence may be higher in countries where consanguineous marriage is high, such as Iran [3, 4]. Classic WAS presents with a triad of eczema, microthrombocytopenia, and infection. It is caused by the hemizygous mutation in the WAS gene on the short arm of the X chromosome(Xp11.22–23), which encodes the WAS protein (WASp) [5]. WASp regulates actin dynamics and cytoskeletal organization in non-erythroid immune cells, enabling key functions such as adhesion, migration, phagocytosis, and immune synapse formation [6–9]. Defective WASp disrupts T, B, and NK cell function, leading to combined cellular, humoral, and innate immune deficiency [10, 11].

The pathogenesis of thrombocytopenia and platelet dysfunction is only incompletely understood. Despite a normal or increased number of megakaryocytes in the bone marrow, patients develop thrombocytopenia due to both ineffective thrombopoiesis and accelerated peripheral destruction of platelets. WASp has an important role in platelet formation, activation, and cytoskeletal remodeling; defects in WASp lead to dysfunctional platelets, resulting in reduced platelet survival. Moreover, antiplatelet antibodies contribute to platelet destruction, especially in severe cases of thrombocytopenia [12–14].

Eczematous rash is a prominent clinical feature of the disease and affects more than 80% of the patients at some point in their lives. The incidence of eczema is higher in patients with a complete absence of WASp [12, 14]. Allergic rhinitis, asthma, and food allergies are also observed in WAS patients. Defective Treg function leads to skewing immunity to Th2 responses, thus leading to IgE-mediated sensitization [14].

To date, more than 540 different WAS mutations have been recognized [15]. Loss-of-function WAS mutations lead to a wide range of diseases, from X-linked thrombocytopenia (XLT) to classic WAS. Gain-of-function mutations commonly lead to the distinct phenotype of X-linked neutropenia (XLN) [13]. The first HSCT for WAS was performed in 1968 [16], and by 1978, HSCT had been reported as a viable therapeutic option [17]. Given that WASp is expressed exclusively in hematopoietic cells, gene therapy targeting hematopoietic stem cells offers an alternative for patients lacking donors [18–20]. Patients with classic WAS can be cured by allogeneic stem cell transplantation and autologous gene-modified HSCT therapy.

This study aimed to investigate the clinical, immunological, and genetic characteristics of WAS cases who were referred to the Immunology, Asthma, and Allergy Research Institute (IARRI) referral center between 2006 and 2023, including the treatments administered and their long-term outcomes.

Materials and Methods

We retrospectively studied 38 boys with WAS followed them at the Immunology, Asthma and Allergy Research Institute (IAARI) from 2006 to 2023. The IAARI Ethics Committee approved the study (No: IR.TUMS.IAARI.REC.1400.014), and informed consent was obtained from all patients or their parents.

“Definitive WAS” was defined as congenital microthrombocytopenia in addition to at least one of the following criteria: (1) WAS gene mutation; (2) absent WASp expression in lymphocytes; (3) absent WASp mRNA on northern blot analysis of lymphocytes; or (4) a family history of microthrombocytopenia in maternal relatives (cousins, uncles, or nephews).

“Probable WAS” was defined as congenital microthrombocytopenia along with at least one of the following: (1) eczema; (2) abnormal antibody response to polysaccharide antigens; (3) recurrent infections; (4) lymphoma, leukemia, or brain tumor; (5) autoimmune diseases [21].

Clinical severity was evaluated using the WAS score described by Zhu et al. [22] This system assigns a score from 1 to 5, based on 5 parameters: thrombocytopenia, severity of eczema, severity of infections, development of malignancies, and development of autoimmunity. Scores of 1 or 2 indicate XLT, a milder phenotype, characterized by thrombocytopenia with mild or absent eczema, and few or mild recurrent infections. Scores of 3 or 4 typically represent the classic WAS presentation, including the triad of thrombocytopenia, significant eczema, and recurrent infections. A score of 5 is assigned if the patient develops malignancy or autoimmunity. This scoring system helps predict which patients would benefit most from early HSCT [10, 22].

Thrombocytopenia classification was based on platelet counts: severe refractory (< 10 × 10⁹/L after transfusion), profound (10–20 × 10⁹/L), moderate (20–50 × 10⁹/L), and mild (> 50 × 10⁹/L) [7, 8, 23, 24]. The diagnosis of immune thrombocytopenia (ITP) is difficult in WAS patients, given the baseline thrombocytopenia inherent to the disease and the poor correlation with antiplatelet antibody testing. Therefore, we operationally defined suspected ITP based on the presence of severe refractory thrombocytopenia (SRT). Following the approach described by Mahlouli et al., patients were classified as having SRT if they exhibited persistent platelet counts below 10 × 10⁹/L, even 1 h following platelet transfusion [8]. Mean platelet volume (MPV) was systematically measured, with values of 7.5–11 fL considered normal, < 7.5 fL microplatelet, and > 11 fL macroplatelet [10]. Serum immunoglobulin (Ig) G, IgM, and IgA levels were measured via nephelometry and compared to age-specific reference values, while IgE was assessed by enzyme immunoassay.

Demographic, clinical, immunological, and genetic profiles were collected for all cases. DNA analysis of the WAS gene was carried out in 36 cases to confirm the diagnosis.

To analyze WAS gene mutations, genomic DNA was extracted from peripheral blood samples of patients and their parents using the BehPrep Genomic DNA Extraction Kit (Behgene, Iran) following the manufacturer’s instructions. Polymerase chain reaction (PCR) was performed to amplify all 12 exons and their flanking splice site regions of the WAS gene using 10 pairs of specific primers (Table 1).

Table 1.

WAS primer sequences and PCR product sizes

Region	Forward/Reverse	Primer Sequence	Product Size
Exon 1	F	GGTCTAAGCAGTCAAGTGG	497
	R	GGAAGGGTGGATTATGACG
Exon 2	F	CGTCATAATCCACCCTTCC	399
	R	CTTGAAGCTATGGACACATAT
Exons 3 and 4	F	TGAAAATCTCCAAACCAGAC	497
	R	CATGAGAGGGGACTTTTCTAG
Exon 5	F	AAGTTGGGCAGAGGTGAGTG	199
	R	AGAGAGTTATCACAGCCCTG
Exon 6	F	GGCTGTGATAACTCTCTACA	128
	R	CCATCCATCCAGAGACACAG
Exon 7	F	ACACACAGATTTCCCTCAAG	341
	R	CAGCTGTCCACTTGTTCATG
Exons 8 and 9	F	CAAGAGGTTTCACTATGAAGG	534
	R	GCGTATCTTAGCTATGAGCTGC
Exon 10	F	GCTTCAGTCAGGAGTTGGTC	580
	R	TCCTGACTTAGACGGGACAC
Exon 11	F	GAGAAATGCTCCTTTCCCAG	216
	R	TAGCCCTGGGAGCCAGGTTT
Exon 12	F	CTCCCAGGGCATCTTATCTT	118
	R	AGCACAGGGCAGCAAGTAAC

PCR amplification was carried out under the following conditions: an initial denaturation at 95 °C for 2 min; followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at a primer-pair specific temperature (54–60 °C) for 30 s, and extension at 72 °C for 30 s; with a final extension step at 72 °C for 2 min. The sequencing of PCR products was performed by ABI PRISM 3730 genetic analyzer (Applied Biosystems, USA). To identify probable new variants, the NCBI BLAST program was used to align the resulting sequences with the WAS gene.

The majority of donors were HLA-identical siblings and full-match donors. The reduced-intensity conditioning (RIC) regimen consisted of fludarabine (30 mg/m²/day for 5 days), rabbit antithymocyte globulin (10 mg/kg/day), and melphalan (70 mg/m²/day). Graft versus host disease (GVHD) prophylaxis included cyclosporine A, initiated at 1.5 mg/kg/day and subsequently increased to 3 mg/kg/day, along with methylprednisolone administered at 1 mg/kg/day and then reduced to 0.5 mg/kg/day [25].Treatment outcomes were categorized as either complete or partial responses, based on the extent of symptom resolution, defined as complete or partial correction of clinical manifestations, similar to Alain Fischer’s study [8].

Statistical Analysis

Data were analyzed using SPSS software version 22 (IBM Corp., Armonk, NY, USA). Quantitative variables were summarized as median (IQR) and (min, max). The chi-square test was applied to evaluate associations between two categorical variables. Kaplan-Meier curves were generated to estimate overall survival, and the log-rank test was utilized to compare survival distributions between patients with and without HSCT. A p value < 0.05 was considered statistically significant.

Results

Clinical Features

Thirty-eight boys with definitive WAS were evaluated with a median age of 7.29 years (min = 11 months, max = 27.7 years) during the last 17 years (2006–2023). Six patients (four with no mutation detected, two not done) fulfilled the criteria for a definitive WAS diagnosis based on congenital microthrombocytopenia, associated clinical manifestations, and a family history of microthrombocytopenia in maternal relatives (cousins, uncles, or nephews).

The median (IQR) age at symptom onset was 3.5 months (1–6) and at diagnosis 7.5 months (4.62–20), with a median diagnostic delay of 4.5 months (1.25–16). The median (min-max) follow-up duration from diagnosis was 39.5 months (4.01–200.87) in non-transplant patients and 82.48 months (26.65–188.35) in transplant patients.

Parent consanguinity was present in 21 patients (55.3%). The family history of WAS and PID was positive in 20 (54.1%) and 22 patients (59.5%), respectively. Among these families, the median (IQR) number of affected individuals per family was 1.5 (1–3).

The frequency of alive and deceased patients was 17 (44.7%) and 21 (55.3%), respectively. The median (min-max) age at death for deceased patients was 3.18 (11 m-14.01) years, while the median age of surviving patients at the time of analysis was 10.53 (3.65–27.74) years. Moreover, the median (min-max) follow-up duration for deceased cases was 27.7 months (4.01–155.76).

Patients’ Manifestations

Bleeding Manifestations

Bleeding manifestations were reported in 36 patients (94.7%). The most frequent signs were petechiae (n = 26, 68.4%), gastrointestinal bleeding (n=22, 57.9%), and epistaxis (n=9, 23.7%). Other manifestations are shown in Table 2.

Table 2.

The clinical manifestations of patients with Wiskott-Aldrich syndrome

Manifestations	N (%)
Infections	37 (97.4)
Sinusitis Otitis media Mastoiditis Thrush Gingivitis Pneumonia Diarrhea Meningitis Septic arthritis Skin abscess Cellulitis Wart BCG lymphadenitis Sepsis	3 (7.9) 9 (23.7) 1 (2.6) 3 (7.9) 4 (10.5) 23 (60.5) 13 (34.2) 2 (5.3) 1 (2.6) 4 (10.5) 3 (7.9) 2 (5.3) 5 (13.2) 15 (39.5)
Hemorrhage	36 (94.7)
Petechiae/purpura Epistaxis GI CNS Lung Retina Urinary system	26 (68.4) 9 (23.7) 22 (57.9) 1 (2.6) 1 (2.6) 3 (7.9) 3 (7.9)
Atopy	38 (100)
Eczema Food allergies Anaphylaxis Asthma	35 (92.1) 7 (18.4) 1 (2.6) 1 (2.6)
Autoimmunity	14 (36.8)
Henoch-Schönlein purpura Autoimmune hemolytic anemia Nephrotic syndrome Inflammatory bowel disease Autoimmune pancytopenia Severe refractory thrombocytopenia	1 (2.6) 4 (10.5) 1 (2.6) 2 (5.3) 1 (2.6) 4 (10.5)
Malignancy	3 (7.9)
FTT	5 (13.2)

BCG Bacillus Calmette-Guérin, CNS central nervous system, FTT failure to thrive, GI gastrointestinal

Atopy

Atopic manifestations were reported in 38 (100%) patients, with eczema being the most common type, seen in 35 (92.1%) patients. Other atopic manifestations are shown in Table 2.

Infection

Infection manifestations were reported in 37 (97.4%) patients. Skin infections were the most common infection, reported in 30 (78.9%). Skin infection manifestations included impetigo, cellulitis, and abscess, which were often associated with innate immunity impairment.

Autoimmunity

Autoimmunity manifestations were reported in 14 (36.8%) patients (Table 2). No significant correlation was observed between elevated IgM levels and the presence of autoimmunity. Only a patient with high IgM presented an autoimmune condition. Moreover, 50% patients with autoimmune manifestations died.

Malignancy

A total of 3 patients (7.9%) developed malignancy or myelodysplastic syndrome (MDS). One patient with a history of autoimmune pancytopenia progressed to MDS, another with IBD developed lymphoma, and a third, previously classified with SRT, developed leukemia. All 3 patients achieved complete remission following treatment for their malignancy or MDS. Two of these 3 patients also underwent successful HSCT.

Laboratory Investigations

Thrombocytopenia

All patients had thrombocytopenia. The median (IQR) baseline platelet count was 17,000/µL (12,000–43,000/µL). Based on severity categorization, SRT was present in 4 (10.5%) patients. Among the remaining patients, profound thrombocytopenia occurred in 12 (32.4%), and mild to moderate thrombocytopenia in 21 (56.8%).

Mean Platelet Volume

The median (IQR) MPV was 6.6 fL (5.75–7.8). Twenty-one (65.6%) patients had microthrombocytopenia, whereas 11 (34.4%) had normal MPV.

Three cases had mutations that were previously reported as normal-sized thrombocytopenia in WAS. Two patients underwent splenectomy for severe thrombocytopenia in the course of their diseases, but they belong to the microthrombocytopenia group. We also identified 6 novel mutations, five of which were associated with microthrombocytopenia, and one of them with a missing MPV.

Serum Immunoglobulins

We observed variable immunoglobulin profiles in this cohort study. Serum IgG was measured as normal in 22 (84.6%) and increased in 4 (15.4%) patients. IgA level appeared normal in 29 (82.8%), decreased in 1 (2.9%), and increased in 5 (14.3%) patients. IgM level was normal in 19 (54.3%), decreased in 14 (40%), and increased in 2 (5.7%) patients. Finally, serum IgE levels were within the normal range in 8 (27.6%), and elevated in 21 (72.4%) patients. Isohemagglutinin was checked in 12 cases and was impaired in 50% of them (Table 3).

Table 3.

The immunological test results of patients with Wiskott-Aldrich syndrome

	Count Median (IQR)	Normal N (%)	Decreased N (%)	Increased N (%)
WBC/μL	9100 (6610, 10955)
Lymphocyte/μL	3188 (2110, 5152)	27 (71.1)	11 (28.9)	-
Lymphocyte (%)	35 (26.35, 54.15)
Neutrophil/μL	3590 (1910, 4220)	27 (73)	10 (27)
Neutrophil (%)	42.6 (28.6, 49.35)
Eosinophil/μL	466 (215, 882.5)	11 (31.4)		24 (68.6)
Eosinophil (%)	5.3 (2, 10.32)
Platelet/μL	17,000 (12000, 43000)		38 (100)
MPV (fL)	6.6 (5.75, 7.8)	11 (34.4)	21 (65.6)
IgG (mg/dL)	984.5 (701.5, 1364.5)	22 (84.6)	-	4 (15.4)
IgA (mg/dL)	115 (62, 250)	29 (82.8)	1 (2.9)	5 (14.3)
IgM (mg/dL)	54 (29, 116)	19 (54.3)	14 (40)	2 (5.7)
IgE (IU/mL)	244.7 (44.5, 463.5)	8 (27.6)	-	21 (72.4)
CD3 (%)	62 (52.5, 77.15)	9 (52.9)	8 (47.1)	-
CD4 (%)	32 (26.85, 38)	9 (40.9)	13 (59.1)	-
CD8 (%)	19 (11.77, 35)	10 (45.5)	12 (54.5)	-
CD19 (%)	12 (8, 16.16)	7 (33.3)	14 (66.7)

Ig immunoglobulin, MPV mean platelet volume, WBC white blood cell

White Blood Cell Analysis

The abnormal findings of the CBCs included lymphopenia in 28.9%, neutropenia in 27%, and eosinophilia in 68.6% of the patients. Lymphocyte flow cytometry for CD3⁺, CD4⁺, and CD8⁺ T cells, and CD19⁺ B cells was available for 21 patients. CD3⁺ T cells were decreased by 47.1% (8/17). CD4⁺ T cells, CD8⁺ T cells, and CD19⁺ B cells were decreased by 59.1%, 54.5%, and 66.7%, respectively (Table 3).

T-Cell Proliferation Assay

Functional T-cell assessment via proliferation assays (lymphocyte transformation test, LTT) was performed on a limited subset of the cohort. LTT results in response to phytohemagglutinin (PHA) were available for 7 patients; proliferation was found to be reduced in 6 of these 7 patients. For antigen-specific responses, proliferation was reduced in response to both BCG and Candida antigens in 1 out of the 3 patients tested.

WAS Score

The distribution of WAS scores among the 38 patients was as follows: 4 (10.5%) patients had a score of 3, 20 (52.6%) had a score of 4, and 14 (36.9%) had a score of 5. Prognosis appeared to be correlated with the score. All patients with a WAS score of 3 were alive at the time of analysis, whereas higher mortality was observed among patients with scores of 4 and 5 (Table 4).

Table 4.

The outcome of patients with WAS according to the treatment, the age of HSCT, and WAS score

Variable	Alive N (%)	Deceased N (%)	P value
HSCT	10 (62.5)	6 (37.5)	0.06
Age at HSCT < 2y 2-5y > 5y	7 (70) 2 (66.7) 1 (50)	3 (30) 1 (33.3) 1 (50)	> 0.99
WAS Score WAS score 3 (n = 4) HSCT Non-HSCT WAS score 4 (n = 20) HSCT Non-HSCT WAS score 5 (n = 14) HSCT Non-HSCT Autoimmunity HSCT Non-HSCT Malignancy HSCT No HSCT	4 (100) 3 1 6 (30) 3 3 7 (50) 4 3 7 (50) 4 3 3 2 1	0 (0) 0 0 14 (70) 4 10 7 (50) 2 5 7 (50) 2 5 0 0 0	0.03*

HSCT hematopoietic stem cell transplantation, WAS Wiskott-Aldrich syndrome, y years

*Association between WAS score and outcome

Mutation Analysis

WAS gene mutation analysis in 36 of the 38 patients revealed 29 different mutations in 32 patients, including 6 novel mutations (Table 5). The mutation types and number of affected patients included nonsense (n = 11), missense (n = 7), splicing site (n = 5), deletions (n = 4), duplications (n = 3), deletion-insertion (n = 1), and insertion (n = 1). Nonsense mutations constituted the most frequent type. The 6 novel mutations are listed below.

Table 5.

Clinical, genetic findings, and outcomes in patients with Wiskott-Aldrich syndrome

No	Age of Onset	Clinical Symptoms	Position	Mutation	protein-level consequence	Reported/Novel	WAS Score	MPV	HSCT	Outcome
1	8 m	Otitis media, Pneumonia, Epistaxis, petechiae and purpura, GI hemorrhage	Exon 10	c.1235delC	p.Pro412LeufsTer33	Reported [26]	5	2.6	No	Deceased
2	1 m	Pneumonia, FTT, Cellulitis, petechiae and purpura, Eczema, Sepsis	Exon 2	c.192G>A	p.Trp64Ter	Reported [27]	5	NA	Yes	Deceased
3	3 m	Otitis media, Pneumonia, FTT, Diarrhea, Erythroderma, Hepatosplenomegaly, Oral aphthous, Sepsis, Eczema, (Skin, and GI hemorrhage)	Exon 7	c.631C>T	p.Arg211Ter	Reported [28]	4	5.7	No	Deceased
4	5 m	Otitis media, Sinusitis, Pneumonia, Diarrhea, Hepatosplenomegaly, Eczema, Epistaxis, petechiae and purpura, GI, and Retinal hemorrhage	Exon 2	c.208G>A	p.Gly70Arg	Reported [29]	4	7	No	Deceased
5	5 m	Pneumonia, Sepsis, Hepatosplenomegaly, Eczema	Exon 2	c.208G>A	p.Gly70Arg	Reported [29]	4	6.9	Yes	Alive
6	6 m	Cellulitis, Hepatosplenomegaly, Eczema, BCG lymphadenitis, petechiae, and purpura	Exon 10	c.1074dupA	p.Pro359ThrfsTer136	Reported [26]	4	7.4	Yes	Deceased
7	1 m	Pneumonia, Eczema	Not Found				4	7.9	No	Deceased
8	1 m	Pneumonia, Sepsis, ecchymosis, rectorragia, Hepatosplenomegaly, Eczema, (Epistaxis, petechiae and purpura, and GI hemorrhage)	Exon 1	c.82C>T	p.Gln28Ter	Reported [27]	4	9.10	Yes	Deceased
9	1 m	Petechiae and Purpura, Food Allergy	Exon 1	c.121C>T	p.Arg41Ter	Reported [30]	3	5.6	Yes	Alive
10	1 m	Pneumonia, Eczema, AIHA, GI hemorrhage	Exon 1	c.22G>T	p.Gly8Ter	Reported [26]	5	6	No	Deceased
11	4 m	Diarrhea, Eczema, GI hemorrhage	Not Found				4	NA	No	Deceased
12	6 m	Pneumonia, Meningitis, seizure, Septic arthritis, Hepatosplenomegaly, Eczema, AIHA, Sepsis, Epistaxis	Exon 4	c.381C>G	p.Asn127Lys	Reported [31]	5	NA	No	Deceased
13	1 m	Thrush, Pneumonia, Diarrhea, Hepatosplenomegaly, Skin abscess, perianal abscess, Atopy, AIHA, BCG lymphadenitis, Sepsis, (petechiae and purpura, lung and brain hemorrhage)	Exon 11	c.1390G>T	p.Glu464Ter	Reported [26]	5	5.9	Yes	Deceased
14	6 m	Sinusitis, Pneumonia, Erythroderma, Necrotic lesion, Hepatosplenomegaly, ecchymosis, Skin abscess, Angioedema, Eczema, Anaphylaxis, Asthma, Orbital Abscess, Sepsis, (petechiae and purpura, GI, and oral hemorrhage)	Not Found				4	8.4	No	Alive
15	6 m	Diarrhea, Eczema, GI, and CNS hemorrhage	Not Done				4	NA	No	Deceased
16	2 m	Petechiae and purpura, Eczema, ITP	Exon 2	c.260T>C	p.Leu87Pro	Novel	5	NA	No	Deceased
17	6 m	Pneumonia, ecchymosis, Eczema, sepsis, (Epistaxis, petechiae and purpura, GI hemorrhage)	Exon 2	c.167C>T	p.Ala56Val	Reported [32]	4	NA	No	Alive
18	5 m	Sepsis, Eczema, (petechiae and purpura, GI hemorrhage)	Not Found				4	9.4	Yes	Deceased
19	11 m	Sinusitis, Otitis media, Mastoiditis, Pneumonia, Sepsis, Eczema, Nephrotic syndrome, Skin hemorrhage	Exon 10	c.1001delG	p.Gly334ValfsTer111	Reported [27]	5	3.9	Yes	Alive
20	6 m	Pneumonia, Diarrhea, Oral aphthous, Eczema, HSP, Urticaria, petechiae and purpura, GI hemorrhage	Exon 7	c.687delG	p.Lys230ArgfsTer31	Reported [33]	5	6.8	No	Alive
21	3 m	Otitis media, Hepatosplenomegaly, ecchymosis, Skin abscess, Eczema, sepsis, petechiae and purpura	Exon 7	c.631C>T	p.Arg211Ter	Reported [28]	3	8.9	Yes	Alive
22	12 m	Otitis media, Pneumonia, Eczema, Serum sickness, (Epistaxis and Skin and GI hemorrhage)	Intron 6	c.559+5G>A	Splice Defect	Reported [34]	4	6.7	Yes	Alive
23	1 m	Pneumonia, FTT, Diarrhea, Seizure, Eczema, Food Allergy, BCG adenitis, Sepsis, (petechiae and purpura and GI hemorrhage)	Exon 8	c.755G>A	p.Trp252Ter	Reported [35]	4	5.6	No	Deceased
24	12 m	Otitis media, Pneumonia, Hepatosplenomegaly, Skin abscess, Eczema, Epistaxis, petechiae and purpura	Exon 1	c.116T>C	p.Leu39Pro	Reported [28]	5	6.6	No	Alive
25	1 m	Pneumonia, seizure, Eczema, ITP, (Skin, GI and retinal hemorrhage)	Exon 2	c.227dupA	p.Asp77GlyfsTer2	Novel	4	5.9	No	Alive
26	20 m	Gingivitis, Diarrhea, Ecchymosis and purpura, Eczema, (Skin and oral hemorrhage)	Exon 1	c.116T>C	p.Leu39Pro	Reported [28]	3	7.5	No	Alive
27	6 m	Eczema, Food Allergy, (petechiae and purpura, GI hemorrhage)	Intron 8	c.777+1G>C	Splice Defect	Reported [36]	4	NA	Yes	Alive
28	1 m	Pneumonia, Eczema, Hepatic encephalopathy, (petechiae and purpura, GI hemorrhage)	Exon 3	c.291G>A	p.Trp97Ter	Reported [27]	4	8.4	No	Deceased
29	1 m	Gingivitis, Eczema, Sepsis (petechiae and purpura, GI, Brain, and oral hemorrhage)	Exon 3	c.308C >A	p.Ser103Ter	Novel	4	NA	No	Deceased
30	1 m	Pneumonia, Eczema, AIHA, Hematochezia, rectorragia, (Epistaxis, Skin, GI, and Urinary system hemorrhage)	Exon 8	c.763dupC	p.Gln255ProfsTer5	Reported* (No citation)	5	8.4	Yes	Alive
31	1 m	Thrush, Otitis media, Diarrhea, Meningitis, Wart, Eczema, hypertrophic pyloric stenosis, Scoliosis, Crohn’s disease, IBD, lymphoma, (petechiae and purpura, GI and Urinary system hemorrhage)	Intron 8	c.777+1G>A	Splice Defect	Reported [36]	5	NA	No	Alive
32	1 m	Thrush, Pneumonia, IBD, Eczema, Food Allergy, (GI and retinal hemorrhage)	Intron 3	c.360+1G>C	Splice Defect	Reported [37]	5	6.3	Yes	Alive
33	4 m	FTT, Eczema, petechiae and purpura,	Exon 1	c.100C>T	p.Arg34Ter	Reported [38]	5	6.6	Yes	Alive
34	1 m	Pneumonia, Eczema, Sepsis, petechiae and purpura	Exon 2	c.262delT	p.Tyr88ThrfsTer39	Novel	4	5.10	No	Deceased
35	1 m	Diarrhea, Eczema, Food Allergy, Sepsis, petechiae and purpura, GI hemorrhage	Exon 10	c.1075_1080delCCCCCAinsACCCCAA	p.Pro359ThrfsTer136	Novel	3	5.6	Yes	Alive
36	1 m	Pneumonia, Diarrhea, Eczema, Food Allergy, Lung abscess, (petechiae and purpura, GI hemorrhage)	Not Done				4	6.2	Yes	Deceased
37	6 m	Gingivitis, Otitis media, FTT, Diarrhea, Cellulitis, Eczema, BCG lymphadenitis, hematochezia, (Epistaxis, petechiae and purpura, GI and Oral hemorrhage)	Intron 11	c.1453+1G>C	Splice Defect	Reported [39]	4	NA	No	Deceased
38	4 m	Gingivitis, Diarrhea, Wart, Eczema, Food Allergy, BCG lymphadenitis, autoimmune pancytopenia, (petechiae, GI and Urinary system hemorrhage)	Exon 8	c.738_739insTG	p.Val247TrpfsTer15	Novel	5	6.6	No	Deceased

*Reported in ClinVar with no publication

AIHA Autoimmune hemolytic anemia, BCG Bacillus Calmette-Guerin, FTT Failure to thrive, GI Gastrointestinal, HSP Henoch-Schönlein purpura, ITP Immune thrombocytopenia

1. c.260T>C, observed in exon 2 of patient P16, results in a change from the amino acid leucine to proline at position 87 (p.Leu87Pro).

2. c.227dupA, found in exon 2 of patient P25, involves the duplication of nucleotide A at position 227. This causes a frameshift in the open reading frame (ORF), leading to immediate termination of translation in the subsequent codon (p.Asp77GlyfsTer2).

3. c.308C>A, identified in exon 3 of patient P29, is a nonsense mutation. It changes the codon for the amino acid serine at position 103 into a termination codon (p.Ser103Ter).

4. c.262delT, was observed in exon 2 of patient P34. This deletion results in a frameshift within the WAS ORF, producing an unstable, truncated protein (p.Tyr88ThrfsTer39).

5. c.1075_1080delCCCCCAinsACCCCAA, located in exon 10 of the WAS gene in patient P35, is complex. It involves the deletion of 6 nucleotides (CCCCCA) and the insertion of 7 nucleotides (ACCCCAA) at the same position, resulting in a truncated protein (p.Pro359ThrfsTer136).

6. c.738_739insTG, an insertion of the nucleotides TG between positions c.738 and c.739 in exon 8 of the WAS gene in patient P38. This insertion leads to a frameshift and creates a premature stop codon at position 262 (p.Val247TrpfsTer15).

Treatment

Of the 38 patients, 35 (92.1%) received prophylactic treatments, often involving multiple agents concurrently. Cotrimoxazole was prescribed for 27 (71.1%), acyclovir for 2 (5.3%), and fluconazole for 4 (10.5%). Prophylactic IVIG (typically 400 mg/kg every 4 weeks) was administered to 30 (78.9%) patients, guided by infection history and antibody deficiencies. One patient received granulocyte colony-stimulating factor (G-CSF) for severe neutropenia secondary to autoimmune pancytopenia. Blood products were administered as follows: Red Blood Cell 1, platelets 9, and both 4.

Systemic corticosteroids were used in 16 patients, primarily for autoimmune manifestations or due to initial misdiagnosis as ITP. Other immunomodulators, such as azathioprine and mesalamine, were prescribed for autoimmune complications.

Two patients underwent splenectomy for refractory thrombocytopenia, potentially related to delays in accessing HSCT. Eczema was managed with emollients, topical corticosteroids, and, in some cases, topical calcineurin inhibitors (pimecrolimus, tacrolimus). Hemorrhage management depended on site and severity and included transfusion of irradiated blood products when necessary.

Three patients with malignancies or myelodysplasia received standard oncology protocols, followed by HSCT upon achieving remission; these transplants were deemed successful.

Overall, 16 patients (42.1%) underwent HSCT. One patient required a subsequent bone marrow transplant after an initial umbilical cord graft failure. The median duration of follow-up after HSCT was 66.44 months (min = 4.08-max = 170.24).

Twenty-one cases were deceased from the disease, 6 of whom had been transplanted. Fifteen of them were not transplanted due to the lack of suitable donors. Although transplanted WAS patients had higher survival rates (56.5%) compared to non-transplanted patients (32%), the difference was not statistically significant (p = 0.056)(Fig. 1). Nine patients were transplanted before 2015, of whom four (44.4%) died. Six patients were transplanted after 2015, of whom one (16.7%) died (p = 0.29). Our study did not show significant statistical differences in outcome based on the age of receiving the graft (p > 0.99).

Fig. 1.

The overall survival of patients with Wiskott-Aldrich syndrome (A), Comparison of overall survival in Wiskott-Aldrich syndrome patients who underwent hematopoietic stem cell transplantation (HSCT) compared with those who did not (B)

The treatment outcome was as follows: partial response (n = 14, 36.8%), complete response (n = 3, 7.9%). Moreover, 21 patients (55.3%) expired.

Discussion

Our cohort’s experience underscores both the heterogeneous presentation of WAS and the transformative impact of curative therapies when accessible. WAS is classically defined by the triad of eczema, thrombocytopenia, and recurrent infections; however, only about 15% to 27% of patients exhibit all three features at the diagnosis time [10, 24]. In our cohort, the most common initial presentations were petechiae, bloody stool, and thrombocytopenia. These findings are consistent with reports from a Chinese cohort (bleeding in 75% and eczema in 16.7%) [40] and Sullivan’s multi-institutional series (petechiae/purpura in 78% and melena in 28%) [24].

The median ages of symptom onset and diagnosis in our study were 3.5 and 7.5 months, respectively. These values are closely aligned with other international cohorts. Although delays beyond 6 months are common and contribute to morbidity, symptom onset has been reported as early as 15 days in some cohorts, with diagnosis by 3 months [10]. The median age of diagnosis in our study was 7.5 months, compared to 10-24 months in Chinese cohorts, 12 months in the Indian, 21 months in the USA, and 15-24 months in Turkish cohorts [24, 40–45].

Infections are common in WAS due to lymphopenia, impaired T cell, B cell, NK cell, and phagocyte functions [12]. Pneumonia, upper airway infections, and sepsis were the most common infections in our study. Thirty-five cases (92.1%) received prophylactic treatments. Prophylactic IVIG was administered to 30 (78.9%) patients, guided by infection history and antibody deficiencies, and consistent with recommendations for managing antibody deficiencies in the recent Iranian national consensus guideline [46]. Similar considerations to prophylactic medications for applying prophylactic IVIG were considered, aside from abnormal quantitative antibody production and abnormal antibody responses [13]. Twenty-eight cases (73.7%) received prophylactic antibiotics, 2 (5.3%) prophylactic antivirals, and 4 (10.5%) prophylactic antifungals. The decision to begin antiviral and antifungal prophylaxis was based on the frequency, severity, and type of infection. These prophylactic measures were administered alongside aggressive treatment for acute infections.

Severe viral infections from Herpes simplex virus, varicella zoster, human papillomavirus, Epstein-Barr virus, and cytomegalovirus can also occur and be clues for immunodeficiency [13, 14, 24, 44, 45, 47]. All patients in our cohort had received the BCG vaccine per the national vaccination schedule. Five cases (13.2%) developed localized BCG infection; however, disseminated BCG complications were not observed. While Sullivan reported vaccine complications in 1% [24], most cohorts do not [43, 45]. This discrepancy may reflect differences in national vaccination policies, particularly the routine use or omission of BCG vaccination, as well as the implementation of newborn screening programs in other regions. Fazlollahi et al. investigated BCG vaccine complications among 3275 cases of inborn error of immunity in the IAARI. The overall incidence of BCG vaccine complications reached 197 cases (6%), with WAS patients accounting for 6 (3%) of these cases. All WAS patients exhibited localized BCG vaccine complications [48].

In our cohort, allergic manifestations were observed in all patients, with atopic dermatitis being the most prevalent presentation. Food allergies, episodes of anaphylaxis, and asthma were also documented. The pathophysiology underlying these allergic phenotypes is thought to involve the role of WASp in T-cell differentiation, whereby its absence promotes immune skewing toward a Th2-dominant phenotype [49, 50]. Furthermore, dysfunctional Tregs- characterized by impaired suppressive capacity and reduced IL-10 secretion as well as the presence of ectopic dermal Langerhans cells, contribute to atopic dermatitis [10]. Atopy is prominent in WAS, with eczema reported in over 80% of cases [10, 23, 24, 44]. Allergic rhinitis, asthma, and food allergies are also frequently observed [14, 47, 50].

All our patients exhibited thrombocytopenia; 11 (34.4%) had normal-sized platelets, reflecting the known variability in platelet morphology in WAS [1, 12, 51–53]. Comparatively, a cohort in the USA reported microthrombocytopenia in 53.8% [24]. Haskologlu et al. reported normal-sized platelets in 6.9% [43], and Suri’s cohort found microthrombocytopenia universally [45]. Although microthrombocytopenia remains a hallmark, these findings underscore that normal MPV does not exclude WAS. The underlying reasons for this variability in our cohort remain unclear. However, systematic laboratory error is unlikely, given the consistency of findings across multiple measurements and peripheral smear reviews for individual patients. Nevertheless, the potential confounding effect of platelet transfusions before CBC analysis cannot be entirely excluded. Notably, the six novel mutations identified in our study were associated with 5 microthrombocytopenia, while MPV data were unavailable for one patient.

The most common bleeding manifestations were gastrointestinal bleeding and petechiae, consistent with other reports [10, 24, 44, 45]. Intracranial hemorrhage was associated with a fatal outcome in all affected patients. Patients with SRT faced 75% mortality, with bleeding being the primary cause of death. One patient with SRT died from extensive intracranial and pulmonary hemorrhage following two graft procedures, including an unsuccessful umbilical cord blood transplant and a subsequent HSCT. This aligns with a previous study that identified SRT as a poor prognostic factor [8]. Although thrombopoietin receptor agonists like romiplostim and eltrombopag may temporarily mitigate life-threatening hemorrhage, definitive management requires curative therapies [8].

Autoimmune complications occurred in 14 (36.8%) of our patients, predominantly SRT and autoimmune hemolytic anemia (AIHA). This rate falls within the wide spectrum reported globally (26% to 72%) [14, 24, 42, 44, 54, 55]. Moreover, in a recent study in our country, the percentage of autoimmune manifestations (56.1%) was higher than in our cohort [56]. Other studies also report autoimmune cytopenias (including AIHA, autoimmune thrombocytopenia, and autoimmune neutropenia) as the most prominent autoimmune diseases in WAS [24, 42, 45, 54]. These findings reflect the complex interplay between genetic background, environmental triggers, and stochastic events in driving immune dysregulation. Importantly, as highlighted in recent reviews, the development of autoimmunity often signals a more severe disease phenotype and strengthens the indication for prompt referral for curative therapies like HSCT [57].

WAS patients have an increased risk of developing malignancies, with hematologic malignancies being the most common [10, 58]. In our study, 3 (7.9%) cases developed hematologic malignancies: one leukemia, one lymphoma, and one myelodysplastic syndrome. International cohorts have reported malignancy rates between 2.1% and 26% [10, 24, 45]. All three affected patients in our study were successfully treated for their malignancies, with two undergoing HSCT. Notably, all patients who developed malignancies had a WAS score of 5 before the onset of cancer, whereas none of the patients without autoimmune disease developed cancer. This observation is consistent with the findings of Sullivan et al. who reported that patients with autoimmune diseases are more likely to develop malignancies [24]. In addition, Suri et al. (2021) identified malignancy as a rare but severe complication of WAS [45], and emerging evidences suggest WAS gene correction may ultimately mitigate oncogenic risk [59].

Additionally, patients with a higher WAS score experienced more morbidity and mortality in our study, as reported in other studies [8, 10, 13, 24].

In our cohort, IgG and IgA levels were generally within the age-adjusted reference ranges, although elevated levels of IgG and IgA were observed in a subset of patients. IgM levels were predominantly normal; however, reduced concentrations were observed in 40% of cases. Elevated serum IgE levels were observed in 72.4% of our patients, compared with 58.3% reported by Esmaeilzadeh et al. [56]. Overall, these findings are consistent with the heterogeneous immunoglobulin profiles previously reported in other studies [24, 40–42, 44, 47, 50].

Our study also demonstrated heterogeneity in immunologic abnormalities, including variable lymphopenia across T-cell subsets, impaired T-cell proliferative responses to both mitogens and antigens, B-cell lymphopenia, and reduced specific antibody responses to polysaccharide antigens. These combined defects in adaptive and innate immune function are well-recognized features of WAS [14, 24, 40–42].

The Human WAS Gene Mutation Database (HGMD) currently documents over 540 distinct mutations, predominantly comprising single-nucleotide substitutions such as nonsense, missense, and splice site defects, with small deletions representing the second most prevalent category. Our analysis of 29 mutations aligns with this distribution, revealing that 20 (68.9%) are single-nucleotide substitutions. Among these, 24 mutations (82.8%) were localized to exons, with exons 2 and 1 exhibiting the highest mutational frequency (6 and 5 mutations, respectively). The remaining 5 mutations (17.2%) occurred in intronic regions, 4 of which disrupted the conserved +1G nucleotide at intron-exon boundaries. Recurrent mutations were observed in three instances: c.631C>T (p.Arg211Ter) and c.208G >A (p.Gly70Arg) each appeared in 2 unrelated families, while c.116T>C (p.Leu39Pro) was identified in 2 siblings from a single family. The spectrum of mutations encompassed seven distinct classes, including missense, nonsense, splice site defects, deletions, duplications, insertions, and del-ins (deletion-insertion mutation). Notably, all splice site defects corresponded to previously reported mutations, whereas novel mutations were identified in the missense (c.260T>C), nonsense (c.308C>A), duplication (c.227dupA) and deletion (c.262delT) categories. Both insertion (c.738_739insTG) and del-ins (c.1075_1080delCCCCCAinsACCCCAA) mutations, each observed once in the study, were novel.

The prognosis following HSCT is influenced by factors, including patient age at transplantation, pretransplant clinical status, donor type, and conditioning regimen. Notably, superior survival outcomes have been consistently reported in patients transplanted before 5 years of age [18, 42]. HSCT outcomes have continued to improve over time; a recent analysis by the EBMT Inborn Errors Working Party reported a 3-year overall survival rate of 88.7% [42]. Favorable outcomes have also been documented with cord blood and matched unrelated donors, especially in younger patients [60]. In light of these data, early HSCT is recommended for patients with WAS.

However, access to HSCT and post-transplant outcomes remains challenging in resource-limited settings. In our cohort, only 42.1% underwent HSCT, with a high transplant-related mortality rate of 37.5%. In this limited sample, outcomes did not differ significantly according to age at the time of transplant. Mortality following HSCT in this study was higher than in most published series. However, it was consistent with the findings observed in an Indian cohort study [45]. Several barriers contribute to these less favorable outcomes, including limited access to donor registries and transplant infrastructure. Delayed diagnosis may further increase pretransplant morbidity and mortality, thereby negatively affecting both the timing and success of HSCT. Overall mortality in our cohort was high (21 patients, 55.3%), particularly among those who did not receive HSCT. Suri et al. reported a mortality rate of 37% with a similar median follow-up [45]. This high mortality is consistent with the established observation that patients in better clinical condition at the time of HSCT experience superior outcomes [12]. In addition, our cohort reflects earlier transplant eras, whereas HSCT outcomes for WAS have progressively improved over time with advances in conditioning regimens, donor selection, and supportive care. Recent data from the Primary Immune Deficiency Treatment Consortium (PIDTC) reported a 5-year overall survival and event-free survival rate of 87.2% and 79.7%, respectively, among patients with WAS, with a median age at HSCT of 1.2 years [61]. Superior overall survival was observed in patients less than 5 years of age at the time of HSCT [8, 62]. In our study, life-threatening hemorrhage, severe infections, and transplant-related complications were the leading causes of death. Without definitive therapy, the median survival of patients with WAS is estimated to be only 10–15 years, largely due to severe bleeding, recurrent infections, malignancies, and autoimmune complications [7, 24]. Although the mortality rate after HSCT was lower after 2015 than before 2015, it was statistically insignificant. The conditioning protocol was the same in both groups; however, differences may be due to factors such as improved supportive care.

Autologous gene-modified HSCT represents a curative alternative for WAS patients lacking a suitable donor for allogenic transplant. This approach circumvents major transplant-related complications, including GVHD and graft rejection [63] The first successful gene therapy for WAS was conducted in 2006, which demonstrated correction of both lymphoid and myeloid defects in 2 patients [64]. More recently, lentiviral vector-based gene therapy has shown substantial efficacy in multiple clinical trials [65]. Long-term follow-up of 15 gene‑treated patients revealed durable engraftment, resolution of eczema and infections, and a significant reduction in autoimmune manifestations, despite only partial restoration of platelet counts [66]. Nevertheless, gene therapy is not currently available in Iran, underscoring the need to explore access through neighboring countries or to advocate for its future availability.

Future directions include establishing multicenter studies or a national WAS registry for more robust analysis of outcomes and genotype-phenotype correlations. Optimizing local HSCT protocols and supportive care is warranted to improve safety [46]. Further research should involve functional studies of novel mutations and strategies, like physician education or newborn screening, to reduce diagnostic delays. Long-term follow-up remains essential for tracking late complications and quality of life. It is also important to consider differential diagnoses, such as WIP deficiency, an autosomal recessive disorder with overlapping clinical features [67].

Our study has several limitations. Missing laboratory data, including lymphocyte flow cytometry, specific antibody responses, and genetic studies, were not available for some patients. Additionally, data on HSCT complications and donor type were incomplete for some individuals.

Conclusion

Early diagnosis of WAS, a rare inborn error of immunity, is critical for optimizing patient outcomes. Although supportive care remains essential until definitive therapies- such as gene therapy or HSCT- are available, diagnostic delays can lead to inappropriate or postponed interventions, mismanagement of infections, and potentially harmful interventions such as splenectomy, all of which may contribute to increased morbidity and mortality. WAS should be considered in any male infant or child presenting with early-onset thrombocytopenia, particularly if associated with microthrombocytopenia; though normal platelet size does not exclude WAS. Furthermore, WAS should be strongly suspected in male children diagnosed with presumed ITP in early childhood and shows resistance to treatment or present with eczema, recurrent infections, or a positive family history of thrombocytopenia or immunodeficiency in male relatives. Prompt recognition and referral are key to improving outcomes for patients with WAS.

Author Contributions

Anahita Razaghian, Mohammad Reza Fazlollahi, and Zahra Pourpak contributed to the study conception and design. Material preparation, data collection, and genetic analysis, validation, and visualization were performed by Mohsen Badalzadeh. Statistical analysis and visualization were performed by Raheleh Shokouhi Shoormasti. Data collection and patient evaluation were performed by Anahita Razaghian, Mohammad Reza Fazlollahi, Amir Ali Hamidieh, Nasrin Behniafard, Leila Moradi, Samin Alavi, Maryam Behfar, Masoud Movahedi, Mohammad Gharagozlou, Tahereh Rostami, Farideh Moussavi, Morteza Fallahpour, Mansoureh Shariat, Nima Parvaneh, Alireza Shafiei, Hamid Ahanchian, Delara Babaei, Mohammad Hassan Bemanian, and Roshanak Radmehr and Zahra Pourpak. Genetic analysis and validation were performed by Massoud Houshmand. Genetic investigations were performed by Reyhaneh Khademi and Somayeh Shamlou. The first draft of the manuscript was written by Anahita Razaghian and Mohsen Badalzadeh. All authors contributed to [writing, review & editing](http:/credit.niso.org/contributor-roles/writing-review-editing). All authors read and approved the final manuscript.

Funding

This study was supported by the Immunology, Asthma, and Allergy Research Institute, Tehran University of Medical Sciences.

Data Availability

The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics Approval

The Ethics Committee of Immunology, Asthma and Allergy Research Institute approved the study (No. IR.TUMS.IAARI.REC.1400.014), and informed consent was obtained from all patients or their parents.

Consent to Participate

Informed consent was obtained from all patients or their parents.

Consent to Publish

Not applicable.

Generative AI and AI-Assisted Technologies in the Writing Process

We acknowledge that the authors used ChatGPT and Sider in order to improve sentences and language editing. After using this tool/service, the authors reviewed and edited the content thoroughly and hereby declare full responsibility for the authenticity of the contents of this publication.

Competing Interests

The authors declare no competing interests.