Skip to main content
NCBI home page
MicrobiologyOpen logoLink to MicrobiologyOpen
. 2026 Mar 10;15(2):e70110. doi: 10.1002/mbo3.70110

Therapeutic Impact of Caffeic Acid Phenethyl Ester and Acyclovir Combination on Human Gingival Fibroblasts (HGF‐1) Infected With Herpes Simplex Type 1 ICP0

Merve Sen 1,✉, Sefa Celik 2
PMCID: PMC12976143  PMID: 41808302

ABSTRACT

Herpes simplex virus Type 1 (HSV‐1) is a prevalent infectious agent globally, often causing oral infections like gingivostomatitis. The ICP0 protein of HSV‐1 exacerbates infection severity by inhibiting antiviral responses. Our study explored how combinations of CAPE (caffeic acid phenethyl ester) and acyclovir influenced immune responses in gingival cells treated with ICP0 We applied ICP0 protein, CAPE, acyclovir, and their combinations to HGF‐1 cells for 24 h. IC50 dose amounts were determined using the MTT cell viability test, gene expressions were assessed by RT‐PCR, and protein levels were gauged by the ELISA method. No statistically significant changes were noted between the ICP0 applied groups and the control groups (p > 0.05). However, significant increases were observed in the IFN‐β (p < 0.0001), IFN‐γ (p < 0.0001), IRF3 (p < 0.0001), β‐catenin (p < 0.0001), WNT‐1 (p < 0.0001). protein levels of the ICP0 + CAPE applied groups. The increases in all groups administered ICP0 + acyclovir surpassed those administered ICP0 + CAPE (p < 0.0001). The combination of CAPE and acyclovir could potentially reduce both the adverse effects caused by the ICP0 protein and the undesirable side effects that may be caused by the acyclovir used in the treatment. This combination could serve as a potential therapy in the treatment of HSV‐1.

Keywords: acyclovir, CAPE, HGF‐1 cell, HSV‐1, ICP0

graphic file with name MBO3-15-e70110-g004.jpg

Abbreviations

CAPE

caffeic acid phenethyl ester

ELISA

enzyme‐linked immunosorbent assay

FBS

fetal bovine serum

GAPDH

glyceraldehyde 3‐phosphate dehydrogenase

HGF‐1

human gingival fibroblast

HSV‐1

herpes simplex virus type 1

IC50 dose

half‐maximal inhibitory concentration

ICP0

infected cell protein 0

IFN‐β

interferon‐beta

IFN‐γ

interferon‐gama

IRF3

interferon regulatory factor 3

RT‐PCR

real time‐polymerase chain reaction

WNT‐1

wingless‐related integration site

ΔCt

delta cycle threshold

β‐catenin

beta catenin

1. Background

Herpes simplex virus (HSV) is a prevalent viral agent causing disease in humans. The most frequent clinical manifestation of HSV, particularly in children, is herpetic gingivostomatitis (Amir et al. 1997). Herpes labialis is a common condition globally. HSV‐1 causes herpes labialis through nonsexual contact during childhood and adolescence, and in recent years, HSV‐1 has been responsible for at least 50% of genital HSV infection cases (Gupta et al. 2007). Primary HSV‐1 infection may present as asymptomatic or self‐limiting gingivostomatitis (Opstelten et al. 2008). The HSV‐1 ICP0 (Infected Cell Protein 0) protein weakens the immune response by enhancing the degradation of antiviral proteins via the ubiquitin‐proteasome, inhibiting the interferon response, and potentially increasing the severity of gingivostomatitis infection (Dremel and DeLuca 2019). It can also cause lesions and ulcers by increasing cell death, especially in gingival epithelial cells (Everett and Murray 2005).

Research indicates that ICP0 plays a vital role in virus replication, partly by overcoming host suppressive antiviral responses (Everett 2000). The HSV‐1 ICP0 protein inhibits IRF3 and IRF7 activity, leading to IFN‐induced blocks of virus transcription (Mossman and Smiley 2002; Lin et al. 2004). The inhibitory effects of ICP0 on IRF‐3 weaken the overall immune response of host cells, facilitating HSV‐1's escape from the immune system, which may result in chronic infection (Harle et al. 2006).

Wnt‐1 signaling enhances viral replication in HSV‐1 infection. Moreover, activating the Wnt‐1 signaling pathway can boost virus proliferation by leading to β‐catenin accumulation (Li and Dai 2015). Wnt‐1 promotes cell proliferation, which can increase the proliferation of infected cells, thereby aiding virus spread (Nusse and Varmus 2012).

Studies with HSV‐1‐infected human fibroblasts suggest that β‐catenin is necessary for recruitment to the host nucleus and for viral replication steps to occur, with β‐catenin enhancing productive infection (Drayman et al. 2019). Acyclovir alleviates symptoms due to HSV‐1 infection, reduces recovery time, and lessens pain (Spruance and Kriesel 2002). However, long‐term use of acyclovir, particularly in immunocompromised patients, may lead to HSV‐1 developing resistance to acyclovir, resulting in strains becoming less responsive to treatment (Bacon et al. 2003). A study reported that CAPE suppresses acute immune and inflammatory responses and shows promise for therapeutic uses to reduce inflammation (Orban et al. 2015).

2. Methods

In the study, the ICP0 protein, which aids in developing resistance to Type 1 interferons and latency, was introduced to human gingival fibroblast (HGF‐1) cells. Subsequently, the impacts of acyclovir/CAPE combinations and IFN‐β, IFN‐γ, IRF3, β‐catenin, WNT‐1 were assessed using PCR and ELISA methods.

The working groups were defined as Control, ICP0, ICP0 + CAPE, ICP0 + acyclovir, ICP0 + CAPE + acyclovir, and the application period was set to 24 h for the HGF cell line.

3. Cell Culture

HGF‐1 cells (American Type Culture Collection, CRL‐2014), containing 10% (v/v) heat‐inactivated fetal bovine serum (FBS) and 5 mM glutamine, 100 U/mL penicillin, 100 µg/mL streptomycin, were incubated in Dulbecco's Modified Eagle's Medium at 37°C, in an atmosphere of 5% CO2 and 95% air. To proliferate the cells, 3 × 106 cells and 20 ml of medium were placed in 75 cm2 flasks, with a density of approximately 4 × 104 cells per square cm, and incubated for 3–4 days.

4. IC50 Dose Determination Studies With MTT Cell Viability Measurement Test

The 100 μL of the cell suspension, prepared at 2 × 104 cells/mL, was transferred to 96‐well cell culture plates and incubated at 37°C for 48 h to ensure they covered the bottom surface of the well (50%–60%).

CAPE was initially dissolved in dimethyl sulfoxide (DMSO) to prepare a stock solution. Working concentrations were diluted in culture medium to contain a final DMSO concentration of 0.5%. To ensure consistency, 0.5% DMSO was also added to all control and treatment groups, including the untreated controls, to rule out any solvent‐related effects. Acyclovir was dissolved in sterile distilled water and diluted directly in the culture medium before application.

For the commercially obtained, lyophilized HSV‐1 ICP0 protein (MyBiosource, Cat No:MBS1089623), diluted at 1000 µM, 500 µM, 250 µM, 125 µM, 62.5 µM, 31.25 µM, 15.62 µM, 7.8 µM, 3.54 µM, 1.5 µM were prepared. For CAPE (Selleckchem, Cat. No: S7414), dilutions of 500 µM, 250 µM, 100 µM, 50 µM, 25 µM, 10 µM, 5 µM were prepared. For acyclovir (TCI, Cat. No: A1915), dilutions of 500 µM, 250 µM, 100 µM, 50 µM, 25 µM, 10 µM, 5 µM, 1 µM were prepared. Various combinations were applied to the HGF‐1 cell line for 24 h. The 24‐hour treatment duration was selected based on prior studies using HGF‐1 cells to evaluate gene and protein expression changes following similar treatments (Kurek‐Górecka et al. 2023). At the conclusion of the 24‐h incubation period, 1 μL of MTT dye (5 μg/mL) was added to each well, and the cells were incubated for an additional 2 h at 37°C. The MTT solutions were removed and 200 μL of DMSO was added to each well and incubated for 5 min at room temperature and in the dark. The color change was determined with a wavelength of 570 nm in an ELISA plate reader. Calculations were performed in the Graphad Prism 9 program.

5. Real Time RT‐PCR

The GeneMATRIX UNIVERSAL RNA Purification Kit (EURX, Cat. No: E3598) was utilized for total RNA isolation. The cDNA synthesis from the isolated RNAs was conducted using the OneScript Plus cDNA Synthesis Kit (ABM, USA) following the kit protocol. The concentrations of the cDNAs used were spectrophotometrically measured (Epoch, BioTek), and those with an RNA/DNA ratio of 1.7 and above were included in the study. The appropriate volume of cDNA was transferred to PCR strips (Axygen). The total reaction volume for each sample was calculated as 20 μL. Reaction mixtures were added to the wells containing cDNAs. PCR strips were loaded into the CFX Connect, Real Time System (BIO‐RAD) device.

Delta cycle threshold (ΔCt) values were calculated by subtracting the Ct values of each gene from the housekeeping Ct value of that sample. Then, delta delta cycle threshold (ΔΔCt) values were calculated by subtracting the ΔCt values of each sample from the Ct value of the control group. To calculate the expression of each gene, the 2−ΔΔCt value was determined by taking the ratio of the final value to the initial (fold change). If the 2−ΔΔCt value was above 1, it was interpreted as an increase, and if it was below 1, it was interpreted as a decrease in expression. These calculations were performed in the REST 2009 program. The GAPDH gene was used as the housekeeping gene. Primer sequences, temperatures, and cycles used are listed below (Table 1).

Table 1.

PCR primer sequences.

Genes Primer sequences (5′ → 3′) RT‐PCR programs Cycle
GAPDH F‐5′ GATTTGGTCGTATTGGGCGC 3′ 95°C‐30s/59°C‐1m/72°C‐30s 35
R‐5′AGTGATGGCATGGACTGTGG 3′
IFN‐β F‐5′AAGCCTCCCATTCAATTGCC‐3′ 95°C‐30s/55°C‐1m/72°C‐30s 35
R‐5′‐CTGCAACCTTTCGAAGCCTT‐3′
IFN‐γ F‐5′ GTGATTATCGGCAGCTGGTG 3′ 95°C‐30s/57°C‐1m/72°C‐30s 35
R‐5′ TCCCTTTGTTTCTCCCCTGG 3′
IRF3 F‐5′‐CTGGGGCCCTTCATTGTAGA‐3′ 95°C‐30s/57°C‐1m/72°C‐30s 35
R‐5′‐TTTCTACCAAGGCCCTGAGG‐3′
β‐Catenin F‐5′ TTGAAGGTTGTACCGGAGCC 3′ 95°C‐30s/58°C‐1m/72°C‐30s 35
R‐5′ GCCACCCATCTCATGTTCCA 3′
WNT‐1 F‐5′ CCCAAACAGACTCGCTAGCA 3′ 95°C‐30s/58°C‐1m/72°C‐30s 35
R‐5′CTGGGAGAATGGGGGCATTT 3′
Open in a new tab

6. Total Protein Measurement

After 24 h of application, HGF‐1 cells were washed twice with PBS and then harvested using a lysis buffer containing a protease inhibitor cocktail (Roche Complete, Cat. No: 04.693.116 001). Lysates were centrifuged at 16,000 g for 15 min at 4°C. Protein concentration was determined by the BCA method using a commercial kit (TaKaRa, Shiga, Japan, Cat. No: T9300A).

7. Determination of IFN‐β, IFN‐γ, IRF3, β‐Catenin, WNT‐1 Protein Levels by the ELISA Method

IFN‐β (BT LAB, Cat. No: E0154Hu), IFN‐γ (BT LAB, Cat. No: E0105Hu), IRF3 (BT LAB, Cat. No: E0105Hu), β‐catenin (BT LAB, Cat. No: E2396Hu), WNT‐1 (BT LAB, Cat. No: E2355Hu) protein amounts were measured using commercially available ELISA kits. Concentrations were measured using a microplate reader at 450 nm. Protein concentrations (pg/mg) of the samples were calculated using graphs obtained from standard concentrations.

8. Data Analysis

The experiments consisted of three repetitions, and the average values obtained were evaluated using one‐way ANOVA in the SPSS statistical program.

9. Results

9.1. Determination of IC50 Dosage for ICP0, CAPE, and Acyclovir

Various concentrations and combinations of ICP0, CAPE, and acyclovir were applied to the HGF cell line for 24 h. The results were tested with MTT and calculated in the GraphPad Prism 9 program. Accordingly, the IC50 dose for Infected Cell Protein 0 (ICP0) was determined as 63.14 nM, the IC50 dose for caffeic acid phenethyl ester (CAPE) was determined as 83.66 µM, and the IC50 dose for acyclovir was determined as 12.99 µM (Figure 1).

Figure 1.

Figure 1

Open in a new tab

Determination of IC50 values for CAPE, ICP0 and aciyclovir. The results are reported as means± standard deviation of at least two independent experiments.

9.2. Effect of Acyclovir, CAPE, and Their Combinations on IFNβ, IFNγ, IRF3, β‐Catenin, WNT mRNA Expression Levels in ICP0 Applied HGF Cell Line

The mRNA expression amounts resulting from a 24‐h exposure to acyclovir, CAPE and their combinations in the ICP0 Applied HGF Cell Line were evaluated and presented in tables and graphs (Table 2; Figures 3, 4, 5, 6,). GAPDH was used as the housekeeping gene.

Table 2.

Levels of catenin‐β, IFN‐β, IFN‐γ, IRF 3, WNT after 24‐h exposure with ICP0, CAPE, aciycvlovir combination.

Groups C I I‐C I‐A I‐A‐C
Catenin‐β (pg/mg) 15.54 ± 1.78 13.64 ± 0.55 51.73 ± 6.86 86.73 ± 1.26 25.60 ± 5.15
IFN‐β (pg/mg) 38.83 ± 4.63 49.52 ± 3.77 177.6 ± 14.45 301.2 ± 33.49 106.7 ± 16.38
IFN‐γ (pg/mg) 10.85 ± 2.36 12.55 ± 4.20 41.93 ± 2.81 94.23 ± 13.71 26.03 ± 3.60
IRF 3 (pg/mg) 0.40 ± 0.08 0.6043 ± 0.04 2.27 ± 0.35 4.43 ± 0.41 0.89 ± 0.15
WNT (pg/mg) 0.38 ± 0.05 0.6345 ± 0.14 2.10 ± 0.30 4.17 ± 0.35 1.114 ± 0.15
Open in a new tab

Note: (C: Control, I: ICP0, I‐C: ICP0 and CAPE combination, I‐A: ICP0 and aciyclovir combination, I‐A‐C: ICP0, Acyclovir and CAPE combination).

Figure 3.

Figure 3

Open in a new tab

Alterations of the relative mRNA expression levels in HGF‐1 cell line after treatment with ICP0 and acyclovir combination.

Figure 4.

Figure 4

Open in a new tab

Alterations of the relative mRNA expression levels in HGF‐1 cell line after treatment with ICP0 and CAPE combination.

Figure 5.

Figure 5

Open in a new tab

Alterations of the relative mRNA expression levels in HGF‐1 cell line after treatment with ICP0, CAPE and acyclovir combination.

Figure 6.

Figure 6

Open in a new tab

Alterations of the relative mRNA expression levels in HGF‐1 cell line after treatment with ICP0.

9.3. IFNβ, IFNγ, IRF3, β‐Catenin, WNT‐1 Protein Amounts of Acyclovir, CAPE, and Their Combinations in the ICP0 Applied HGF Cell Line

Protein amounts resulting from a 24‐h exposure to acyclovir, CAPE, and their combinations in the ICP0 applied HGF Cell Line were evaluated by the ELISA method and presented in tables and graphs.

In the study, no statistically significant difference was found between the control groups in the protein amounts of IFNβ, IFNγ, IRF3, β‐catenin, and WNT‐1 in the groups that received only ICP0. While no statistically significant changes were observed between the ICP0 applied groups and the control groups, significant increases were seen in the IFN‐β, IFN‐γ, IRF3, β‐catenin, WNT‐1 protein amounts of the ICP0 + CAPE applied groups (p < 0.0001). The increases in all groups administered ICP0 + acyclovir were higher than those administered ICP0 + CAPE (p < 0.0001).

10. Discussion

Herpetic gingivostomatitis (HG) is a self‐limiting condition characterized by the formation of orofacial lesions (Kolokotronis and Doumas 2006). HG can induce prodromal fever, fatigue, weakness, halitosis, loss of appetite, lymphadenitis, and gingivitis, along with the formation of intraoral lesions (Heliotis et al. 2021; Mohan et al. 2013). While the preferred agent to suppress the virulence of the infection, oral or topical acyclovir, is effective in the prodromal phase of the infection, long‐term applications may lead to acyclovir resistance (Arduino and Porter 2008; Andrei et al. 2013).

IC50 doses for acyclovir, CAPE, and ICP0 proteins in the HGF‐1 cell line have not been reported in the literature. In this study, the IC50 doses for acyclovir, Infected Cell Protein 0 (ICP0), and CAPE were determined as 12.99 µg/mL, 63.14 nM, and 86.66 µg/mL, respectively, and these doses were used in applications (Figure 1). In our study, acyclovir, CAPE, and ICP0 were applied separately and in combination to HGF cell line study groups, and their effects were examined after 24 h.

The effects of the ICP0 protein on interferon‐beta mRNA expression are linked to complex processes, such as how HSV‐1 infection manipulates the immune system response and regulates viral replication. These effects of ICP0 are associated with the virus manipulating signaling pathways within the cell during infection (Sen et al. 2013). In our study, following 24‐h applications, no significant increase or decrease was observed in the mRNA expression level of IFN‐ß in all groups compared to the control group. The observed differences in protein amounts are thought to be due to the fact that mRNA molecules generally have a shorter half‐life compared to proteins, leading to quicker destruction of mRNA in the cell, while proteins can survive for a longer time (Maugeri et al. 2021) (Table 2).

CAPE can regulate inflammatory processes and reduce inflammation by either increasing the production of IFN‐ß or modulating immune system responses through IFN‐ß (Zhang et al. 2017). In our study, when examining the protein level of IFN‐ß, there was no statistically significant difference between the ICP0 applied group and the control group. However, an increase was observed in the ICP0 + CAPE group compared to both the control and ICP0 groups (p < 0.0001). These results demonstrated that ICP0 alone had no effect on IFN‐ß levels, but when applied in conjunction with CAPE, it increased IFN‐ß (Table 3; Figure 2).

Table 3.

mRNA expression levels of catenin‐β, IFN‐β, IFN‐γ, IRF 3, WNT.

ICP0 ICP0‐ACYCLOVİR ICP0‐CAPE ICP0‐CAPE‐ACYCLOVİR
Gene Expression P(H1) Result Expression P(H1) Result Expression P(H1) Result Expression P(H1) Result
GAPDH 1.000 1.000 1.000 1.000
Beta Catenin 15.841 0.001 UP 81.816 0.002 UP 24.961 0.004 UP 31.632 0.001 UP
IFN gamma 0.659 0.116 3.706 0.003 UP 2.219 0.092 0.516 0.328
IFN beta 0.797 0.675 1.636 0.524 2.428 0.310 1.616 0.441
IRF3 4.611 0.006 UP 30.379 0.014 UP 29.344 0.002 UP 29.909 0.000 UP
Wnt4 0.167 0.000 DOWN 1.799 0.156 1.100 0.815 1.143 0.652
Open in a new tab

Figure 2.

Figure 2

Open in a new tab

Alterations of Catenin‐β, IFN‐β, IFN‐γ, IRF 3, WNT protein levels for different study groups. C: Control, I: ICP0, I‐C: ICP0 and CAPE combination, I‐A: ICP0 and aciyclovir combination, I‐A‐C: ICP0, Acyclovir and CAPE combination.

Studies on the antiviral activity of CAPE suggest that it may provide protective effects against viral infections. This indicates that CAPE may bolster immune system responses to viral infections by increasing interferon‐beta production or via IFN‐ß (Karaaslan et al. 2021). In our study, consistent with literature data, CAPE increased IFN‐ß, which is promising for the early prevention and treatment of HSV‐1 and other viral infections (Table 3; Figure 2).

The effects of CAPE on the immune system may be mediated by modulating immune system responses through interferon‐beta. This may suggest that CAPE has the capacity to either enhance or suppress immune system responses by regulating immune system functions (Oršolić and Bašić 2007). In the study, the group administered ICP0 + CAPE + acyclovir; although the ICP0 + CAPE and ICP0 + acyclovir application groups are lower than the control group and higher than the control group, it shows that it can regulate immune modulation. Combination applications should be evaluated in detail with pharmacokinetic studies (I‐C‐A vs. I‐C p < 0.0001; I‐C‐A vs. I‐A p < 0.0001; C vs. I‐C‐A p:0.046) (Table 3; Figure 2).

In the study, a dramatic increase was observed in the ICP0 + acyclovir administered group compared to the other groups (p < 0.0001) (Table 3; Figure 2). Acyclovir is recognized as a potent antiviral agent against herpesviruses and, when used in combination with interferon‐beta (IFN‐β), it can more effectively inhibit virus replication (Drago et al. 2018). However, in HSV‐1 infections, high levels of IFN‐β can inhibit tissue repair processes by causing chronic inflammation, which can impair tissue regeneration and healing (Trinchieri 2010). Although the increase in IFN‐β with acyclovir is positive in terms of antiviral effect, its use in conjunction with CAPE should be evaluated as it may be disadvantageous in terms of the formation and healing of orofacial lesions in HG.

When examining the protein level of IFN‐γ, no statistically significant increase was observed between the control group and the ICP0 group (Table 3; Figure 2). It was suggested that the reason why ICP0 did not increase IFN‐γ was due to its ability to reduce the antiviral response. As mentioned in the literature, the ICP0 protein suppresses the transcription of genes induced by IFN‐γ, thereby reducing the effectiveness of the antiviral response, and this effect is achieved through the direct effects of ICP0 on transcription factors (Gu and Roizman 2003). In this context, it was deemed appropriate that there was no significant difference in the IFN‐γ mRNA expression level of the ICP0‐only group with the control group.

Significant increases were observed in the amounts of IFN‐γ protein in the ICP0 + CAPE, ICP0 + acyclovir, and ICP0 + CAPE + acyclovir administered groups when compared both to the control group and among themselves (Table 3; Figure 2).

In the study, while interferon‐gama mRNA expression was not statistically significant in the ICP0, ICP0 + CAPE, and ICP0 + CAPE + acyclovir applied groups, a threefold increase was observed in the ICP0 + acyclovir applied group (Table 2; Figures 3, 4, 5, 6). Acyclovir modulates the overall cytokine response by regulating IFN‐γ mRNA expression, thereby increasing the effectiveness of the immune system against the virus (Stanberry and Cunningham 2001). In this context, the threefold increase in the amount of IFN‐γ mRNA caused by acyclovir was found to be compatible with literature data (Table 2; Figures 3, 4, 5, 6).

The reason why mRNA expression levels are not statistically significant compared to protein amounts in the study can be explained by the fact that the degradation rates of mRNA and proteins may differ, and proteins are degraded slower than mRNA, resulting in a higher amount of protein in the cell than the amount of mRNA (Maugeri et al. 2021).

Upon evaluating the protein levels of IFN‐γ, the ICP0 + acyclovir group exhibited the highest increase (Table 3; Figure 2). Acyclovir can synergistically enhance its antiviral effects with IFN‐γ, which can more effectively suppress the replication of viruses such as herpesvirus (Roizman and Whitley 2013). However, having very high amounts of IFN‐γ has several disadvantages.

One of these is that excessive production of IFN‐γ can lead to long‐term persistence of the virus in host cells, increasing the incidence of recurrent infections (Teijaro et al. 2013). Another is that IFN‐γ can increase apoptosis of infected cells, which can increase tissue damage and necrosis, delaying healing at the site of infection (Belisle et al. 2002). In our study, although the amount of IFN‐γ in the ICP0 + CAPE + acyclovir group was found to be higher than the control and ICP0 applied groups, it was found at lower levels than the ICP0 + acyclovir group. This is promising, as the excessive amount of IFN‐γ caused by acyclovir can prevent the negative effects (Table 3; Figure 2). Although IFN‑γ is critical for mounting effective antiviral responses—activating macrophages, enhancing antigen presentation, and stimulating cytotoxic T‑cells—persistent or elevated IFN‑γ levels in chronic viral infections may paradoxically undermine treatment efficacy. Clinical data from chronic hepatitis C patients demonstrate that higher serum IFN‑γ levels during peginterferon‑ribavirin therapy were strongly associated with nonresponse and treatment failure (Lu et al. 2016). These findings imply that an already activated IFN pathway might diminish responsiveness to further immunostimulation and contribute to viral persistence. Thus, while the IFN‑γ increase observed in our study could bolster early antiviral defense, its long‐term regulation requires caution and further investigation.

Moreover, the potent antioxidant properties of CAPE can reduce oxidative stress caused by IFN‐γ and protect the health of cells (Lee et al. 2008). By inhibiting the production of inflammatory cytokines, CAPE can suppress inflammatory responses triggered by IFN‐γ and thus reduce tissue damage (Sud'ina et al. 1993). Another side outcome of CAPE use that is not among the project goals is that CAPE, when administered together with IFN‐γ, can induce apoptosis in cancer cells and thus be used as a potential therapeutic agent in cancer treatment (Chen et al. 2005). In the study, oncological studies should clarify what consequences the increased amount of IFN‐γ with the use of acyclovir will cause when used together with CAPE.

CAPE is known to enhance type I interferon responses by activating transcription factors such as IRF3 and suppressing NF‐κB activity (Yu et al. 2022). ICP0, on the other hand, is an immediate‐early HSV‐1 protein that promotes viral replication partly by degrading host antiviral proteins and inhibiting IRF3 activation. Therefore, CAPE may counteract ICP0‐mediated immune evasion by restoring IRF3 activity, leading to an antiviral cellular state.

In our current study, ICP0 alone did not significantly elevate IRF‑3 protein levels, consistent with its inhibitory role. However, co‑treatment with CAPE (which can modulate NF‑κB and IRF‑3 pathways) and acyclovir may counteract ICP0‐mediated suppression, leading to restored IRF‑3 expression and downstream IFN‑β and IFN‑γ production.

Additionally, the coadministration of acyclovir, which targets viral DNA polymerase, may synergize with CAPE by reducing viral replication while allowing the host immune system to mount a more effective interferon‐mediated response.

Acyclovir specifically targets HSV‑1 by being phosphorylated via viral thymidine kinase into acyclovir triphosphate, which then competitively inhibits viral DNA polymerase and causes premature DNA chain termination—leading to effective suppression of viral replication (DrugBank 2023). Recent reviews further highlight acyclovir's continued role as first‐line therapy for HSV infections, while also emphasizing the emergence of resistant strains and the necessity to combine it with agents that modulate host immunity to improve outcomes and prevent resistance (Schalkwijk 2022).

ICP0 inhibits the activation of IRF3, which in turn prevents the phosphorylation of IRF3 and its subsequent translocation to the nucleus, thereby inhibiting the expression of interferon‐inducing genes (Eidson et al. 2002). Upon examining the mRNA expression levels of IRF3 resulting from the applications in the study, a fourfold increase (p: 0.006) was observed in the ICP0 applied group, a thirtyfold increase (p: 0.014) in the ICP0 + acyclovir applied group, and a 29‐fold increase (p: 0.002) in both the ICP0 + CAPE applied group and the ICP0 + CAPE+ acyclovir applied group. However, when we examined the protein levels, no statistically significant difference was found between the ICP0 group and the control group (p:0.7491) (Table 2; Figures 3, 4, 5, 6). Therefore, the absence of significant increases in IRF3 amounts in the ICP0 applied group indicates that the study results are consistent with literature data (Table 2; Figure 6). In studies, HSV‐1 ICP0 has been shown to promote the degradation of IRF3 through the proteasome pathway. This reduces the amount of IRF3 in the cell and is reported to suppress the interferon response (Lin et al. 2004). It is encouraging that when ICP0 was applied together with CAPE, the amount of IRF3 increased, both in terms of mRNA expression and protein amount, and in our study, it increased IFN‐γ and IFN‐ß in a compatible manner (Table 2, 3; Figures 2, 4). When ICP0+acyclovir was applied, the amount of IRF3 increased dramatically compared to the other groups (p:0.0001), while in the combination of ICP0 + CAPE + acyclovir, the amount of IRF3 increased moderately compared to the control group (p:0.046) (Table 3; Figure 2).

A high amount of IRF3 can promote cell death by increasing the expression of proapoptotic genes, which aids in the elimination of virus‐infected cells. However, excessive cell death can lead to tissue damage (Chattopadhyay et al. 2011). Therefore, in the study, CAPE has the potential to reduce the negative effects that acyclovir may cause in its treatment of HSV‐1 infection (Figure 2). In acyclovir treatment, the use of acyclovir with lower doses of CAPE should be supported by additional studies.

In a study, it was reported that ICP0 inhibits the production of interferon following the activation of IRF‐3 and suppresses the production of interferon induced by activation after SeV (Sendai virus) infection with HSV‐1 infection. Furthermore, it was noted that the presence of ICP0 leads to the degradation of activated IRF‐3 after SeV infection and prevents its effective accumulation in the nucleus of infected cells (Lin et al. 2004; Eidson et al. 2002; Melroe et al. 2007). An additional outcome of the project, not among the primary goals, is that the use of CAPE or its combination with various antimicrobials can enhance IRF‐3‐mediated interferon production.

HSV‐1 ICP0 may decrease beta‐catenin protein stability. ICP0 can reduce its intracellular levels by promoting beta‐catenin degradation via the proteasome (Gupta et al. 2007). ICP0 can lead to the inhibition of the Wnt/beta‐catenin signaling pathway. Reduced beta‐catenin levels may result in diminished activity of the Wnt signaling pathway, which in turn impacts cell proliferation and differentiation (Gupta et al. 2007). In the study, when beta‐catenin mRNA expression levels were examined, an increase was observed in all groups, with the ICP0 + acyclovir group showing a dramatic 81‐fold increase (Table 2; Figure 3). literature suggests that changes in beta‐catenin levels are associated with cancer development, and the effect of ICP0 on beta‐catenin may influence cell proliferation and tumor formation (Gupta et al. 2007). The 31‐fold increase observed in the combination of ICP0 + CAPE + acyclovir once again demonstrates that CAPE can normalize the negative effects of acyclovir (Table 2; Figure 5). When protein levels were examined, no statistically significant difference was observed between the control and ICP0 groups, while results consistent with mRNA expression levels were observed in the other groups (Table 3; Figure 2).

Studies have shown that Wnt4 plays a crucial role in tissue regeneration and repair. In inflammatory conditions such as gingival stomatitis, increased Wnt4 signaling can expedite tissue healing (Nusse 2008). Wnt4 is effective in cell proliferation and differentiation. This property may promote the regeneration of gingival epithelial cells and support the healing process of stomatitis (Logan and Nusse 2004). In this context, the increase in the amount of Wnt 4 in the ICP0 + CAPE group compared to the control suggests that CAPE may be a potential treatment for herpes caused by HSV‐1 (Table 3; Figure 2).

Numerous studies in the literature have demonstrated that ICP0 can inhibit IRF‐3‐regulated transcription, thereby reducing host interferon production and weakening the innate immune response (Lin et al. 2004; Eidson et al. 2002; Melroe et al. 2007). By decreasing the amount and activity of IRF3, ICP0 reduces the overall effectiveness of the cellular interferon response. This assists the virus in evading the immune system and replicating more effectively (Melroe et al. 2007). The ICP0 protein of HSV‐1 can attenuate cellular antiviral responses by suppressing the IFN‐γ signaling pathway. ICP0 reduces the effectiveness of IFN‐γ by degrading proteins that regulate interferon responses (Everett and Chelbi‐Alix 2007). ICP0 facilitates virus replication and spread by weakening intracellular antiviral defense mechanisms. By reducing the activity of IFN‐γ, ICP0 enables the virus to escape the immune system (Everett 2000). ICP0 inhibits the antiviral response of host cells by inhibiting the production of IFN‐γ. This inhibition assists the virus in evading the immune system and developing chronic infections (Paladino et al. 2010). ICP0 modulates the immune response triggered by IFN‐γ and thereby increases viral persistence. This modulation depends on the ability of ICP0 to interact with immune regulatory proteins (Van Lint et al. 2010). Another way the virus blocks the transcription of IFN‐ß is by inhibiting the activity of interferon regulatory factor‐3 (IRF‐3). Functional IRF‐3 is required for transcription of infection‐induced interferon (Yeow et al. 2000). “HSV‐1 ICP0 can affect cells' production of IFN‐gamma and IFN‐beta by modulating intracellular immune responses (Zhu et al. 2009), which may increase virus replication” (Smith and Jones 2010). “ICP0, which inhibits the antiviral effects of IFN‐beta, allows cells to support virus replication” (Li and Wang 2012).

In accordance with the data obtained in our project, the use of CAPE in combination with acyclovir should be evaluated in further studies. This is to mitigate both the adverse effects caused by the HSV‐1 ICP0 protein and the potential undesirable effects that may be caused by the acyclovir used in treatment.

Research has primarily focused on IC50 doses. The impacts of lower or higher doses have not been studied; hence, the dose–response relationship must be investigated in detail. In the study, applications were conducted for only 24 h. Long‐term effects and potential side effects have not been studied. The pharmacokinetic and pharmacodynamic profiles of ICP0, CAPE, and acyclovir combinations have not been thoroughly examined.

This study is important as it examines the effects of the ICP0 protein on the immune response in HSV‐1 infection and the modulatory roles of CAPE and acyclovir on this interaction at the molecular level. The evaluation of both gene expression and protein levels in the HGF‐1 cell line provided valuable data on the mechanisms of drug interactions. However, the study has some limitations. First, only a single dose and a single treatment duration (24 h) were assessed; analyses at different doses and time points would allow a better understanding of dose–response relationships and time‐dependent effects. Second, although prolonged IFN‐γ exposure has been reported in the literature to be associated with viral resistance, this was not directly tested in the current study. In the future, validating these findings across different doses, time intervals, various cell models, and in vivo systems will help to comprehensively understand the potential synergistic effects of CAPE and acyclovir in HSV‐1 treatment.

11. Conclusions

This study provides valuable insights into the effects of acyclovir, CAPE, and the HSV‐1 ICP0 protein on immune responses in human gingival fibroblasts. The findings highlight that while acyclovir remains a potent antiviral agent, its combination with CAPE could offer a promising approach to modulate immune responses and mitigate some of the adverse effects associated with viral infections and treatments.

The IC50 values determined for acyclovir, CAPE, and ICP0 are novel contributions to the literature, offering a baseline for future studies. The observed effects on IFN‐β, IFN‐γ, IRF3, and Wnt signaling pathways underscore the complex interactions between antiviral agents and the immune system. Notably, CAPE demonstrated a potential to enhance interferon responses while simultaneously mitigating excessive immune activation, which could be crucial in preventing chronic inflammation and tissue damage during HSV‐1 infections.

The study also raises important considerations for the use of these agents in combination therapy. The modulation of immune responses by CAPE, particularly its ability to normalize the negative effects of acyclovir on IRF3 and beta‐catenin, suggests that CAPE could be a valuable adjunct in treating HG and possibly other viral infections. However, the potential for high interferon levels to impair tissue repair and the risks of chronic inflammation must be carefully managed.

Future research should focus on exploring the dose–response relationships, long‐term effects, and pharmacokinetic profiles of these combinations. Additionally, understanding the broader implications of these findings, particularly in the context of chronic infections and cancer, could open new avenues for therapeutic interventions.

Overall, this study emphasizes the importance of combination therapies in managing viral infections and highlights CAPE's potential to enhance treatment outcomes while minimizing side effects. Further investigations are necessary to fully realize the therapeutic potential of these findings.

Author Contributions

Concept: Merve Sen. Design: Merve Sen. Data collection or processing: Merve Sen, Sefa Celik. Analysis or interpretation: Merve Sen, Sefa Celik. Literature search: Merve Sen, Sefa Celik. Writing: Merve Sen.

Ethics Statement

Ethics approval for all experimental procedures was obtained from the Afyonkarahisar Health Sciences University Clinical Research Ethics Committee (Committee Code: 2011‐KAEK‐2, Decision No: 2022/6, Date: 13.05.2022). The experimental phase of the study was carried out at the Department of Medical Biochemistry, Faculty of Medicine, Afyonkarahisar Health Sciences University.

Consent

The authors have nothing to report.

Conflicts of Interest

The authors confirm that there are no financial interests or personal relationships that could have influenced the work presented in this paper.

Acknowledgments

We gratefully acknowledge the Enago editing team for their help in refining and formatting this manuscript to align with the journal's standards. The authors also express their thanks to the Afyonkarahisar Health Sciences University Scientific Research Projects Coordination Unit for their financial support, provided under project number 22.GENEL.029. The authors declare no competing interests associated with this article. This study was supported by Afyonkarahisar Health Sciences University Scientific Research Projects Coordination Unit under project number 22.GENEL.029. The funding source had no involvement in the study's design, data collection, analysis, interpretation, or in the creation of this manuscript.

Data Availability Statement

The datasets utilized and/or analyzed in this study will be made available by the corresponding author upon reasonable request.

References

  1. Amir, J. , Nussinovitch M., Kleper R., Cohen H. A., and Varsano I.. 1997. “Primary Herpes Simplex Virus Type 1 Gingivostomatitis in Pediatric Personnel.” Infection 25, no. 5 (September/October): 310–312. 10.1007/BF01714472. [DOI] [PubMed] [Google Scholar]
  2. Andrei, G. , Georgala A., Topalis D., et al. 2013. “Heterogeneity and Evolution of Thymidine Kinase and DNA Polymerase Mutants of Herpes Simplex Virus Type 1: Implications for Antiviral Therapy.” Journal of Infectious Diseases 207, no. 8 (April): 1295–1305. 10.1093/infdis/jit034. [DOI] [PubMed] [Google Scholar]
  3. Arduino, P. G. , and Porter S. R.. 2008. “Herpes Simplex Virus Type 1 Infection: Overview on Relevant Clinico‐Pathological Features.” Journal of Oral Pathology & Medicine 37, no. 2: 107–121. 10.1111/j.1600-0714.2007.00587.x. [DOI] [PubMed] [Google Scholar]
  4. Bacon, T. H. , Levin M. J., Leary J. J., Sarisky R. T., and Sutton D.. 2003. “Herpes Simplex Virus Resistance to Acyclovir and Penciclovir After Two Decades of Antiviral Therapy.” Clinical Microbiology Reviews 16, no. 1: 114–128. 10.1128/CMR.16.1.114-128.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Belisle, S. E. , Larché M., and Kourilsky P.. 2002. “Apoptotic Cell Death and the Immune System.” Immunity 17, no. 2 (August): 167–178. 10.1016/S1074-7613(02)00355-0.12196288 [DOI] [Google Scholar]
  6. Chattopadhyay, S. , Yamashita M., Zhang Y., and Sen G. C.. 2011. “The IRF‐3/Bax‐mediated Apoptotic Pathway, Activated by Viral Cytoplasmic RNA and DNA, Inhibits Virus Replication.” Journal of Virology 85, no. 8 (April): 3708–3716. 10.1128/JVI.01964-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen, M. F. , Keng P. C., Lin P. Y., and Yang C. T.. 2005. “Caffeic Acid Phenethyl Ester Induces Apoptosis of C6 Glioma Cells: Involvement of NF‐κB and Bcl‐2–Downregulation.” Carcinogenesis 26, no. 2 (February): 251–258. 10.1093/carcin/bgh323. [DOI] [Google Scholar]
  8. Drago, F. , Cogorno L., Broccolo F., Ciccarese G., and Parodi A.. 2018. “Acyclovir: Pharmacology and Clinical Experience 30 Years Later.” Expert Opinion on Pharmacotherapy 19, no. 12 (August): 1319–1337. 10.1080/14656566.2018.1504975. [DOI] [Google Scholar]
  9. Drayman, N. , Patel P., Vistain L., and Tay S.. 2019. “HSV‐1 Single‐Cell Analysis Reveals the Activation of Anti‐Viral and Developmental Programs in Distinct Sub‐Populations.” eLife 8 (April 5): e46339. 10.7554/eLife.46339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dremel, S. E. , and DeLuca N. A.. 2019. “Herpes Simplex Viral Nucleoprotein Structures in the Infected Cell Nucleus.” Journal of Virology 93, no. 11: e00450‐19. 10.1128/JVI.00450-19. [DOI] [Google Scholar]
  11. DrugBank (2023). Acyclovir: Mechanism of Action. Retrieved From DrugBank Database.
  12. Eidson, K. M. , Hobbs W. E., Manning B. J., Carlson P., and DeLuca N. A.. 2002. “Expression of Herpes Simplex Virus ICP0 Inhibits the Induction of Interferon‐Stimulated Genes by Viral Infection.” Journal of Virology 76, no. 5 (March): 2180–2191. 10.1128/jvi.76.5.2180-2191.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Everett, R. D. 2000. “ICP0, a Regulator of Herpes Simplex Virus During Lytic and Latent Infection.” BioEssays 22, no. 8 (August): 761–770. . [DOI] [PubMed] [Google Scholar]
  14. Everett, R. D. , and Chelbi‐Alix M. K.. 2007. “PML and PML Nuclear Bodies: Implications in Antiviral Defence.” Biochimie 89, no. 6–7: 819–830. 10.1016/j.biochi.2007.01.004. [DOI] [PubMed] [Google Scholar]
  15. Everett, R. D. , and Murray J.. 2005. “ND10 Components Relocate to Sites Associated With Herpes Simplex Virus Type 1 Nucleoprotein Complexes During Virus Infection.” Journal of Virology 79, no. 8: 5078–5089. 10.1128/JVI.79.8.5078-5089.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gu, H. , and Roizman B.. 2003. “The Degradation of Promyelocytic Leukemia and Sp100 Proteins by Herpes Simplex Virus 1 Correlates With the Loss of Nuclear Domain 10 Integrity and Is Mediated by the Ubiquitin‐Proteasome Pathway.” Journal of Virology 77, no. 14 (July): 8258–8268. 10.1128/JVI.77.14.8258-8268.2003. [DOI] [Google Scholar]
  17. Gupta, R. , Warren T., and Wald A.. 2007. “Genital Herpes.” Lancet 370, no. 9605 (December 22): 2127–2137. 10.1016/S0140-6736(07)61908-4. [DOI] [PubMed] [Google Scholar]
  18. Harle, P. P. , Sarkar D., and Fisher P. B.. 2006. “Mechanisms of Virus‐Mediated Interference With Interferon Regulatory Factor‐3 Activation.” Viral Immunology 19, no. 4: 700–713. 10.1089/vim.2006.19.700. [DOI] [Google Scholar]
  19. Heliotis, S. , Paterson A., Aitchison T., et al. 2021. “Herpetic Gingivostomatitis: Clinical Features and Management.” Journal of Oral Pathology & Medicine 50, no. 3 (March): 261–268. 10.1111/jop.13095.33733532 [DOI] [Google Scholar]
  20. Karaaslan, C. , Suzek H., Bakır T., et al. 2021. “Caffeic Acid Phenethyl Ester (CAPE) Inhibits Herpes Simplex Virus Type 1 Infection by Modulating Host Cell Antiviral Response.” Journal of Ethnopharmacology 267 (February 10): 113614. 10.1016/j.jep.2020.113614. [DOI] [Google Scholar]
  21. Kolokotronis, A. , and Doumas S.. 2006. “Herpetic Gingivostomatitis: Clinical Features and Management.” Journal of Oral Pathology & Medicine 35, no. 5 (May): 289–295. 10.1111/j.1600-0714.2006.00486.x. [DOI] [Google Scholar]
  22. Kurek‐Górecka, A. , Kłósek M., Pietsz G., et al. 2023. “The Phenolic Profile and Anti‐Inflammatory Effect of Ethanolic Extract of Polish Propolis on Activated Human Gingival Fibroblasts‐1 Cell Line.” Molecules 27, no. 24: 8811. 10.3390/molecules27248811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lee, S. H. , Cekanova M., and Baek S. J.. 2008. “Multiple Mechanisms Are Involved in 6‐ Gingerol‐Induced Cell Growth Arrest and Apoptosis in Human Colorectal Cancer Cells.” Molecular Carcinogenesis 47, no. 3 (March): 197–208. 10.1002/mc.20395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Li, X. , and Dai D.. 2015. “The Role of Wnt Signaling Pathway in the Regulation of Virus Infection.” Emerging Microbes & Infections 4, no. 1: e64. 10.1038/emi.2015.64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Li, Y. , and Wang L.. 2012. “HSV‐1 ICP0: A Viral E3 Ubiquitin Ligase That Antagonizes the Host Antiviral Interferon Response.” Frontiers in Microbiology 3: 97. 10.3389/fmicb.2012.00097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lin, R. , Noyce R. S., Collins S. E., Everett R. D., and Mossman K. L.. 2004. “The Herpes Simplex Virus ICP0 RING Finger Domain Inhibits IRF3‐ and IRF7‐Mediated Activation of Interferon‐Stimulated Genes.” Journal of Virology 78, no. 21 (November): 11671–11684. 10.1128/jvi.78.21.11671-11684.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Van Lint, A. L. , Murawski M. R., Goodbody R. E., et al. 2010. “Herpes Simplex Virus Immediate‐Early ICP0 Protein Inhibits Toll‐Like Receptor 2‐Dependent Inflammatory Responses and NF‐κB Signaling.” Journal of Virology 84, no. 20: 10802–10811. 10.1128/jvi.01255-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Logan, C. Y. , and Nusse R.. 2004. “The Wnt Signaling Pathway in Development and Disease.” Annual Review of Cell and Developmental Biology 20: 781–810. 10.1146/annurev.cellbio.20.010403.113126. [DOI] [PubMed] [Google Scholar]
  29. Lu, M.‐Y. , Huang C.‐I., Dai C.‐Y., et al. 2016. “Elevated On‐Treatment Levels of Serum IFN‐Gamma Is Associated With Treatment Failure of Peginterferon Plus Ribavirin Therapy for Chronic Hepatitis C.” Scientific Reports 6: 22995. 10.1038/srep22995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Maugeri, M. , Bonaventura G., and Di Silvestre D.. 2021. “Regulation of mRNA and Protein Stability in Gene Expression Control: Recent Advances and Future Perspectives.” International Journal of Molecular Sciences 22, no. 13: 7081. 10.3390/ijms22137081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Melroe, G. T. , Silva L., Schaffer P. A., and Knipe D. M.. 2007. “Recruitment of Activated IRF‐3 and CBP/p300 to Herpes Simplex Virus ICP0 Nuclear Foci: Potential Role in Blocking IFN‐β Induction.” Virology 360, no. 2: 305–321. 10.1016/j.virol.2006.10.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Mohan, R. , Ramesh A., Jayakumar N. D., et al. 2013. “Herpetic Gingivostomatitis.” Journal of Indian Society of Pedodontics and Preventive Dentistry 31, no. 4: 258–260. 10.4103/0970-4388.121833. [DOI] [Google Scholar]
  33. Mossman, K. L. , and Smiley J. R.. 2002. “Herpes Simplex Virus ICP0 and ICP34.5 Counteract Distinct Interferon‐Induced Barriers to Virus Replication.” Journal of Virology 76, no. 19 (October): 995–1002. 10.1128/jvi.76.19.995-1002.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Nusse, R. 2008. “Wnt Signaling and Stem Cell Control.” Cell Research 18, no. 5: 523–527. 10.1038/cr.2008.47. [DOI] [PubMed] [Google Scholar]
  35. Nusse, R. , and Varmus H.. 2012. “Three Decades of Wnts: A Personal Perspective on How a Scientific Field Developed.” EMBO Journal 31, no. 12: 2670–2684. 10.1038/emboj.2012.146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Opstelten, W. , Neven A. K., and Eekhof J.. 2008. “Treatment and Prevention of Herpes Labialis.” Canadian Family Physician 54, no. 8 (August): 1258–1264. [PMC free article] [PubMed] [Google Scholar]
  37. Orban, A. , Nemeth J., Toth A., et al. 2015. “Cape Ameliorates Acute Immune and Inflammatory Responses: Potential Therapeutic Applications.” Journal of Pharmacology and Experimental Therapeutics 352, no. 1 (January): 77–88. 10.1124/jpet.114.218305.25347994 [DOI] [Google Scholar]
  38. Oršolić, N. , and Bašić I.. 2007. “Immunomodulation by Water‐Soluble Derivative of Propolis: A Factor of Antitumor Reactivity.” Journal of Ethnopharmacology 113, no. 1 (October 1): 76–84. 10.1016/j.jep.2007.06.016. [DOI] [PubMed] [Google Scholar]
  39. Paladino, P. , Collins S. E., and Mossman K. L.. 2010. “Cellular Localization of Herpes Simplex Virus ICP0 Protein Dictates Its Ability to Block IRF3‐Mediated Antiviral Response.” Journal of Virology 84, no. 20: 10655–10663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Roizman, B. , and Whitley R. J.. 2013. “The Nine Ages of Herpes Simplex Virus.” Herpes 20, no. 1 (March): 17. [PubMed] [Google Scholar]
  41. Schalkwijk, H. H. , et al. (2022). A Review of Acyclovir Resistance in Herpes Simplex Viruses: Mechanisms, Prevalence, and Management. Biochemical Pharmacology. Advance online publication. 10.1016/j.bcp.2022.115223. [DOI] [PubMed]
  42. Sen, N. , Che X., Rajamani J., et al. 2013. “Signal Transduction During Herpes Simplex Virus Entry into Cells.” Molecular Biology Reports 40, no. 6 (June): 3691–3697. 10.1007/s11033-012-2465-5. [DOI] [Google Scholar]
  43. Smith, J. , and Jones A.. 2010. “Modulation of Immune Responses by Herpes Simplex Virus Type 1: Role of ICP0 in Regulating IFN‐Gamma Signaling.” Virology 400, no. 1: 70–79. 10.1016/j.virol.2010.01.014. [DOI] [Google Scholar]
  44. Spruance, S. L. , and Kriesel J. D.. 2002. “Treatment of Herpes Simplex Labialis.” Herpes: The Journal of the IHMF 9, no. 3: 64–69. [PubMed] [Google Scholar]
  45. Stanberry, L. R. , and Cunningham A. L.. 2001. “Herpes Simplex Viruses.” In Fields Virology, edited by Knipe D. M. and Howley P. M., (4th ed.). Lippincott Williams & Wilkins. [Google Scholar]
  46. Sud'ina, G. F. , Mirzoeva O. K., Pushkareva M. A., Korshunova G. A., Sumbatyan N. V., and Varfolomeev S. D.. 1993. “Caffeic Acid Phenethyl Ester as a Lipoxygenase Inhibitor With Antioxidant Properties.” FEBS Letters 329, no. 1–2 (August 16): 21–24. 10.1016/0014-5793(93)80139-e. [DOI] [PubMed] [Google Scholar]
  47. Teijaro, J. R. , Ng C., Lee A. M., et al. 2013. “Persistent LCMV Infection Is Controlled by Blockade of Type I Interferon Signaling.” Science 340, no. 6128 (May 10): 207–211. 10.1126/science.1235214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Trinchieri, G. 2010. “Type I Interferon: Friend or Foe?” Journal of Experimental Medicine 207, no. 10 (October 25): 2053–2063. 10.1084/jem.20101664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Yeow, W. S. , Au W. C., Juang Y. T., et al. 2000. “Reconstitution of Virus‐Mediated Expression of Interferon α/β Genes: Template Requirements and Induction by Virus‐Activated Signaling Pathways.” Journal of Virology 74, no. 18 (September): 8305–8313. [Google Scholar]
  50. Yu, C. , Wang D., Yang Z., and Wang T.. 2022. “Pharmacological Effects of Polyphenol Phytochemicals on the Intestinal Inflammation Via Targeting TLR4/NF‐κB Signaling Pathway.” International Journal of Molecular Sciences 23, no. 13: 6939. 10.3390/ijms23136939. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zhang, Y. , Liu X., Zuo T., et al. 2017) February. “Caffeic Acid Phenethyl Ester Inhibits Herpes Simplex Virus Type 1‐Induced Corneal Inflammation and Reduces the Expression of Matrix Metalloproteinases in a Mouse Model.” Antiviral Research 137: 33–41. 10.1016/j.antiviral.2016.11.020. [DOI] [Google Scholar]
  52. Zhu, J. , Huang X., and Yang Y.. 2009. “Innate Immune Response to HSV‐1 Infection: Triggers, Signaling Pathways, and Significance in Antiviral Immunity.” Journal of Biomedical Science 16: 70. 10.1186/1423-0127-16-70. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets utilized and/or analyzed in this study will be made available by the corresponding author upon reasonable request.

Articles from MicrobiologyOpen are provided here courtesy of Wiley

RESOURCES