Abstract
Although silver pomfret (Pampus argenteus) is a highly valued marine fish in China, its aquaculture development is limited by the lack of species‐specific formulated feed. This study investigated the effects of replacing fishmeal with Antarctic krill (Euphausia superba) meal (AKM) on the nutritional deposition, metabolism, and immune response of silver pomfret. Juvenile fish with an initial body weight of 12.93 ± 0.48 g were randomly allocated into four dietary treatments with three replicates per treatment (50 fish per tank; 600 fish in total), and fed one of four experimental diets containing 0% (FM), 10% (KM10), 20% (KM20), or 40% (KM40) AKM for a 60‐day feeding trial. The results showed that moderate AKM inclusion, particularly at the 20% replacement genes (pparα, cpt1α) and the downregulation of lipid level significantly enhanced intestinal trypsin and lipase activities, as well as glucose and amino acid metabolic capacity. In addition, lipid utilization efficiency was improved through the upregulation of fatty acid oxidation‐related genes (fas). Consequently, the KM20 group exhibited significantly higher muscle essential amino acids and polyunsaturated fatty acids, particularly eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), compared to the FM group (p < 0.05). Furthermore, serum immunoglobulin M (IgM), complement C3, and C4 levels increased in AKM‐fed groups, with KM20 showing the most pronounced enhancement. However, excessive substitution (KM40) led to a decline in certain nutritional and immune parameters, suggesting potential metabolic imbalances. These findings indicate that moderate replacement of fishmeal with AKM (~20%) optimizes nutrient deposition, enhances metabolic efficiency, and boosts immune capacity in silver pomfret. This study provides a theoretical basis for the development of functional aquafeeds aimed at promoting the sustainable and efficient industrial cultivation of silver pomfret.
Keywords: Antarctic krill meal, immune ability, lipid metabolism, nutritional composition, Pampus argenteus
1. Introduction
Silver pomfret (Pampus argenteus) is an economically important marine species widely distributed along the coastal waters of China, with high market value due to its favorable flesh quality. However, the intensification of fishing efforts and the deterioration of marine ecosystems have led to a substantial decline in wild populations, raising serious concerns about resource depletion [1]. To alleviate pressure on wild stocks and ensure a stable market supply, the development of artificial breeding and aquaculture technologies has become a critical strategy. In recent years, significant advancements have been achieved in larval rearing, feeding management, and water quality control, which have collectively enhanced the success of silver pomfret aquaculture [2–7]. Despite these advancements, the industrial‐scale cultivation of silver pomfret still faces several challenges, with the lack of specialized compound feeds remaining a major bottleneck. At present, fishmeal serves as the primary protein source in commercial aquafeeds. However, due to the increasing demand and finite availability of global fishery resources, fishmeal has become a limiting factor for the sustainable growth of the aquaculture industry [8].
In this context, identifying resource‐rich and nutritionally suitable alternative protein sources to partially or fully replace fishmeal is essential for promoting sustainable and efficient aquaculture practices. Antarctic krill (Euphausia superba), the most abundant animal protein resource in the world, has garnered attention as a promising alternative due to its rich content of high‐quality protein, astaxanthin, phospholipids, and polyunsaturated fatty acids [9, 10]. Recent studies have demonstrated the beneficial effects of incorporating Antarctic krill meal (AKM) in the diets of various aquaculture species, including enhanced growth performance, improved feed utilization, and modulation of lipid metabolism in European seabass (Dicentrarchus labrax) [11], oriental river prawn (Macrobrachium nipponense) [12], olive flounder (Paralichthys olivaceus) [13], and large yellow croaker (Larimichthys crocea) [14].
However, the efficiency of AKM varies among aquatic animals, and its effectiveness in replacing fishmeal is still being determined for many species [11, 15]. Specifically, a comprehensive assessment of the impact of AKM on silver pomfret is still incomplete, and its exact mechanism of action remains unclear. In our previous study, dietary supplementation with AKM significantly enhanced the growth performance of juvenile silver pomfret, as evidenced by higher weight gain rate (WG) and specific growth rate (SGR) compared with the control diet. No significant differences in WG or SGR were observed among diets containing different levels of AKM. Moreover, diets associated with superior growth performance exhibited lower feed conversion ratios (FCR), with the control group showing the highest FCR, which was significantly higher than those of the 20% and 40% AKM groups, while survival rate did not differ significantly among dietary treatments [16]. Building on these findings, the present study, using the same feeding trial as our previous study, focuses on elucidating the effects of graded AKM substitution levels on proximate composition, immune responses, lipid metabolism, and related gene expression in silver pomfret. By linking growth performance with metabolic and immunological responses, this study aims to determine the optimal inclusion level of AKM in silver pomfret diets and to provide a scientific basis for improving feed formulation toward more efficient and sustainable aquaculture.
2. Materials and Methods
2.1. Experimental Diets
The AKM, produced from Antarctic krill, was supplied by China National Fisheries Corp. (Beijing, China). According to the manufacturer’s specification, the AKM was processed by low‐temperature drying and used as a whole‐fat krill meal. The proximate compositions of the krill meal and fish meal are presented in Table 1. Four isonitrogenous and isolipidic diets were formulated by partially replacing fishmeal with AKM at inclusion levels of 0% (FM), 10% (KM10), 20% (KM20), and 40% (KM40). The FM group served as the control, while KM10, KM20, and KM40 were the experimental groups. All dry ingredients were accurately weighed according to the formulation, sieved, oven‐dried, and thoroughly mixed. Fish oils and enzyme preparations were then added, followed by wet mixing to ensure uniform oil coating on the particle surface. The mixtures were pelleted using a twin‐screw extruder, with extrusion temperatures maintained at 85–95°C to ensure a protein digestibility of not less than 85%. After extrusion, pellets were cooled to room temperature and sprayed with antioxidants and probiotics. Final moisture content was controlled below 8%. The diets were then packaged and stored in a cool, dry place until use. Detailed ingredient composition and nutritional profiles of the diets, including proximate composition, can be found in Yang et al. [16].
Table 1.
Composition of the krill meal and fish meal (% dry matter).
| Item | Fish meal | Krill meal |
|---|---|---|
| Crude protein | 69.28 ± 1.25 | 69.01 ± 1.75 |
| Crude lipid | 9.11 ± 0.58a | 4.69 ± 0.41b |
| Crude ash | 17.91 ± 1.23a | 12.76 ± 1.78b |
Note: Values are expressed as mean ± SD (n = 3). Different superscript letters within the same row indicate significant differences (p < 0.05).
2.2. Fish and Rearing Conditions
Juvenile silver pomfret with an initial average weight of 12.93 ± 0.48 g were obtained from the Fujian Fuding Research Center, East China Sea Fisheries Research Institute. A total of 600 healthy fish were randomly distributed into 12 fiberglass tanks (circumference: 4 m; depth: 1.6 m) in a completely randomized design, with three replicates per treatment and 50 fish per tank. Fish were fed twice daily at 8:00 and 16:00 to apparent satiation. The amount of feed offered was recorded daily throughout the feeding trial. The feeding trial was conducted in indoor tanks operated as a static system with a partial daily water exchange rate of 30%–50%. Water quality parameters were maintained throughout the 60‐day feeding trial. Water temperature was maintained at 25–27°C, salinity at 26–28‰, and dissolved oxygen above 7 mg/L. The pH ranged from 7.8 to 8.2, ammonia nitrogen remained below 0.03 mg/L, and nitrite levels were maintained below 0.05 mg/L. Fish were maintained under natural photoperiod conditions throughout the feeding trial without additional light manipulation.
2.3. Sample Collection
At the conclusion of the feeding trial, fish were fasted for 12 h. Three fish with intact scales and good health status were randomly selected from each tank and anesthetized with 75 mg/L tricaine methanesulfonate (MS‑222, Canton, Shanghai, China), a dosage based on previously published studies in silver pomfret [17]. Blood was drawn from the caudal vein using sterile syringes and left to clot at 4°C for 2 h, followed by centrifugation at 2000×g for 10 min at 4°C. The resulting serum was stored at −80°C for subsequent analyses. Muscle, liver, intestine, and kidney tissues were excised, snap‐frozen in liquid nitrogen, and stored at −80°C for biochemical and molecular analyses.
2.4. Biochemical and Immunological Analyses
Tissue samples (0.1 g) were homogenized in 0.9 mL of physiological saline on ice, followed by centrifugation at 13,000×g for 10 min at 4°C. The supernatants were collected for analysis. All assays were performed using three biological replicates and three technical replicates. The activities of glutamic‐pyruvic transaminase (GPT) and glutamic‐oxaloacetic transaminase (GOT), as well as the levels of glucose (GLU) and lactic acid (LD), were measured in liver, serum, muscle, and kidney tissues. The contents of immunoglobulin M (IgM) and complement components C3 and C4 were determined in serum. Additionally, the activities of lipase, trypsin, and alpha‐amylase were assessed in intestinal tissues. All the above measurements were conducted using commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) following the manufacturer’s protocols.
2.5. Nutritional Composition Analysis
The proximate composition of muscle tissue was determined following AOAC [18] standard methods. Moisture content was measured using the constant weight method, wherein muscle samples were dried at 105°C until a constant weight was achieved. Crude protein content was analyzed using the Kjeldahl method. Samples were digested with a mixed solution of concentrated sulfuric acid and catalyst, and nitrogen content was quantified using an automatic Kjeldahl nitrogen analyzer (Kjeltec 8400, FOSS, Hillerød, Denmark). Protein content was calculated using a nitrogen‐to‐protein conversion factor of 6.25. Crude fat content was determined via the acid hydrolysis–Soxhlet extraction method, where samples underwent acid hydrolysis followed by extraction with petroleum ether. The solvent was then recovered, and the extract was dried and weighed to determine lipid content. Ash content was measured by incinerating samples in a muffle furnace at 550°C until a constant weight was obtained.
Total lipids were extracted from 0.5 g of lyophilized muscle tissue using the Folch method [19] and subsequently methylated with 14% boron trifluoride/methanol (BF3/MeOH). Fatty acid methyl esters (FAMEs) were analyzed using gas chromatography (Agilent 7890A, Agilent Technologies, Santa Clara, CA, USA) equipped with a DB‐23 column (60 m × 0.25 mm × 0.25 μm). The oven temperature was programed as follows: initial hold at 50°C for 1 min, ramped to 175°C at 30°C/min, then to 215°C at 1°C/min, and finally to 230°C at 2°C/min with a final hold of 10 min. Identification and quantification of fatty acids were performed by comparing retention times with those of known standards.
Amino acid composition in muscle tissue was analyzed using high‐performance liquid chromatography (HPLC). Muscle samples (0.1 g) were hydrolyzed in 6 mol/L hydrochloric acid (HCl) at 110°C for 24 h [20]. The hydrolysates were concentrated by rotary evaporation, neutralized, derivatized, and separated on a C18 reversed‐phase column (4.6 mm × 250 mm, 5 μm; Agilent Technologies, Santa Clara, CA, USA) using an Agilent 1260 Infinity HPLC system equipped with an OPA/FMOC derivatization module. The mobile phase A consisted of 40 mmol/L phosphate buffer (pH 7.8), while mobile phase B was a mixture of acetonitrile, methanol, and water (45:45: 10, v/v/v). Gradient elution was performed at a flow rate of 1.0 mL/min with the column maintained at 40°C. Detection wavelengths were set at 338 nm for OPA derivatives and 262 nm for FMOC derivatives. Amino acids were quantified using external calibration standards.
2.6. Expression Analysis of Lipid Metabolism‐Related Genes
Total RNA was extracted from liver tissue using an RNA extraction kit (TaKaRa, Shiga, Japan). RNA integrity was assessed by 2% agarose gel electrophoresis, and concentration was measured using a NanoDrop 2000c spectrophotometer (Thermo Scientific, Waltham, MA, USA). Complementary DNA (cDNA) synthesis was performed using the PrimeScript RT‐PCR Kit (TaKaRa).
Quantitative real‐time PCR (qPCR) was conducted to analyze the expression of lipid metabolism‐related genes, including pparα, cpt1α, lpl, hsl, fas, and srebp1-1c. β-actin and efα1 were used as the normalization gene. Primer sequences were adopted from previously published studies in silver pomfret, and the sequences are provided in Table 2. qPCR reactions were performed using the Ultra SYBR Mixture kit (Kangwei, Beijing, China) on a QuantStudio 6 Flex system (Thermo Fisher Scientific). The qPCR program comprised a predenaturation step (95°C, 30 s), 40 amplification cycles of denaturation (95°C, 15 s), and annealing and extension (58°C, 30 s). Relative gene expression levels were calculated using the 2−ΔΔCt method [23].
Table 2.
qPCR primer sequences used in this study.
| Gene name | Primer sequences | Product size (bp) | Primer efficiency (%) |
|---|---|---|---|
| β-actin [21] | F: TGAAATCGCCGCACTGGTTG | 157 | 106.2 |
| R: ACCAACGTAGCTGTCCTTCTG | |||
| ef1α [22] | AGAGCTTCTCCCAGTACCCTC | 107 | 99.3 |
| ACCGGAGGCGAGCTTCTTTTC | |||
| pparα [21] | F: CTCAAGGCGGAAAGCAAGATG | 168 | 95.9 |
| R: GATGAACGGCGGCTTGCTA | |||
| cpt1α [21] |
|
256 | 106.7 |
| lpl [21] | F: GAACCGCTGCAATAAGCTCG | 152 | 98.2 |
| R: GCTTGTTGTGAGCGTGTTGT | |||
| hsl [21] | F: CGTCATCGACCCCGAGTAAG | 136 | 104.8 |
| R: GACGTCGGGCGAATAAAAGC | |||
| fas [21] | F: CAGCTGAGAAGACTAGGGCG | 148 | 103.6 |
| R: GTGGAAGCTCCTGACACCTC | |||
| srebp1-1c [21] | F: GTCAGTGTGAGCCAGGCAG | 103 | 108.1 |
| R: GAGAAGAGGTGGTCGTCAGC |
Abbreviations: β-actin, beta‐actin; cpt1α, carnitine palmitoyltransferase 1‐alpha; ef1α, elongation factor 1‐alpha; fas, fatty acid synthase; hsl, hormone sensitive lipase; lpl, lipoprotein lipase; pparα, peroxisome proliferators‐activated receptor alpha; srebp1-1c, sterol regulatory element binding protein‐1c.
2.7. Statistical Analysis
All data are expressed as mean ± standard deviation (SD). Prior to ANOVA, data were tested for normality using the Shapiro–Wilk test and for homogeneity of variance using Levene’s test to ensure that ANOVA assumptions were met. Statistical analyses were performed using SPSS 25.0 (IBM Corp., Armonk, NY, USA). One‐way analysis of variance (ANOVA) was used to assess differences among groups, followed by Tukey’s honestly significant difference test for pairwise comparisons. Statistical significance was set at p < 0.05. Graphical representations were generated using Origin 8.0 software (OriginLab Corporation, Northampton, MA, USA).
3. Results
3.1. Effect of AKM Replacement on Digestive Enzyme Activities in Silver Pomfret
Trypsin activity in intestinal tissues was significantly higher in all experimental groups compared with the FM group (p < 0.05). No significant differences were detected among the experimental groups (p > 0.05). Lipase activity was also enhanced by AKM replacement, with significantly higher activities in the KM10 (29.14 ± 1.56 U/mg prot) and KM20 (28.46 ± 1.21 U/mg prot) groups compared to the FM group (22.13 ± 1.77 U/mg prot) (p < 0.05). The KM40 group showed an intermediate value (25.34 ± 1.88 U/mg prot), which did not differ significantly from either the FM or KM20 groups (p > 0.05). In contrast, amylase activity exhibited only minor variation among groups, ranging from 1.58 to 1.67 U/mg prot, with no significant differences observed across treatments (p > 0.05) (Table 3).
Table 3.
Activities of intestinal digestive enzymes in silver pomfret under varying levels of Antarctic krill meal replacement in the diet.
| Item | Groups | |||
|---|---|---|---|---|
| FM | KM10 | KM20 | KM40 | |
|
325.17 ± 20.13b | 409.05 ± 32.15a | 422.51 ± 29.13a | 397.13 ± 35.19a |
|
22.13 ± 1.77b | 29.14 ± 0.41a | 28.46 ± 1.21a | 25.34 ± 1.88ab |
|
1.58 ± 0.21 | 1.64 ± 0.15 | 1.66 ± 0.19 | 1.67 ± 0.13 |
Note: Values are expressed as mean ± SD (n = 3). Different superscript letters within the same row indicate significant differences (p < 0.05).
3.2. Effect of AKM Replacement on Transaminase Activity and Glucose Metabolism in Silver Pomfret
All experimental groups exhibited significantly higher GPT activity in kidney tissues compared to the FM group (p < 0.05), with a progressive increase observed as the level of AKM substitution increased. In muscle tissues, GPT activity was also elevated in the AKM‐fed groups relative to the FM group; however, these differences were not statistically significant (p > 0.05), with the KM10 group showing the highest activity. In liver tissue, the KM20 group demonstrated the highest GPT activity, significantly exceeding that of the FM and KM10 groups (p < 0.05), while no significant difference was observed between the KM20 and KM40 groups (p > 0.05) (Figure 1A).
Figure 1.
Activities of GPT (A) and GOT (B) in the muscle, liver, and kidney tissues of silver pomfret fed diets with varying levels of AKM replacement. Values are expressed as mean ± SD (n = 3). Different letters indicate significant differences among groups (p < 0.05).

(A)

(B)
For GOT activity, the KM20 group exhibited significantly higher levels in both kidney and muscle tissues compared to the FM group (p < 0.05). Moreover, GOT activity in liver tissue displayed a gradual upward trend with increasing AKM substitution, reaching a significantly higher level in the KM40 group relative to the FM group (p < 0.05) (Figure 1B).
No significant differences were observed among the four groups in glucose (GLU) or lactate (LD) levels in serum, kidney, or muscle tissues (p > 0.05). However, in liver tissue, the GLU concentration was significantly higher in the KM20 group compared to the FM and KM40 groups (p < 0.05), while no significant difference was found between the KM20 and KM10 groups (p > 0.05) (Figure 2A). Regarding LD content, no significant differences were detected among the groups in kidney and liver tissues (p > 0.05). In muscle tissue, the FM group exhibited the highest LD level, significantly higher than that of the KM10 group (p < 0.05), but not significantly different from the KM20 and KM40 groups (p > 0.05). Similarly, in serum, the FM group presented the highest LD concentration, which was significantly greater than that of the other three groups (p < 0.05) (Figure 2B).
Figure 2.
Contents of glucose (GLU) (A) and lactate (LD) (B) in the muscle, liver, kidney tissues, and serum of silver pomfret under different levels of AKM replacement in the diet. Values are expressed as mean ± SD (n = 3). Different letters indicate significant differences among groups (p < 0.05).

(A)

(B)
3.3. Effect of AKM Replacement on Muscle Nutritional Composition in Silver Pomfret
No significant differences were observed among the four groups in terms of muscle moisture, ash, crude protein, and crude fat content (p > 0.05) (Table 4).
Table 4.
Proximate composition of silver pomfret muscle under varying levels of Antarctic krill meal replacement in the diet.
| Item | Groups | |||
|---|---|---|---|---|
| FM | KM10 | KM20 | KM40 | |
| Moisture (%) | 76.88 ± 1.27 | 76.62 ± 1.78 | 75.89 ± 1.01 | 76.08 ± 0.95 |
| Crude protein (%) | 14.81 ± 0.46 | 15.39 ± 0.41 | 16.07 ± 0.31 | 15.51 ± 0.34 |
| Crude lipid (%) | 5.84 ± 0.45 | 5.43 ± 0.30 | 5.21 ± 0.26 | 5.44 ± 0.27 |
| Crude ash (%) | 2.67 ± 0.27 | 2.56 ± 0.19 | 2.83 ± 0.25 | 2.97 ± 0.22 |
Note: Values are expressed as mean ± SD (n = 3).
Regarding amino acid composition, there were no significant differences in most non‐essential amino acids (NEAAs), including serine (Ser), glycine (Gly), alanine (Ala), tyrosine (Tyr), and proline (Pro) across all groups (p > 0.05). However, aspartic acid (Asp) and glutamic acid (Glu) levels were significantly higher in the KM20 groups compared to the FM group (p < 0.05). For essential amino acids (EAAs), the KM20 group exhibited significantly elevated levels of valine (Val), isoleucine (Ile), leucine (Leu), and phenylalanine (Phe) relative to the FM group (p < 0.05). The total EAA content was highest in the KM20 group, followed by the KM10 group, with both groups significantly surpassing the FM group (p < 0.05). Similarly, the KM20 group exhibited the highest total amino acid (TAA) content, which was significantly greater than that of the FM and KM40 groups (p < 0.05). These findings indicate that a 20% replacement level of AKM (KM20 group) effectively enhanced both EAA and TAA levels, thereby improving muscle protein content and nutritional quality in silver pomfret (Table 5).
Table 5.
Amino acid composition of silver pomfret muscle under varying levels of Antarctic krill meal replacement in the diet (mg/g).
| Amino acid | Groups | |||
|---|---|---|---|---|
| FM | KM10 | KM20 | KM40 | |
| Asp | 52.38 ± 5.03b | 56.69 ± 4.17a | 57.83 ± 4.69a | 50.27 ± 3.25b |
| Ser | 15.47 ± 1.28 | 15.11 ± 1.14 | 15.66 ± 1.29 | 14.99 ± 1.26 |
| Glu | 64.38 ± 4.22b | 70.12 ± 5.23ab | 72.05 ± 4.89a | 67.56 ± 5.27ab |
| Gly | 20.23 ± 1.53 | 19.84 ± 1.18 | 20.03 ± 1.48 | 19.79 ± 1.19 |
| Ala | 30.02 ± 2.24 | 29.15 ± 1.87 | 31.25 ± 2.43 | 29.57 ± 0.96 |
| Tyr | 13.22 ± 0.97 | 14.10 ± 1.04 | 13.79 ± 0.85 | 13.67 ± 1.17 |
| Pro | 20.27 ± 2.04 | 19.58 ± 1.89 | 19.36 ± 1.77 | 19.52 ± 1.93 |
| Val1 | 37.53 ± 3.59b | 38.15 ± 4.02b | 42.07 ± 3.61a | 37.27 ± 3.01b |
| Met1 | 13.27 ± 1.02 | 12.96 ± 1.23 | 13.55 ± 1.35 | 12.63 ± 1.37 |
| Ile1 | 24.27 ± 2.10b | 32.15 ± 2.03a | 32.48 ± 2.37a | 33.01 ± 2.74a |
| Leu1 | 40.18 ± 3.23b | 45.25 ± 3.18ab | 47.01 ± 2.19a | 46.44 ± 3.52a |
| Phe1 | 23.17 ± 1.52b | 28.74 ± 1.65a | 29.31 ± 2.02a | 22.14 ± 1.78b |
| His1 | 9.29 ± 0.32 | 10.25 ± 0.47 | 9.65 ± 0.33 | 10.14 ± 0.78 |
| Lys1 | 56.27 ± 4.56 | 55.14 ± 3.79 | 55.03 ± 3.61 | 54.85 ± 4.01 |
| Arg1 | 33.17 ± 3.15 | 32.49 ± 3.21 | 32.98 ± 3.15 | 33.01 ± 3.94 |
| Thr1 | 19.87 ± 2.01 | 19.79 ± 1.88 | 20.35 ± 2.35 | 19.75 ± 1.72 |
| EAA | 257.02 ± 14.27b | 274.92 ± 16.79a | 282.43 ± 15.77a | 269.24 ± 17.71ab |
| TAA | 472.99 ± 25.64c | 499.51 ± 30.44ab | 512.40 ± 32.13a | 484.61 ± 35.45b |
Note: Values are expressed as mean ± SD (n = 3). Different superscript letters within the same row indicate significant differences (p < 0.05).
Abbreviations: Ala, alanine; Arg, arginine; Asp, aspartic acid; EAA, total essential amino acids; Glu, glutamic acid; Gly, glycine; His, histidine; Ile, isoleucine; Leu, leucine; Lys, lysine; Met, methionine; Phe, phenylalanine; Pro, proline; Ser, serine; TAA, total amino acids; Thr, threonine; Tyr, tyrosine; Val, valine.
1Indicate essential amino acids.
In terms of muscle fatty acid (FA) composition, the KM20 group exhibited significantly lower saturated fatty acid (SFA) content compared to the FM and KM40 groups (p < 0.05). No significant differences were observed among the groups in total monounsaturated fatty acid (MUFA) content (p > 0.05). Among individual MUFAs, the FM group had significantly lower C20:1 content (p < 0.05), while C16:1, C18:1n9, C17:1, and C24:1 content did not differ significantly among the groups (p > 0.05). Notably, the contents of eicosapentaenoic acid (C20:5n3, EPA) and docosahexaenoic acid (C22:6n3, DHA) were significantly higher in the KM10 and KM20 groups compared to the FM group (p < 0.05), suggesting that moderate AKM inclusion (20% replacement levels) enhances the deposition of n‐3 PUFAs in muscle tissue. Conversely, the FM group exhibited the highest content of linoleic acid (C18:2n6), which showed a decreasing trend as the AKM substitution level increased. Overall, the KM20 group demonstrated an optimized muscle FA profile, characterized by elevated levels of essential n‐3 fatty acids (EPA and DHA), indicating that replacement of fishmeal with 20% AKM can effectively improve the nutritional quality of muscle lipids in silver pomfret (Table 6).
Table 6.
Fatty acid composition of silver pomfret muscle under varying levels of Antarctic krill meal replacement in the diet (percentage of total fatty acids).
| Fatty acid | Groups | |||
|---|---|---|---|---|
| FM | KM10 | KM20 | KM40 | |
| SAF | 34.22 ± 2.25a | 31.53 ± 3.36ab | 30.27 ± 3.01b | 33.9 ± 1.56a |
| C16:1 | 8.12 ± 0.56 | 8.35 ± 0.47 | 8.19 ± 0.65 | 7.96 ± 0.55 |
| C17:1 | 0.36 ± 0.07 | 0.40 ± 0.05 | 0.38 ± 0.07 | 0.36 ± 0.12 |
| C18:1n9 | 25.52 ± 2.23 | 26.14 ± 3.02 | 26.78 ± 2.78 | 25.79 ± 2.65 |
| C20:1 | 4.12 ± 0.15b | 5.03 ± 0.31a | 5.33 ± 0.29a | 4.89 ± 0.33a |
| C22:1n9 | 0.28 ± 0.05 | 0.30 ± 0.03 | 0.29 ± 0.06 | 0.25 ± 0.07 |
| C24:1 | 1.87 ± 0.24 | 2.05 ± 0.26 | 1.79 ± 0.35 | 2.58 ± 0.53 |
| MUFA | 40.27 ± 3.53 | 42.27 ± 3.79 | 42.76 ± 4.02 | 41.83 ± 3.56 |
| C18:2n6 | 3.02 ± 0.57a | 2.34 ± 0.34b | 2.12 ± 0.32b | 1.98 ± 0.28b |
| C18:3n3 | 2.18 ± 0.38a | 1.56 ± 0.29b | 1.82 ± 0.26ab | 1.32 ± 0.23b |
| C18:3n6 | 2.19 ± 0.25 | 1.97 ± 0.19 | 1.76 ± 0.23 | 1.85 ± 0.17 |
| C20:3n3 | 0.99 ± 0.17 | 0.78 ± 0.15 | 0.85 ± 0.09a | 0.77 ± 0.17 |
| C20:4n6 | 1.81 ± 0.24 | 1.55 ± 0.35 | 1.53 ± 0.24 | 1.51 ± 0.28 |
| C20:5n3 | 4.08 ± 0.52b | 5.21 ± 0.47a | 5.87 ± 0.46a | 5.91 ± 0.50a |
| C22:6n3 | 11.24 ± 1.02b | 12.79 ± 1.14a | 13.02 ± 0.97a | 10.93 ± 1.08b |
| PUFA | 25.51 ± 2.08 | 26.20 ± 1.88 | 26.97 ± 2.32 | 24.27 ± 2.45 |
| n‐3 | 18.49 ± 1.56b | 20.34 ± 1.88ab | 21.56 ± 2.01a | 18.93 ± 1.66b |
| n‐6 | 7.02 ± 0.51a | 5.86 ± 0.47b | 5.41 ± 0.38b | 5.34 ± 0.40b |
Note: Values are expressed as mean ± SD (n = 3). Different superscript letters within the same row indicate significant differences (p < 0.05).
Abbreviations: MUFA, monounsaturated fatty acids; n‐3, omega‐3 fatty acids; n‐6, omega‐6 fatty acids; PUFA, polyunsaturated fatty acids; SAF, saturated fatty acids.
3.4. Effect of AKM Replacement on Lipid Metabolism‐Related Gene Expression in Silver Pomfret
Replacing fishmeal with varying levels of AKM significantly influenced the expression of lipid metabolism‐related genes in the liver of silver pomfret, including pparα, cpt1α, lpl, hsl, fas, and srebp1-1c (Figure 3). The expression of pparα increased progressively with the AKM substitution level, with all experimental groups showing significantly higher expression compared to the FM group (p < 0.05). Similarly, cpt1α expression exhibited an upward trend, with markedly higher levels observed in the KM20 and KM40 groups relative to the FM and KM10 groups (p < 0.05). For lpl expression, the KM10, KM20, and FM groups exhibited significantly higher levels compared to the KM40 group (p < 0.05). The KM20 and KM40 groups exhibited significantly higher hsl expression than the FM group (p < 0.05), whereas the KM10 group did not differ significantly from other groups (p > 0.05). In contrast, fas expression demonstrated a significant decline with increasing levels of AKM replacement. The KM20 and KM40 groups showed significantly lower fas expression compared to the FM and KM10 groups (p < 0.05), with the KM40 group displaying the lowest expression among all groups. Regarding srebp1-1c expression, the FM, KM10, and KM20 groups exhibited significantly higher levels than the KM40 group (p < 0.05), while no significant differences were observed among the FM, KM10, and KM20 groups (p > 0.05).
Figure 3.

Relative expression levels of lipid metabolism‐related genes in the liver tissue of silver pomfret under different levels of AKM replacement in the diet. Values are expressed as mean ± SD (n = 3). Different letters indicate significant differences among groups (p < 0.05).
These findings indicate that moderate AKM substitution (10% and 20% replacement levels) modulates the expression of lipid metabolism‐related genes, promoting lipid catabolism, and reducing lipid synthesis in silver pomfret, while excessive replacement may lead to dysregulation of lipid metabolic pathways.
3.5. Effect of AKM Replacement on Serum Immune Indices in Silver Pomfret
The replacement of fishmeal with AKM significantly influenced serum immune parameters in silver pomfret (Table 7). Complement component C3 levels were significantly higher in the KM20 and KM40 groups compared to the FM group (p < 0.05), with the KM20 group exhibiting the highest C3 concentration (319.66 ± 36.29 mg/L). However, there was no significant difference in C3 content between the KM20 and KM40 groups (p > 0.05). Although the KM10 group showed an increase in C3 levels relative to the FM group, this difference was not statistically significant (p > 0.05). All AKM‐fed groups exhibited significantly elevated complement component C4 levels compared to the FM group (p < 0.05). The KM10 group recorded the highest C4 concentration (115.17 ± 23.17 mg/L), followed by the KM40 (110.25 ± 15.73 mg/L) and KM20 groups (104.23 ± 19.54 mg/L). No significant differences in C4 content were observed among the experimental groups (p > 0.05). Serum IgM levels peaked in the KM20 group (1417.9 ± 115.5 mg/L), which was significantly higher than that in the FM group (p < 0.05). Although the KM10 and KM40 groups also exhibited elevated IgM levels compared to the FM group, these differences were not statistically significant (p > 0.05).
Table 7.
Serum immune‐related indices of silver pomfret under varying levels of Antarctic krill meal replacement in the diet.
| Item | Groups | |||
|---|---|---|---|---|
| FM | KM10 | KM20 | KM40 | |
| IgM (mg/L) | 1,138.6 ± 69.8b | 1,282.3 ± 96.7ab | 1417.9 ± 115.5a | 1,262.0 ± 93.8ab |
| C3 (mg/L) | 212.47 ± 36.96b | 286.83 ± 26.88ab | 319.66 ± 36.29a | 317.83 ± 24.16a |
| C4 (mg/L) | 85.13 ± 15.23b | 115.17 ± 23.17a | 104.23 ± 19.54a | 110.25 ± 15.73a |
Note: Values are expressed as mean ± SD (n = 3). Different superscript letters within the same row indicate significant differences (p < 0.05).
Overall, moderate inclusion of AKM (KM20) enhanced serum immune indicators, suggesting an improvement in humoral immune capacity, whereas excessive substitution did not yield additional immunological benefits.
4. Discussion
The growth performance of fish is closely linked to the efficiency of nutrient digestion and absorption, which largely depends on digestive enzyme activities [24]. In the present study, partial replacement of fishmeal with AKM significantly enhanced trypsin and lipase activities in silver pomfret, particularly at 10%–20% substitution levels, while amylase activity remained unaffected. These results suggest that moderate AKM replacement can improve protein and lipid digestion, potentially through the combined effects of its readily digestible soluble proteins and phospholipids, which are known to facilitate lipid emulsification and enhance digestive enzyme efficiency, together with other bioactive compounds [25]. Similar improvements in digestive enzyme activities following AKM supplementation have been reported in Australian red claw crayfish (Cherax quadricarinatus) [26], indicating a general stimulatory effect across aquatic species. However, excessive replacement (40%) showed a declining trend in lipase and trypsin activities, which may be related to the higher levels of fluoride and ash in AKM, potentially impairing nutrient utilization at high substitution levels [25]. These results highlight that the effects of AKM on digestive physiology may vary with species and dietary levels, and an optimal replacement level is essential to balance nutritional benefits and potential negative factors.
Fish primarily use proteins and lipids as energy sources, but glucose metabolism is also a crucial component of their energy supply [27–29]. LD, a product of anaerobic glycolysis, is a sensitive indicator of metabolic stress, whereas GLU is involved in aerobic metabolism and gluconeogenesis [30]. In the present study, moderate AKM substitution (KM20) resulted in reduced lactate accumulation in serum and muscle, suggesting improved metabolic efficiency. Hepatic glycogen storage, which is central to glucose regulation [31], was also enhanced in the moderate substitution group, potentially supported by bioactive compounds such as astaxanthin present in AKM [32]. In contrast, high‐level substitution (KM40) did not confer additional metabolic benefits, indicating a threshold beyond which excessive AKM inclusion may impair energy metabolism.
The activities of GPT and GOT are critical indicators of liver health and amino acid metabolism in fish [33–35]. Our study showed an increase in GPT and GOT activities with the inclusion of AKM, suggesting that AKM positively affects amino acid metabolism in silver pomfret, leading to an increased demand for energy and nitrogen metabolism. The rise in GPT and GOT activities may be an adaptive response to enhanced amino acid metabolism [36]. However, a slight decrease in GPT activity was observed in the KM40 group, possibly due to nutrient imbalances, which has also been reported in studies involving high levels of plant protein sources replacing fishmeal [37–39]. This higher level of AKM may have increased the metabolic burden on the organism and affected normal liver function, which could also explain the decline in survival rate in the KM40 group [16].
As the foundation of growth, development, and the maintenance of physiological functions, the balance of protein synthesis and degradation is crucial for fish health. It has been shown that AKM is rich in a variety of EAAs and has a positive effect on fish growth and development [40, 41]. Aspartic acid, phenylalanine, and glutamic acid are the main flavor‐enhancing amino acids [42]. We found that using appropriate levels of AKM to replace fishmeal is effective in improving the amino acid composition of silver pomfret muscle and enhancing its flavor quality, a conclusion also reached in yellow catfish (Pelteobagrus fulvidraco) [43]. Moreover, the KM20 group showed significantly higher levels of leucine, isoleucine, and valine (collectively referred to BCAAs) versus the FM group (p < 0.05). BCAAs are known to be involved in various physiological processes in fish, such as protein synthesis, immune response, muscle growth, and energy metabolism [44]. Therefore, moderate AKM inclusion may promote the absorption and accumulation of BCAAs, improve amino acid metabolism and physiological condition, and ultimately enhance protein synthesis, growth performance, and overall health in silver pomfret. This also supports the previous experimental findings on the growth performance of silver pomfret [16].
Lipid metabolism in fish is a dynamically regulated process that depends on the modulation of associated genes and their corresponding enzymes. Maintaining a dynamic balance of lipid metabolism is essential for the health and growth of fish [45]. AKM is rich in unsaturated fatty acids, particularly DHA and EPA [46], which not only affect fish growth and development [47] but also regulate cell membrane fluidity and signaling, thereby regulating lipid metabolism [48]. As key regulators of mitochondrial fatty acid β‐oxidation, the upregulation of lipid catabolism‐related genes (pparα and cpt1α) in the KM20 group underscores the role of AKM in enhancing fatty acid β‐oxidation pathways, which may be partially attributed to the increased availability of dietary DHA and EPA derived from AKM, consistent with findings that unsaturated fatty acids in krill oil activate lipid metabolism through PPAR signaling [49, 50]. The elevated deposition of DHA and EPA in muscle tissues further confirms AKM’s role in improving muscle fatty acid profiles, a benefit also observed in Atlantic salmon and large yellow croaker [51, 52]. As central regulators of fatty acid synthesis and lipogenic gene expression, the downregulation of fas and srebp1-1c with increasing substitution levels suggests a suppression of lipogenesis, indicating a shift towards lipid catabolism rather than storage. However, excessive AKM (KM40) appeared to disrupt lipid transport and synthesis, as evidenced by decreased lpl expression and reduced DHA levels, highlighting the delicate balance required in dietary formulations.
IgM is an important immunoglobulin in bony fish that mediates the primary immune response and provides effective defense against pathogens [53]. C3 and C4 essentially constitute the complement system, and their activation enhances phagocytosis and inflammation, helping the organism defend against external threats [54]. According to our findings, the KM10 and KM20 groups demonstrated significantly higher levels of IgM, C3, and C4 in the blood of silver pomfret compared to the FM group, suggesting that the replacement of fishmeal with AKM enhances the immunocompetence of the fish. However, the slight decrease in IgM and C4 levels in the KM40 group compared to the KM20 group may result from the disrupted lipid metabolic homeostasis caused by excessive AKM, which can suppress the immune response. This observation is consistent with results reported in yellow catfish [43]. It has been shown that AKM is rich in the natural antioxidant astaxanthin, which has a significant immunomodulatory effect, not only enhancing macrophage function but also promoting antibody production and complement activity [55, 56]. Therefore, the elevated IgM, C3, and C4 levels observed under moderate AKM inclusion are likely attributable, at least in part, to the bioactive effects of astaxanthin, whereas excessive substitution may attenuate these benefits due to metabolic imbalance.
In our previous study, dietary supplementation with AKM significantly improved WG and SGR in silver pomfret compared with the fishmeal‐based control diet (p < 0.05), although no significant differences were observed among the 10%, 20%, and 40% inclusion levels, and survival rates remained similar across all groups [16]. These results suggest that growth performance alone may not fully reflect the physiological benefits of different AKM substitution levels. In the present study, moderate replacement of fishmeal with AKM, particularly at 20%, effectively enhanced digestive capacity, energy and amino acid metabolism, lipid utilization, immune responses, and muscle nutritional quality, indicating that metabolic and immunological indicators respond more sensitively than growth metrics. The study provides an integrative assessment of AKM effects on fish health and product quality, highlighting the practical importance of optimizing inclusion rates to maximize benefits while avoiding metabolic overload. Although the experimental duration was relatively short and cellular mechanisms such as oxidative stress or histopathology were not examined, these findings offer guidance for feed formulation in silver pomfret aquaculture and support the strategic use of AKM to improve nutrient metabolism, immune competence, feed efficiency, and overall fish health.
5. Conclusion
In summary, moderate replacement of fishmeal with AKM, particularly at 20%, effectively enhanced nutrient metabolism, digestive enzyme activity, and immune function in silver pomfret. Higher inclusion levels (40%) showed diminishing benefits and potential metabolic overload. These results highlight the practical importance of optimizing AKM inclusion for both fish health and feed efficiency, while also reducing fishmeal use and supporting the development of sustainable aquafeeds.
Author Contributions
Conceptualization: Shiming Peng. Writing – original draft: Guangde Qiao. Material preparation: Yabing Wang and Qiaozhen Ke. Supervision: Shengyu Liu and Xiaoshan Wang. Writing – review and editing: Shuaijie Wang and Shiming Peng. Funding acquisition: Shiming Peng.
Funding
This work was sponsored by a grant from the National Natural Science Foundation of China [grant number 31772870].
Disclosure
All authors have read and approved the final manuscript.
Conflicts of Interest
The authors declare no conflicts of interest.
Acknowledgments
The authors have nothing to report.
Qiao, Guangde , Wang, Yabing , Ke, Qiaozhen , Liu, Shengyu , Wang, Xiaoshan , Wang, Shuaijie , Peng, Shiming , Effects of Replacing Fishmeal With Antarctic Krill Meal on Nutrient Deposition, Metabolism, and Immunity in Silver Pomfret (Pampus argenteus), Aquaculture Nutrition, 2026, 4095616, 11 pages, 2026. 10.1155/anu/4095616
Academic Editor: Osman Sabri Kesbic
Contributor Information
Shuaijie Wang, Email: wangsj@ecsf.ac.cn.
Shiming Peng, Email: shiming.peng@163.com.
Osman Sabri Kesbic, Email: okesbic@kastamonu.edu.tr.
Data Availability Statement
The raw data supporting the findings of this study are available from the first author upon reasonable request.
References
- 1. Wen T. Y., Jian L., and Gen H. Y., Multiplex Genotyping of Novel Microsatellites From Silver Pomfret (Pampus argenteus) and Cross-Amplification in Other Pomfret Species, Molecular Ecology Notes. (2006) 6, no. 4, 1073–1075, 10.1111/j.1471-8286.2006.01438.x, 2-s2.0-33751335688. [DOI] [Google Scholar]
- 2. Peng S. M., Shi Z. H., and Sun P., et al.Effects of Breeding Density on the Growth and Tissues Biochemical Indices of Juvenile Silver Pomfret (Pampus argenteus), Chinese Journal of Ecology. (2010) 29, no. 7, 1371–1376. [Google Scholar]
- 3. Peng S. M., Yin F., and Sun P., et al.Effects of Different Diets on Weight Gain, Hepatic Lipase and Antioxidant Enzyme of Juvenile Silver Pomfret (Pampus argenteus), Journal of Fisheries of China. (2010) 34, no. 6, 769–774, 10.3724/SP.J.1231.2010.06823. [DOI] [Google Scholar]
- 4. Shi Z. H., Gao L. J., and Xie Y. L., et al.Comparison of Reproductive Characteristics Between Pampus argenteus and Pampus cinereuc in Zhoushan Fishing Ground, Journal of Fisheries of China. (2006) 30, no. 5, 647–653. [Google Scholar]
- 5. Shi Z. H., Ma L. B., and Gao L. J., et al.Feeding Habits and Growth Characteristics of Larva and Juvenile of Pampus argenteus Under Artificial Rearing Condition, Progress in Fishery Sciences. (2007) no. 4, 38–46. [Google Scholar]
- 6. Shi Z. H., Zhao F., and Wang J. G., et al.Artificial Insemination and Incubation of Silver Pomfret (Pampus argenteus) From Zhoushan Fishing Ground, Fishery Modernization. (2009) 36, no. 1, 18–21+34. [Google Scholar]
- 7. Zhang C. J., Peng S. M., and Wang J. G., et al.The Effects of Salinity on Na+/K+-ATPase Activity and Plasma Osmoregulatory Hormone Concentration in Silver Pomfret Pampus argenteus , Oceanologia et Limnologia Sinica. (2013) 44, no. 5, 1395–1402. [Google Scholar]
- 8. Serra V., Pastorelli G., Tedesco D. E. A., Turin L., and Guerrini A., Alternative Protein Sources in Aquafeed: Current Scenario and Future Perspectives, Veterinary and Animal Science. (2024) 25, 10.1016/j.vas.2024.100381, 100381. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Hill S. L., Murphy E. J., Reid K., Trathan P. N., and Constable A. J., Modelling Southern Ocean Ecosystems: Krill, the Food-Web, and the Impacts of Harvesting, Biological Reviews. (2006) 81, no. 4, 581–608, 10.1017/S1464793106007123, 2-s2.0-33750689492. [DOI] [PubMed] [Google Scholar]
- 10. Cruz F. S., Ernst B., Arata J. A., and Parada C., Spatial and Temporal Dynamics of the Antarctic Krill Fishery in Fishing Hotspots in the Bransfield Strait and South Shetland Islands, Fisheries Research. (2018) 208, 157–166. [Google Scholar]
- 11. Torrecillas S., Montero D., Carvalho M., Benitez-Santana T., and Izquierdo M., Replacement of Fish Meal by Antarctic Krill Meal in Diets for European Sea Bass Dicentrarchus labrax: Growth Performance, Feed Utilization and Liver Lipid Metabolism, Aquaculture. (2021) 545, 10.1016/j.aquaculture.2021.737166, 737166. [DOI] [Google Scholar]
- 12. Yan Y., Lin Y., and Gu Z., et al.Dietary Fishmeal Substitution With Antarctic Krill Meal Improves the Growth Performance, Lipid Metabolism, and Health Status of Oriental River Prawn (Macrobrachium nipponense), Aquaculture Reports. (2024) 37, 10.1016/j.aqrep.2024.102202, 102202. [DOI] [Google Scholar]
- 13. Tharaka K., Benitez-Santana T., and Gunathilaka B. E., et al.Evaluation of Antarctic Krill (Euphausia superba) Meal Supplementation in Diets for Olive Flounder (Paralichthys olivaceus), Aquaculture Research. (2020) 51, no. 6, 2291–2302, 10.1111/are.14573. [DOI] [Google Scholar]
- 14. Tang B., Zheng H., Wang S., Qin G., Huang Y., and Wang L., Effects of Antarctic Krill Euphausia superba Meal Inclusion on Growth, Body Color, and Composition of Large Yellow Croaker Larimichthys crocea , North American Journal of Aquaculture. (2021) 83, no. 4, 255–266, 10.1002/naaq.10185. [DOI] [Google Scholar]
- 15. Tran H. Q., Nguyen T. T., and Prokešová M. D., et al.Impact of Krill (Euphausia superba) Meal on Growth Performance of Aquatic Animals: A Meta-Analysis and Prospective Directions, Animal Nutrition. (2025) 20, 487–498, 10.1016/j.aninu.2024.11.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Yang C., Gao Q. X., and Zhang C. J., et al.Effects of Antarctic Krill Powder on Growth, Non-Specific Immunity and Antioxidant Functions of Pampus argenteus Juveniles, Marine Fisheries. (2019) 41, no. 2, 224–233. [Google Scholar]
- 17. Yu N., Cao X. H., and Wang Y. J., et al.Reduced Stress Responses by MS-222 in Juvenile Silver Pomfret (Pampus argenteus), Journal of the World Aquaculture Society. (2020) 51, no. 5, 1192–1207, 10.1111/jwas.12725. [DOI] [Google Scholar]
- 18. AOAC, Official Methods of Analysis of AOAC International, 2005, 18th edition, AOAC International. [Google Scholar]
- 19. Folch J., Lees M., and Stanley G. H. S., A Simple Method for the Isolation and Purification of Total Lipides From Animal Tissues, Journal of Biological Chemistry. (1957) 226, no. 1, 497–509, 10.1016/S0021-9258(18)64849-5. [DOI] [PubMed] [Google Scholar]
- 20. Moore S. and Stein W. H., A Modified Ninhydrin Reagent for the Photometric Determination of Amino Acids and Related Compounds, Journal of Biological Chemistry. (1954) 211, no. 2, 907–913, 10.1016/S0021-9258(18)71178-2. [DOI] [PubMed] [Google Scholar]
- 21. Liu X. R., Zhao W. L., and Bao Y. G., et al.Regulatory Effects of Dietary Lipid Sources on Growth, Physiological Responses, Fatty Acid Composition, and Lipid Metabolism in Juvenile Silver Pomfret (Pampus argenteus), Aquaculture. (2026) 613, 10.1016/j.aquaculture.2025.743456, 743456. [DOI] [Google Scholar]
- 22. Liu K., Meng R., and Rang Z. S., et al.Short-Term Starvation in Silver Pomfret (Pampus argenteus): Molecular Effects on Lipid Mobilization and Utilization, Aquaculture Research. (2017) 48, no. 9, 4874–4885, 10.1111/are.13307, 2-s2.0-85016397502. [DOI] [Google Scholar]
- 23. Livak K. J. and Schmittgen T. D., Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method, Methods. (2001) 25, no. 4, 402–408, 10.1006/meth.2001.1262, 2-s2.0-0035710746. [DOI] [PubMed] [Google Scholar]
- 24. Montero D., Moyano F. J., and Carvalho M., et al.Nutritional Innovations in Superior Gilthead Seabream (Sparus aurata) Genotypes: Implications in the Utilization of Emerging New Ingredients Through the Study of the Patterns of Secretion of Digestive Enzymes, Aquaculture. (2023) 577, 10.1016/j.aquaculture.2023.739958, 739958. [DOI] [Google Scholar]
- 25. Kaur K. and Torrecillas S., Impact of Krill Products on the Growth, Health, and Fillet Quality of Farmed Non-Salmonid Fish, Aquaculture. (2025) 608, 10.1016/j.aquaculture.2025.742723, 742723. [DOI] [Google Scholar]
- 26. Mai Z., Wei J., and Wang Y., et al.Effects of Different Feeding Strategies for the Frozen Antarctic Krill Meal on Growth, Muscle Nutrition, Digestive Enzyme Activity, Immunity, Molting, and Gut Microbiota Structure of Cherax quadricarinatus , Frontiers in Marine Science. (2025) 12, 10.3389/fmars.2025.1573152, 1573152. [DOI] [Google Scholar]
- 27. Li X., Han T., and Zheng S., et al.Wu G., Hepatic Glucose Metabolism and Its Disorders in Fish, Recent Advances in Animal Nutrition and Metabolism, 2021, Springer International Publishing, 207–236. [DOI] [PubMed] [Google Scholar]
- 28. Tung P.-H. and Shiau S.-Y., Effects of Meal Frequency on Growth Performance of Hybrid Tilapia, Oreochromis niloticus × O. aureus, Fed Different Carbohydrate Diets, Aquaculture. (1991) 92, 343–350, 10.1016/0044-8486(91)90039-A, 2-s2.0-0001646094. [DOI] [Google Scholar]
- 29. Wilson R. P., Utilization of Dietary Carbohydrate by Fish, Aquaculture. (1994) 124, no. 1–4, 67–80, 10.1016/0044-8486(94)90363-8, 2-s2.0-0345616560. [DOI] [Google Scholar]
- 30. Enes P., Panserat S., Kaushik S., and Oliva-Teles A., Nutritional Regulation of Hepatic Glucose Metabolism in Fish, Fish Physiology and Biochemistry. (2009) 35, no. 3, 519–539, 10.1007/s10695-008-9259-5, 2-s2.0-67650413595. [DOI] [PubMed] [Google Scholar]
- 31. Polakof S., Panserat S., Soengas J. L., and Moon T. W., Glucose Metabolism in Fish: A Review, Journal of Comparative Physiology B. (2012) 182, no. 8, 1015–1045, 10.1007/s00360-012-0658-7, 2-s2.0-84870370032. [DOI] [PubMed] [Google Scholar]
- 32. Medoro A., Intrieri M., Passarella D., Willcox D. C., Davinelli S., and Scapagnini G., Astaxanthin as a Metabolic Regulator of Glucose and Lipid Homeostasis, Journal of Functional Foods. (2024) 112, 10.1016/j.jff.2023.105937, 105937. [DOI] [Google Scholar]
- 33. Wu L. F., Qin G. X., and Liu C. L., et al.Effects of Dietary Soybean Protein on the Activity of Digestive Enzyme and Blood Biochemical Parameters of Carp, Journal of Northwest A & F University. (2009) 37, no. 8, 63–69. [Google Scholar]
- 34. Jiao X., Guo Z. Y., and Liu B. Y., et al.Toxic Effects of Perfluorocaproic Acid (PFHxA) on Crucian Carp (Carassius auratus) and the Response of the Intestinal Microbial Community, Comparative Biochemistry and Physiology. (2023) 271, 10.1016/j.cbpc.2023.109683, 109683. [DOI] [PubMed] [Google Scholar]
- 35. Yan Q., Xie S., Zhu X., Lei W., and Yang Y., Dietary Methionine Requirement for Juvenile Rockfish, Sebastes schlegeli , Aquaculture Nutrition. (2007) 13, no. 3, 163–169, 10.1111/j.1365-2095.2007.00461.x, 2-s2.0-34248151893. [DOI] [Google Scholar]
- 36. Li X., Jiang Y., Liu W., and Ge X., Protein-Sparing Effect of Dietary Lipid in Practical Diets for Blunt Snout Bream (Megalobrama amblycephala) Fingerlings: Effects on Digestive and Metabolic Responses, Fish Physiology and Biochemistry. (2012) 38, no. 2, 529–541, 10.1007/s10695-011-9533-9, 2-s2.0-84858708371. [DOI] [PubMed] [Google Scholar]
- 37. Amer S. A., Osman A., and Al-Gabri N. A., et al.The Effect of Dietary Replacement of Fish Meal With Whey Protein Concentrate on the Growth Performance, Fish Health, and Immune Status of Nile Tilapia Fingerlings, Oreochromis niloticus , Animals. (2019) 9, no. 12, 10.3390/ani9121003, 1003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Li B., Su L., Sun Y., Huang H., Deng J., and Cao Z., Evaluation of Cottonseed Meal as an Alternative to Fish Meal in Diet for Juvenile Asian Red-Tailed Catfish Hemibagrus wyckioides , Aquaculture Nutrition. (2023) 2023, 1–15, 10.1155/2023/1741724, 1741724. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Sitjà-Bobadilla A., Peña-Llopis S., Gómez-Requeni P., Médale F., Kaushik S., and Pérez-Sánchez J., Effect of Fish Meal Replacement by Plant Protein Sources on Non-Specific Defence Mechanisms and Oxidative Stress in Gilthead Sea Bream (Sparus aurata), Aquaculture. (2005) 249, no. 1–4, 387–400, 10.1016/j.aquaculture.2005.03.031, 2-s2.0-23944519606. [DOI] [Google Scholar]
- 40. Panteli N., Kousoulaki K., and Antonopoulou E., et al.Which Novel Ingredient Should Be Considered the “Holy Grail” for Sustainable Production of Finfish Aquafeeds?, Reviews in Aquaculture. (2025) 17, no. 1, 10.1111/raq.12969. [DOI] [Google Scholar]
- 41. Zhang L. L., Liang M. Q., and Xu H. G., et al.Effects of Dietary Krill Hydrolysates on Growth Performance, Body Composition and Related Enzyme Activities of Juvenile Turbot (Scophthalmus maximus L.), Acta Hydrobiologica Sinica. (2017) 41, no. 3, 3497–3505. [Google Scholar]
- 42. Wongso S. and Yamanaka H., Extractive Components of the Adductor Muscle of Japanese Baking Scallop and Changes During Refrigerated Storage, Journal of Food Science. (1998) 63, no. 5, 772–776, 10.1111/j.1365-2621.1998.tb17897.x, 2-s2.0-0031731061. [DOI] [Google Scholar]
- 43. Xie K., Shi Y., and He H., et al.Effects of Replacement of Fish Meal by AntarSctic Krill Meal on Growth Performance, Immune Indexes and Muscle Quality of Pelteobagrus fulvidraco , Journal of Fisheries of China. (2022) 46, no. 3, 410–419. [Google Scholar]
- 44. Ahmad I., Ahmed I., Fatma S., and Peres H., Role of Branched-Chain Amino Acids on Growth, Physiology and Metabolism of Different Fish Species: A Review, Aquaculture Nutrition. (2021) 27, no. 5, 1270–1289, 10.1111/anu.13267. [DOI] [Google Scholar]
- 45. Li Y., Li W., and Luo L., et al.Dietary Lipid Levels Affect Growth Performance, Lipid Metabolism, Antioxidant and Immune Status of Amur Sturgeon, Acipenser schrenckii , Aquaculture Reports. (2023) 33, 10.1016/j.aqrep.2023.101796, 101796. [DOI] [Google Scholar]
- 46. Lou Q.-M., Wang Y.-M., Yang W.-G., Xu D.-L., and Xue C.-H., Lipid Classes and Fatty Acid Compositions of Antarctic Krill Meal, Journal of Fisheries of China. (2012) 36, no. 8, 1256–1262, 10.3724/SP.J.1231.2012.27867. [DOI] [Google Scholar]
- 47. Takeuchi T. and Watanabe T., Effect of Excess Amounts of Essential Fatty Acids on Growth of Rainbow Trout, Bulletin of the Japanese Society of Scientific Fisheries. (1979) 45, 87656466. [Google Scholar]
- 48. Samovski D., Jacome-Sosa M., and Abumrad N. A., Fatty Acid Transport and Signaling: Mechanisms and Physiological Implications, Annual Review of Physiology. (2023) 85, no. 1, 317–337, 10.1146/annurev-physiol-032122-030352. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Yan X., Dong X., and Tan B., et al.Effects of Alternative Dietary Oils on Lipid Metabolism and Related Gene Expression in Hybrid Grouper (♀ Epinephelus fuscoguttatus×♂ E. lanceolatu), Aquaculture Nutrition. (2021) 27, no. 1, 105–115, 10.1111/anu.13168. [DOI] [Google Scholar]
- 50. Zhao T., Ma A., and Huang Z., et al.Molecular Cloning and Structural Characterization of PPARα Gene From Turbot (Scophthalmus maximus) and Functional Exploration of Lipid Metabolism in Response to Thermal Stress, Aquaculture Research. (2022) 53, no. 7, 2608–2618, 10.1111/are.15778. [DOI] [Google Scholar]
- 51. Mørkøre T., Moreno H. M., and Borderías J., et al.Dietary Inclusion of Antarctic Krill Meal During the Finishing Feed Period Improves Health and Fillet Quality of Atlantic Salmon (Salmo salar L.), British Journal of Nutrition. (2020) 124, no. 4, 418–431, 10.1017/S0007114520001282. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Wei Y., Shen H., and Xu W., et al.Replacement of Dietary Fishmeal by Antarctic Krill Meal on Growth Performance, Intestinal Morphology, Body Composition and Organoleptic Quality of Large Yellow Croaker Larimichthys crocea , Aquaculture. (2019) 512, 10.1016/j.aquaculture.2019.734281, 2-s2.0-85069456344, 734281. [DOI] [Google Scholar]
- 53. Mokhtar D., Zaccone G., Alesci A., Kuciel M., Hussein M., and Sayed R., Main Components of Fish Immunity: An Overview of the Fish Immune System, Fishes. (2023) 8, no. 2, 10.3390/fishes8020093, 93. [DOI] [Google Scholar]
- 54. Mori K., Nakanishi T., Suzuki T., and Oohara I., Defense Mechanisms in Invertebrates and Fish, Tanpakushitsu Kakusan Koso. Protein, Nucleic Acid, Enzyme. (1989) 34, no. 3, 214–223. [PubMed] [Google Scholar]
- 55. Elbahnaswy S. and Elshopakey G. E., Recent Progress in Practical Applications of a Potential Carotenoid Astaxanthin in Aquaculture Industry: A Review, Fish Physiology and Biochemistry. (2024) 50, no. 1, 97–126, 10.1007/s10695-022-01167-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56. Magalhães R., Guardiola F. A., and Guerreiro I., et al.Effect of Different Dietary Arachidonic, Eicosapentaenoic, and Docosahexaenoic Acid Content on Selected Immune Parameters in Gilthead Sea Bream (Sparus aurata), Fish and Shellfish Immunology Reports. (2021) 2, 10.1016/j.fsirep.2021.100014, 100014. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The raw data supporting the findings of this study are available from the first author upon reasonable request.
