Skip to main content
NCBI home page
Environmental Microbiology Reports logoLink to Environmental Microbiology Reports
. 2026 Mar 10;18(2):e70317. doi: 10.1111/1758-2229.70317

Dietary Specialisation Shapes Gut Bacterial Diversity in Dung Beetles: Insights From Coprophagy to Millipede Carnivory

Johann C de Beer 1,✉, Kazeem A Alayande 2, Christian W W Pirk 1, Rasheed A Adeleke 2, Catherine L Sole 1
PMCID: PMC12976458  PMID: 41808437

ABSTRACT

Dung beetles are ecosystem engineers, providing ecosystem services like nutrient cycling, waste degradation and parasite suppression. Their gut microbiome is essential for exploiting specialised diets, yet the eco‐evolutionary factors driving microbial composition across diverse feeding strategies remain ambiguous. Here, we show that diet strongly influences gut bacterial composition across seven dung beetle species specialising in coprophagy, necrophagy, detritophagy, fungivory and carnivory. Most dietary specialisations grouped separately, though fungivores clustered with carrion and millipede feeders. The millipede‐feeding species, Sceliages brittoni and S. hippias, hosted the most distinct and least diverse gut microbiomes. Taxonomically, differences were driven by distinct marker taxa, many of which are consistently isolated across taxonomic orders with similar diets. For example, the indicative bacterial species I. indica has been identified in various flesh‐feeding insect taxa. Crucially, this pattern of shared bacterial communities suggests that diet is a dominant structuring factor which promotes community convergence regardless of host phylogeny. This study highlights the role of diet in shaping the dung beetle gut microbiome and provides the first characterisation of the gut microbiota in millipede‐feeding dung beetles. Our findings underscore the critical role of diet, laying the foundation for functional studies into the eco‐evolutionary significance of these host–microbe interactions.

Keywords: 16S rRNA, coevolution, Coleoptera, diet, dung beetles, gut microbiota, symbiosis

Dung beetles feed on various food sources that are rich in microbial life. Here, we describe how the diets of seven dung beetle species, specialising in coprophagy, necrophagy, detritophagy, fungivory and carnivory influence their gut bacterial structure and diversity.

graphic file with name EMI4-18-e70317-g002.jpg

1. Introduction

An insect's gastrointestinal tract accommodates a complex collection of microbes known as the gut microbiome (Engel and Moran 2013). Gut microbes can be symbiotic or antagonistic, comprising bacteria, fungi, archaea, protists and viruses. Many microbial species within the insect gut are transient, environmentally acquired and unable to persist within the insect gut. However, the association between phylogeny and gut microbiota composition is generally consistent (Jang and Kikuchi 2020). These microbes play a crucial role in the adaptation and development of insects to their specific dietary niches; contributing towards various metabolic and biochemical processes (Prasanna et al. 2014; Wang et al. 2020; Sikorska‐Zimny and Beneduce 2021). For example, the insect gut microbiota can deactivate toxic plant semiochemicals; a process that allows the them to overcome the host plant's defences (Ceja‐Navarro et al. 2015; Shukla and Beran 2020) or aid insects in carbohydrate digestion, providing their hosts access to a complex assortment of nutrients (Gao et al. 2023; Chen et al. 2016; Xia et al. 2020; Ma et al. 2021; Jing et al. 2020).

Host phylogeny and diet are often cited as two major factors contributing to the insect gut microbiome diversity and structure (Yun et al. 2014; Huang et al. 2021; Colman et al. 2012). Insect orders and families are fundamentally different from one another, comprising unique behaviours, physiologies, niches or gut environments (Kim et al. 2017). Therefore, differences between the gut microbiomes of phylogenetically distinct groups are expected. This is true for eight sympatric fruit fly species, where a study found that their gut microbiome was imprinted by the fly's phylogeny, and to a lesser extent their environment or dietary specialisation (Ravigné et al. 2022). Some studies suggest the co‐evolution of vertically transmitted gut microbes within the insect host (phylosymbiosis), further emphasising the effect phylogeny has on the insect gut microbiome (Groussin et al. 2020; Shapira 2016; Engel and Moran 2013). As our knowledge of microbiomes expands, it becomes clear that resident gut microbes are ubiquitous in nature, and many insect food sources harbour a plethora of microorganisms (Santos‐Garcia et al. 2020; Višňovská et al. 2020). Recent evidence suggests that a significant proportion of leaf feeding insects may gain their gut microbiome from their diets (Zhu et al. 2021). When comparing the importance of diet and phylogeny in determining the gut microbiome composition and diversity, studies suggest diet plays a larger role than phylogeny in insects that feed on lignocellulose‐derived substances (Kim et al. 2017). Another study revealed a similar trend, with diet being the main determinant of gut bacterial community composition in two wood feeding beetles (Colman et al. 2012). It has also been hypothesised that specialist feeders accommodate a very specialised core gut microbiota and generalist feeders house a vast diversity of gut microbes (Chen et al. 2019).

Although large scale studies spanning different insect orders and diets are sufficient at showing general patterns, a major drawback of these studies is that most compare insects between different orders, families or subfamilies with different feeding strategies, or insects from the same family with similar feeding strategies (Ebert et al. 2021; Franzini et al. 2016; Yun et al. 2014; Huang et al. 2021). This approach is inadequate at investigating the effect of varied diets whilst limiting differences in insect phylogeny and physiology. Dung beetles provide a unique opportunity to study the effect diet has on an insect's gut microbiota (Schwab et al. 2016). Dung beetles are largely coprophagous insects that are essential in providing ecosystem services such as nutrient cycling (Hanski and Cambefort 2014). Within the subfamily Scarabaeinae, there are also species that are carnivorous, fungivores, detritivores or necrophagous. Recent studies observing the dung beetle gut microbiome concluded that dung beetle tribes best predicted microbial diversity for all taxa studied, except the tribe Deltochilini, which possess variable diets (Jácome‐Hernández et al. 2023). However, the main diets investigated were coprophagy and necrophagy, with few studies focusing on more varied dung beetle diets. Other factors that significantly affect the gut microbiome of dung beetles are the developmental stage and geographic range, even within the same species. Due to the microbial rich nature of dung and decomposing matter, we expect coprophagous, necrophagous and detritivorous beetles to possess fairly variable and diverse gut bacterial communities. Chen et al. (2019) also propose that specialist feeders accommodate a very specialised core gut microbiota and generalist feeders house a vast diversity of gut microbes. By further exploring and comparing the composition and biodiversity of the microbiome between species with a large variation in diet specialisation within the same subfamily could shed light on how diet affects the gut microbiome of insects, whilst limiting taxon specific differences.

Therefore, this study aimed to characterise the gut bacterial communities of seven different South African dung beetle species feeding on five different dietary specialisations (Table 1). By studying the bacterial communities of seven different species within the same subfamily, the present study was designed to provide insights on the effect of large dietary variation on the gut bacterial community of closely related individuals. Furthermore, bacterial taxa of importance that characterise the different dietary specialisations were also investigated. Ultimately, this study is expected to expand our knowledge base on the natural variable of dung beetle gut microbiomes within their separate ecological roles.

TABLE 1.

Final number of dung beetle samples that were successfully sequenced.

Species Diet Location Sequenced samples
Sceliages hippias Millipede Jericho 3
Sceliages brittoni Millipede Kommandokraal 3
Pachysoma hippocrates Dry dung/Detritus Kommandokraal 1
Pachysoma striatum Dry dung/Detritus Kommandokraal 3
Coptorhina klugii Mushroom Jericho 5
Anachalcos convexus Carrion/Dry dung Jericho 5
Dicranocara sp.1 Dung Jericho 3
Total (N) 23
Open in a new tab

2. Methods

2.1. Study Species and Sampling

A total of 23 adult dung beetles (Subfamily: Scarabaeinae) from six genera and seven species were collected in the North‐West and Northern‐Cape provinces, South Africa (Figure S1). Pitfall traps baited with dung, chicken liver, mushroom and millipedes were used to collect all samples; with sampling commencing after the first rains in September 2021. The selected study species range from ancient to most derived through the dung beetle phylogeny, with all genera representing different dietary specialisations (Table 1) (Mlambo et al. 2015). Most of the seven dung beetle species investigated in this study are tunnellers, except for Pachysoma hippocrates (MacLeay 1821) and Pachysoma striatum (Castelnau 1840), which are commonly referred to as draggers (Figure S5) (Scholtz 1989). Anachalcos convexus (Boheman 1857) belongs to the tribe Canthonini. This species is quite understudied but is a known generalist feeder with an extreme bias towards carrion (Davis et al. 2020). Coptorhina klugii (Hope 1833) belongs to the Ateuchini tribe and is widely distributed throughout Southern Africa (Frolov et al. 2008). This is our most ancient lineage of obligate fungivores that feed exclusively on basidiomycetes (Mlambo et al. 2015). Sceliages hippias (Westwood 1844) and S. brittoni (zur Strassen 1965) belong to the Scarabaeini tribe and are some of the more common species within the genus. They are entirely carnivorous and exclusively hunt millipedes, usually by disarticulation or by attacking already injured individuals (Krell 1999; Forgie et al. 2002). Dicranocara sp. 1 is an undescribed species in the tribe Canthonini. This species is a dung feeder that specialises in exploiting hyrax middens (Deschodt et al. 2007). Pachysoma hippocrates and P. striatum belong to the Scarabaeini tribe and occur on the west coast of Southern Africa. This genus of dung beetle is unique as they drag their food items and feed exclusively on dry dung and plant detritus.

2.2. Sample Preparation

After collecting the beetles, they were housed in falcon tubes for 2 days before euthanasia in a −20°C freezer. This allows for the complete digestion of any dietary material left within the gut. Beetles that died before euthanasia were omitted and not utilised for the study. Beetles were surface sterilised with 5% diluted bleach and 70% ethanol as described by Hammer et al. (2015). The mid and hind guts of all beetles were dissected under sterile conditions utilising a dissection microscope (Olympus SZ61/51, USA) and insect dissection kit. All dissecting equipment was cleaned with ethanol and flame sterilised after each completed dissection. The gut sections were dissected from dung beetles by opening the hard elytra and removing the soft membrane covering of the abdomen. Thereafter, the mid and hind guts were removed (starting from the posterior end through to the thorax) and placed in clean Eppendorf tubes.

2.3. Metabarcoding Analysis of the Gut Microbiome

The bacterial DNA of all samples was extracted and purified utilising QIAamp PowerFecal Pro DNA Kit (QIAGEN, USA). This product was deemed most appropriate as it specialises in the DNA extraction of bacterial cells within gut and stool samples. Gut samples were mechanically (through bead beating) and chemically (lysis buffer) homogenised. Inhibitors were filtered out and the DNA collected in silica membrane. The kit protocol was modified to ensure complete lysis of crushed gut samples through doubling the bead beating time (20 min), with larger samples (Pachysoma) requiring two rounds of bead beating.

The use of 16S rRNA amplicon sequencing was deemed most appropriate for the initial screening for gut bacterial communities, due to the massively parallel sequencing, with relatively low costs and ease of use. The extracted bacterial DNA was sent to Singapore Joint Venture & Sequencing Centre NovogeneAIT (Genomics Singapore Pte. Ltd.) who performed the library preparation and sequenced the V4‐V5 hypervariable regions of the 16S rRNA gene through the Illumina NovoSeq high throughput sequencing platform. The primer sets 515F–907R with the sequence FWD: GTGCCAGCMGCCGCGGTAA and REV: CCGTCAATTCCTTTGAGTTT were utilised to amplify the 16S rRNA gene as stipulated by the earth microbiome project (Thompson et al. 2017).

2.4. Data Analysis

All gut samples were sequenced utilising the Illumina NovaSeq platform, obtaining an average of ~109,355 reads per sample. After quality control through the DADA2 algorithm, reads were cleaned and combined amounting to an average of ~78,672 reads per sample, clustering into ~325 amplicon sequencing variants (ASVs) per sample (Table S4). The raw reads received from Novogene were filtered and analysed with QIIME 2 (version 2023.2) (Bolyen et al. 2019) through a Linux (Ubuntu version 22.04.1) virtual machine. The data were further visualised in R‐studio. Raw reads were first processed through the DADA2 denoising algorithm (Callahan et al. 2016). DADA2 infers exact amplicon sequencing variants (ASVs) and allows for greater accuracy, resolution and comparability compared to the traditional operational taxonomic unit (OTU) clustering method. This step included paired end joining of the raw reads, quality filtering and finally, removing the primers and chimeras (Table S1). Subsequently, the table of ASVs were classified against the Greengenes 2.0 database (Mcdonald et al. 2022). All samples were rarefied at 39,000 sequences to control for sampling bias and normalised through the counts per million (CPM) method to account for variation in sequencing depth among samples. Alpha and beta diversity metrics were calculated utilising the cleaned sequences and the r pages phyloseq (Mcmurdie and Holmes 2013), vegan (Oksanen et al. 2019) and DESeq2 (Love et al. 2014). The alpha diversity measures include observed ASVs, Shannon and Simpson diversity indices (Table S2). A Kruskal–Wallace test (Kruskal and Wallis 1952) was performed to determine if there are statistically significant differences between the alpha diversity measures of different dung beetle dietary specialisations and a Dunn's test (Dinno 2015) to determine the effect size. An NMDS analysis was used to visualise the beta diversity between different dung beetle diets (Table S3 and Figure S4). After 300 random starts, an NMDS plot with the least residuals was created following the Whittaker beta diversity index. The PERMANOVA Adonis test (Anderson et al. 2017) was used to determine significance between the observed species, diets and their interactions. The abundances of bacterial phyla within each sample were visualised with a relative abundance bar plot. Lastly, the LEfSe analysis (Chang et al. 2022) was utilised to build a cladogram of statistically significant marker sequences representing each diet analysed. The Kruskal–Wallis test was applied (α = 0.05) to detect taxa with significant differences in abundance between diet categories, followed by a linear discriminant analysis (LDA) to estimate the effect size of each discriminative feature. Only taxa with an LDA score greater than 5 were retained for visualisation and interpretation.

3. Results

All samples reached sequencing saturation, indicating sufficient sampling of the 16 s rRNA gene region (Figures S2 and S3). Gut bacterial diversity varied considerably within the carrion, detritus/dry dung, dung and mushroom feeding groups (Figure 1). In contrast, the millipede feeding species, Sceliages brittoni and S. hippias, possess a less variable gut microbiome. The observed ASVs differed significantly between the different dietary specialisations (χ 2 = 11.133, df = 4.000, p = 0.025). Millipede feeding beetles possessed significantly lower observed ASVs in their guts compared to the detritus/dry dung (Z = 2.399, p = 0.016), dung (Z = 2.763, p = 0.006) and carrion (Z = 2.496, p = 0.013) feeding groups. The mean observed ASVs for carrion, detritus/dry dung and dung feeders were ~653, compared to the more specific ~195.5 and ~381 ASVs of the millipede and mushroom feeding species respectively. The Shannon index (χ 2 = 10.957, df = 4.000, p = 0.027) suggests that millipede feeders possess a significantly less diverse gut microbiome compared to the dung (Z = 2.746, p = 0.006), carrion/dung (Z = 2.557, p = 0.011) and mushroom (Z = −2.361, p = 0.018) feeding species. Following the same trend, millipede feeding species had a much lower bacterial species richness, compared to the detritus/dry dung (Z = 2.417, p = 0.016), dung (Z = 2.780, p = 0.005) and carrion (Z = 2.516, p = 0.012) feeding groups. The Simpson index (χ 2 = 8.2029, df = 4.000, p = 0.084) shows a similar trend of less species evenness in the millipede feeding beetles (although this model is not significant).

FIGURE 1.

FIGURE 1

Open in a new tab

Alpha diversity estimates as a box and whisker plot, measured according to the observed ASVs, Shannon and Simpson diversity indices of five feeding specialisations comprising seven dung beetle species. Significant differences are indicated by different letters; different colours represent different feeding specialisations, and the median is central to each box.

The PERMANOVA Adonis test at 9999 permutations indicates significant differences between the different diets (R 2 = 0.405, p = 0.001), species (R 2 = 0.493, p = 0.001) and their interactions (R 2 = 0.492, p = 0.001) in the NMDS plot (Figure 2). Most of the major dietary specialisations assessed in this study grouped separately from one another, except for the mushroom feeding group, which overlapped with both the carrion/dung and millipede diet clusters. The two closely related species, S. brittoni and S. hippias, specialise on similar diets and are also clustered together. Pachysoma hippocrates and P. striatum specialise on slightly different diets and were only loosely clustered. When considering the ASVs shared between different dietary specialisations, it is clear that the mushroom feeding beetles share the largest portion (66.67%) of their gut microbiome with other dung beetle species; notably, with the detritus, carrion and dung feeding beetles (Figure 3). Only 104 sequences were shared between all five dietary specialisations. The dung feeding beetles, Dicranocara sp. 1, shared the lowest proportion of their sequences with other dietary specialisations.

FIGURE 2.

FIGURE 2

Open in a new tab

Beta diversity estimate calculated according to the non‐metric multidimensional scaling plot (NMDS) based on Whittaker beta diversity. Each species is represented with a different colour and each dietary specialisation with a different symbol; the ellipses resemble statistically significant groupings according to the PERMANOVA test.

FIGURE 3.

FIGURE 3

Open in a new tab

Five‐set Venn diagram indicating the number of shared ASVs between different dung beetle dietary specialisations.

The bacteria phyla most commonly observed within the gastrointestinal tract of the sampled dung beetle species were Firmicutes, Proteobacteria and Bacteroidota (Figure 4A). When observing the family‐level breakdown of the dung beetle gut bacteria, it is clear that the dung beetle gut community is quite variable (Figure 4B). There is a clear pattern of bacterial families dominating within one taxa or dietary specialisation. For example, Sceliages brittoni possesses similar abundances of VBWQ01, whereas Sceliages hippias has large abundances of Tissierellales.

FIGURE 4.

FIGURE 4

Open in a new tab

Relative abundance of bacterial phyla (A) and families (B) within all dung beetle gut samples analysed. The abundances are further grouped according to their dietary specialisations, with each colour representing a specific bacterial phylum.

The LEfSe analysis indicated various taxa that were characteristically observed within the different dietary specialisations (Figure 5). The dung feeding beetles possessed the least number of characteristic bacterial taxa (two), where all other dietary specialisations possessed four and five. When considering the cladogram, characteristic bacterial taxa were spread throughout, with only a few clades of bacteria grouping together.

FIGURE 5.

FIGURE 5

Open in a new tab

Cladogram of the taxonomic difference between dung beetle dietary specialisations. The circle's diameter at each node is proportional to the taxonomic abundance. The range of colours represents different diets and also corresponds to the marker taxa. The numbers outside the cladogram correspond to the position of each specific bacterial taxon.

4. Discussion

Recent research has shown how diet and phylogeny have a strong contribution to determining the gut bacterial structure within a wide range of insect orders (Kim et al. 2017; Colman et al. 2012; Yun et al. 2014; Huang et al. 2021). The majority of these studies focus on broad comparisons between different insect orders whilst comparing their distinct diets or focus on closely related species feeding on similar or only a few different diets (Yun et al. 2014; Huang et al. 2021). It is, thus, important to investigate the effect of multiple dietary specialisations on closely related species. Dung beetles prove a great model system to investigate the effects of diet on gut microbial community structure, due to their closely relatedness, similar physiologies and wide diet breaths (Scholtz et al. 2009; Scholtz and Chown 1995; Davis et al. 2017). Our results indicate that there is a clear differentiation in bacterial community abundance, diversity and structure between dung beetles specialising on different diets. Furthermore, specialised feeders (millipede feeding beetles) show a remarkably specific gut bacterial community compared to the generalist feeders (dung feeding beetles).

4.1. Gut Bacterial Structure and Diversity

Here we show how the gut bacterial structure within the five different dung beetle dietary specialisations clustered separately, suggesting diet as an important predictor of gut bacterial community composition. This finding is congruent with other studies that indicate diet is an important factor in determining insect gut bacterial structure (Engel and Moran 2013; Colman et al. 2012; Schmidt and Engel 2021; Leite‐Mondin et al. 2021; Yun et al. 2014). This specificity was also observed by another study investigating necrophagous and coprophagous dung beetles. However, the authors claim that dung beetle taxa with varied diets have variable microbiomes. This specificity could be a shared attribute of the order Coleoptera, as studies have reported that beetles' gut microbial structures were significantly similar, unlike the remaining analysed insect groups (Colman et al. 2012). Alternatively, a recent study investigating coprophagous and fungivorous dung beetle gut microbiomes concluded that phylogeny, rather than diet, largely determines their gut bacterial diversity (Ebert et al. 2021). This could, however, arise as a result of investigating many mushroom feeding species, whilst our results indicate that mushroom feeding beetles possess variable gut microbiomes, which could obscure the relationship between diet and phylogeny. Although diet might be a determinant of insect gut bacterial structure, recent evidence highlights how some insect gut microbiomes might be resistant against dietary shifts. For example, the gut microbiome of the American cockroach ( Periplaneta americana ), which stays remarkably consistent between eight different diets, including starvation (Tinker and Ottesen 2016).

The alpha diversity between all dung beetle dietary groups varied considerably. Results indicate that Sceliages brittoni and S. hippias maintain the most specific and least diverse gut bacterial community between all assessed beetle samples (Figure 1). These beetles specialise on millipedes which are commonly known to discharge volatile secretions grouped into alkaloids, quinones, phenols and cyanogenic compounds (Vujisić et al. 2011; Makarov et al. 2010; Kuwahara et al. 2011; Duffey et al. 1977). Recent evidence suggests quinones serve significant antibacterial and antifungal functions, even at the lowest minimum concentrations assessed (Stanković et al. 2016). Furthermore, hydrogen cyanide produced by millipedes are toxic to most biological systems (Duffey et al. 1977; Kuwahara et al. 2011). However, the dung beetle genus, Sceliages, is attracted to these chemical excretions; exclusively hunting and feeding on millipedes (Krell 1999). Keeping this in mind, we hypothesise two potential avenues for how the specific gut microbiome of S. brittoni and S. hippias arose. Firstly, the millipede's defensive secretions could compromise Sceliages' gut, creating an extreme environment within the millipede feeding beetle's gut. This could result in a strong selective pressure, where only a small number of resistant gut bacterial species can persist, leading to a distinct gut bacterial community. As multiple studies have outlined, a myriad of microorganisms detoxify chemical compounds previously thought poisonous to animals, principally cyanide (Harris et al. 1987; Gupta et al. 2010). This alludes to a potential detoxification mechanism for Sceliages, as the method of intoxication avoidance by millipede feeding insects is yet undescribed (Weary and Will 2020). Multiple insect species avoid intoxication by plant semiochemicals through detoxification from their native gut microbiomes, thus, it is not unreasonable to assume a similar system could prevail within Sceliages (Itoh et al. 2018; Ceja‐Navarro et al. 2015; Wu et al. 2020). Alternatively, the potency of the millipede defence sections could prevent bacteria from colonising Sceliages' gut. The millipede feeding beetle, could subsequently avoid intoxication via a physiological mechanism and avoid reliance on bacterial symbionts (Van Ohlen et al. 2017). Not all insects are reported to utilise a symbiotic gut microbiome and it is not required for all insects' successful functioning (Hammer et al. 2017). Unfortunately, this study is limited by its capacity to perform functional analyses on the bacterial communities present within the millipede feeding beetle gut, leaving us to speculate as to why we observe this specific community. Future studies should consider the functional and metabolic profile of Sceliages' gut microbiome in an attempt to determine their mechanism for cyanide or quinone detoxification. Previous analyses on a diverse array of insects conclude how omnivorous insects possessed a significantly more diverse gut microbiome compared to herbivorous and carnivorous insect species (Yun et al. 2014). Furthermore, studies also mention how specialist feeders possess a more specific gut microbiome compared to generalist feeders (Chen et al. 2022; Brunetti et al. 2022). The dry dung/detritus and carrion feeding groups assessed in this study seem to follow the above hypotheses. Our results follow this same trend, as the carnivorous specialists, Sceliages brittoni and S. hippias, both possess very specific gut microbiomes. Quite contradictory, the hyrax dung specialist, Dicranocara sp.1, possessed a diverse and rich gut microbiome, more diverse than is expected of a specialist insect (Brunetti et al. 2022). These coprophagous beetles could possess a diverse gut bacterial community due to the large numbers of microorganisms present within their food source, leading to an overabundance of transient bacteria within their guts (Kennedy et al. 2020).

A previous study by Ebert et al. (2021) further showed how generalist mushroom and coprophagous dung beetles possessed a diverse gut bacterial community. This could explain why the mushroom feeding species in our study, Coptorhina klugii, possessed such a variable gut microbiome stretching across different dietary specialisations (Figure 2). Coptorhina klugii is the most basal lineage in the South African dung beetle phylogeny and is considered to be ancestral in their feeding habits (Scholtz and Chown 1995; Mlambo et al. 2015). The dietary switch from fungivory to coprophagy only occurred later in the evolutionary history of dung beetles (Scholtz and Chown 1995). Microbial symbionts' involvement in this dietary switch is yet unknown; however, some recent evidence points to the idea that ancient bacterial symbionts accommodated the diversification of different beetle lineages. Engl et al. (2018) indicates how convergent acquisitions of ancient bacterial symbionts allow for key adaptations in beetle hosts, which could have led to the diversification of ancient wood and grain feeding beetles. The results indicate that C. klugii has a varied gut microbiome that overlaps with different dietary groups. As often suggested in generalists, a varied gut microbiome permits a large metabolic potential, allowing generalist insects to exploit multiple food sources (Brunetti et al. 2022). Therefore, we hypothesise that the varied gut microbiome present in ancient dung beetles, such as that of C. klugii , could accommodate the diversification of diets observed within the dung beetle phylogeny through the provisioning of an increased metabolic potential. The degree to which an insect's microbiome contributes to the host's evolutionary history depends on a multitude of factors, such as ubiquity, specificity and gene size of symbionts. Although difficult to study, future attempts at investigating this phenomenon in dung beetles should focus on phylogenetic inference and dating of bacterial symbionts throughout the Scarabaeinae lineage.

4.2. Marker Bacterial Taxa Associated With Each Diet

This study also sheds light on the bacterial families present within the dung beetle gastrointestinal tract. The bacterial families within and between different dung beetle dietary specialisation varied considerably, although some families seem common within one dietary group (Figure 4). Such as the large proportion of Dysgonomonadaceae in the dung feeding group or the consistent Tissierellales, Lactobacillales and Peptoniphilaceae observed in the mushroom feeding species. The dung beetle diets assessed in this study comprise microbial rich food sources. Some of the variation could arise due to transient bacteria that persisted in the dung beetle guts. Further increasing the dung beetle species and sample sizes could unearth a more obvious pattern of observed ASV within each dietary group.

The LEfSe analyses indicate several bacterial taxa that are indicative of each dung beetle dietary specialisation (Figure 5). Although species classification of bacteria is difficult with short read sequences, it still provides an interesting overview of potential taxa present with the dung beetle guts. Bacterial markers for carrion feeding beetles include unclassified Kurthia, Lactobacillales, Vagococcaceae and the species Ignatzschineria indica . Specifically, I. indica is a non‐motile gram‐positive aerobe that was first isolated from the gut of spotted flesh fly larvae in India; Wohlfahrtia magnifica is an obligate parasitic fly that infests open wounds and flesh of mammals through myiasis (Gupta et al. 2011; Snyder et al. 2020; Kokcam and Saki 2005; Toth et al. 2008). The bacterium I. indica has been identified in multiple dipteran hosts and has not yet been linked to any symbiosis with its insect hosts (Snyder et al. 2020; Lysaght et al. 2018). Ignatzschineria indica , in tandem with Wohlfahrtiimonas chitiniclastica , are considered emerging human pathogens according to multiple studies, as the bacterium has been linked to infections, or even septic shock, in patients invaded by flesh fly larvae (Lysaght et al. 2018; Snyder et al. 2020; Kokcam and Saki 2005). It is unclear if I. indica is transient within carrion feeding insects. It is, however, not unexpected to observe this gut bacterium shared between the different insect orders, due to the similarity of flesh fly and carrion feeding beetle diets (i.e., meat). Although the symbiotic nature of this bacterium is undescribed, its consistent isolation in flesh feeding insects should spark inquiry into the functional relationship between I. indica and its host, especially given the emergent pathogenic nature of the bacterium.

The marker bacteria suggested for detritus feeding beetles are unclassified Vagococcus, Ruminococcaceae, Rikenellaceae, Bacteroides sp010501015 and the species Miniphocaeibacter massiliensis. Very little is known about the non‐motile anaerobic gram‐positive bacterium M. massiliensis, isolated from a biogas digester (utilised in the decomposition of organic matter) and human faecal samples (Schnürer et al. 2022; Munson and Carroll 2023; Bilen et al. 2019). This bacterium is characterised by its ammonium tolerance and metabolic pathway that produces acetate (Schnürer et al. 2022). Species from the Vagococcus have also been isolated from multiple insect gut samples ranging from flies (Guzman et al. 2023) to diving beetles (Hyun et al. 2021). Their symbiotic relationship with insects is yet unknown; however, their regularity in being isolated from insect guts would suggest an association between the bacterium and host. Previous research suggests bacterial symbionts aid detritus feeding beetles in the digestion of lignocellulosic diets, such as in the detritus feeding fly larvae of Tipula abdominalis (Cook et al. 2007; Engel and Moran 2013).

The dung feeding beetles are only characterised by two markers, an unclassified Proteiniphilum and Anaerosphaera aminiphila . Anaerosphaera aminiphila is a non‐motile gram‐positive anaerobic bacterium isolated from a methanogenic reactor treating waste from cattle farms (Ueki et al. 2009). This bacterium excels at glutamate degradation (Ueki et al. 2009). The genus Anaerosphaera is well documented among mammal faecal isolates and would be expected to correspond to the coprophagous beetle gut (Rettenmaier et al. 2019; Johnson et al. 2014; Takakura et al. 2020). However, the ubiquity of this genus in animal dung suggests this bacterial species could either be important for dung beetle digestion of glutamate or is transient rather than a core gut symbiont.

The millepede feeding beetles possess the most well classified collection of bacterial markers between all diets namely; Andreesenia angusta, Spiroplasma ixodetis , Skermanella aerolata , Wohlfahrtiimonas chitiniclastica and an unclassified Providencia species. Andreesenia angusta is a gram‐positive anaerobic purine‐fermenting bacteria (Poehlein et al. 2017). High abundances of the bacterium S. ixodetis is observed within our millepede feeding samples (Figure 5), S. ixodetis was first isolated in the western black‐legged tick, Ixodes pacificus (Tully et al. 1995). Fascinatingly, S. ixodetis is a maternally inherited bacterium isolated across multiple insect orders and can be lethal to males in certain arthropod species (Jiggins et al. 2000; Tabata et al. 2011; Tinsley and Majerus 2006). Studies suggest S. ixodetis possess features of endosymbionts associated with arthropods, due to their incomplete virulence factors and enrichment of type IV secretion systems (Vera‐Ponce León et al. 2021). Although the bacterium's symbiotic functionality remains largely unknown, recent phylogenetic evidence suggests this bacterium has undergone repeated horizontal transfers between different insect and tick species (Binetruy et al. 2019). This study also demonstrated that the male killing ability of this bacterium might be taxon specific, as both male and female arthropods sequenced in this study, possessed this symbiont. Skermanella aerolata is a gram‐negative motile aerobic bacterium first isolated from air samples (Weon et al. 2007). Studies have shown the ability of this genus as a biocontrol larvicide for rice crop pests (Panneerselvam et al. 2018). This bacterium has also been isolated in other insect gut samples, however, no link to its symbiotic ability has been produced (Valiente Moro et al. 2013). Wohlfahrtiimonas chitiniclastica is yet another bacterium similar to I. indica associated with flesh fly (Wohlfahrtia) myiasis, and is considered an emergent human pathogen. This bacterium, however, has been suggested to act symbiotically in insects through strong chitinase activity (Toth et al. 2008; Tóth et al. 2001; Gassner et al. 2019). No study has looked into the mechanism of this symbiosis, we can however speculate that this would be useful in digestion when feeding on chitin rich pray, such a millipede (Liu et al. 2022). Furthermore, chitinase activity could be beneficial to these insects in regulating their immune systems (Engel and Moran 2013).

The mushroom feeding species largely harboured unclassified bacterial marker taxa. Specifically, they possessed unclassified Peptoniphilaceae, Tissierellales, Neisseriaceae and Lactococcus. This is unsurprising as the mushroom feeding beetles seem to possess a varied and unspecific gut microbiome (Figure 1), with their gut bacterial structure overlapping across different diets (Figure 2). Previous studies on fungivorous dipterans also noted the highly variable gut bacterial structure between and within different sympatric fly species (Martinson et al. 2017). This could indicate that the gut microbiome of fungivorous insects is largely environmentally acquired (Kikuchi et al. 2007). Furthermore, this study did not assess dung beetle gut fungi, which could undertake a significant role in the successful functioning of fungivorous insects' gut microbiomes. Although some studies have assessed insect gut fungi and have found it to be quite variable, transient and largely influenced by the environment, and at worst, antagonistic (Ruiz Barrionuevo et al. 2022; Šigut et al. 2022; Wang et al. 2022; Di Lelio et al. 2023).

The differences between the various dung beetle diets are stark in terms of diversity and marker taxa. Some of the taxa observed within each dietary specialisation are indicative of bacteria living on or within the food source, such as the genus Anaerosphaera commonly isolated from mammalian dung. Interestingly, those with similar feeding preferences seem to possess similar bacterial communities. If we use the carrion dung beetles as an example, the indicative bacterial species I. indica has been identified in various insect taxa that feed on flesh. Even if no clear symbiotic relationship is yet described, the fact that this bacterium is consistently isolated across taxonomic orders requires further inquiry. Such patterns suggest that diet acts as a strong ecological filter shaping microbial community assembly, favouring bacteria capable of tolerating or exploiting the biochemical environment of specific food substrates. Over evolutionary time, repeated exposure to these microbial consortia may facilitate host‐microbe coadaptation, where transient environmental bacteria become more persistent or functionally integrated within the gut. This process could contribute to the diversification of feeding strategies in dung beetles by enabling the efficient use of nutritionally or chemically distinct food resources. Understanding these ecological and evolutionary interactions between diet, microbes and host physiology will be key to revealing how microbial partnerships have influenced dung beetle adaptation and niche expansion.

5. Conclusion

This study reports on the detailed investigation of seven dung beetle species feeding on five different dietary specialisations, adding to the literature describing factors determining the insect gut microbiome. Ultimately, this study shows that the dung beetle gut microbiome is largely determined by their dietary specialisations. It is clear that multiple factors, such as phylogeny and geographic location, can have considerable consequences for the insect gut microbiome, such as the case between S. brittoni and S. hippias; however, our results indicate that diet was, nevertheless, a larger predictor of gut bacterial diversity within dung beetle species. This is apparent when considering that most of the observed dietary specialisations are nested within themselves, excluding the mushroom feeding species, which stretch across two other diets. Furthermore, our results indicate that the carnivorous millipede feeding genus, Sceliages, possessed the most specific and least diverse gut bacterial community. We hypothesise that this is largely due to the defensive secretions produced by their prey species, millipedes. This study also identified certain marker taxa that were characteristic of each dietary specialisation. The gut microbiomes of the seven dung beetle species are conserved, and their observed nestedness across different diets highlights the crucial role that gut bacterial communities play in various dung beetle feeding specialisations. The scope of this study only characterised bacterial taxa; however, gut microbial communities are diverse and complex. The exploration of fungi could reveal their significant role in dung beetle gut microbiomes and shed light on the successful functioning of fungivorous insects. Furthermore, functional predictions are ineffective when utilising the relatively short bacterial 16S rRNA marker gene region, therefore, dedicated functional analyses of the gut microbiomes would be important. Especially considering the shift in the field of gut microbiomes towards functional capacity instead of taxonomic diversity. Challenges in collecting and sequencing rare dung beetle species resulted in low replication for some dietary groups. However, the sample size between dietary groups is sufficiently informative and robust to observe important patterns within the dung beetle gut microbiome and their respective diets. Identification is the first step to characterising the function of the dung beetle gut microbial system.

Author Contributions

Johann C. de Beer: investigation, formal analysis, visualisation and writing – original draft. Kazeem A. Alayande: investigation, data curation, visualisation and writing – review and editing. Christian W. W. Pirk: conceptualisation, supervision and writing – review and editing. Rasheed A. Adeleke: funding acquisition, resources, supervision and writing – review and editing. Catherine L. Sole: conceptualisation, project administration, supervision and writing – review and editing.

Funding

This work was supported by the National Research Foundation of South Africa, 98696, SRUG220326856 and South Africa Sweden University Forum.

Ethics Statement

The authors received ethics approval for the following research, which adheres to the University of Pretoria's Code of Ethics for Researcher and the Policy guidelines (application number NAS078/2021).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Data S1: Supporting Information.

EMI4-18-e70317-s001.docx (5.7MB, docx)

Acknowledgements

We thank Kara du Plessis, Frederich Henneke, Christian Deschodt and Clarke Scholtz for their invaluable assistance with fieldwork and dung beetle collection. We would also like to acknowledge the anonymous reviewers whose comments greatly benefited this manuscript. The author(s) declare financial support was received. This work was supported by the National Research Foundation of South Africa (Grant Unique Numbers 98696 and SRUG220326856) and the South Africa Sweden University Forum.

Data Availability Statement

The raw data that support the findings of this study are openly available in the SRA database at https://dataview.ncbi.nlm.nih.gov/object/PRJNA1249453, reference number PRJNA1249453.

References

  1. Anderson, M. J. , Balakrishnan N., Everitt T. C. B., et al. 2017. “Permutational Multivariate Analysis of Variance (PERMANOVA).” Wiley Statsref: Statistics Reference Online, 1–15. John Wiley & Sons. [Google Scholar]
  2. Bilen, M. , Mbogning Fonkou M. D., Nguyen T. T., et al. 2019. “ Miniphocibacter massiliensis Gen. Nov., sp. Nov., a New Species Isolated From the Human Gut and Its Taxono‐Genomics Description.” Microbiology 8: e00735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Binetruy, F. , Bailly X., Chevillon C., Martin O. Y., Bernasconi M. V., and Duron O.. 2019. “Phylogenetics of the Spiroplasma ixodetis Endosymbiont Reveals Past Transfers Between Ticks and Other Arthropods.” Ticks and Tick‐Borne Diseases 10: 575–584. [DOI] [PubMed] [Google Scholar]
  4. Bolyen, E. , Rideout J. R., Dillon M. R., et al. 2019. “Reproducible, Interactive, Scalable and Extensible Microbiome Data Science Using QIIME 2.” Nature Biotechnology 37: 852–857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brunetti, M. , Magoga G., Gionechetti F., De Biase A., and Montagna M.. 2022. “Does Diet Breadth Affect the Complexity of the Phytophagous Insect Microbiota? The Case Study of Chrysomelidae.” Environmental Microbiology 24: 3565–3579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Callahan, B. J. , Mcmurdie P. J., Rosen M. J., Han A. W., Johnson A. J. A., and Holmes S. P.. 2016. “DADA2: High‐Resolution Sample Inference From Illumina Amplicon Data.” Nature Methods 13: 581–583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ceja‐Navarro, J. A. , Vega F. E., Karaoz U., et al. 2015. “Gut Microbiota Mediate Caffeine Detoxification in the Primary Insect Pest of Coffee.” Nature Communications 6: 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chang, F. , He S., and Dang C.. 2022. “Assisted Selection of Biomarkers by Linear Discriminant Analysis Effect Size (LEfSe) in Microbiome Data.” Journal of Visualized Experiments 183: e61715. [DOI] [PubMed] [Google Scholar]
  9. Chen, B. , Teh B.‐S., Sun C., et al. 2016. “Biodiversity and Activity of the Gut Microbiota Across the Life History of the Insect Herbivore Spodoptera Littoralis.” Scientific Reports 6: 29505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen, J.‐S. , Tsaur S.‐C., Ting C.‐T., and Fang S.. 2022. “Dietary Utilization Drives the Differentiation of Gut Bacterial Communities Between Specialist and Generalist Drosophilid Flies.” Microbiology Spectrum 10: e01418‐22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chen, Z. , Hui P. C., Hui M., et al. 2019. “Impact of Preservation Method and 16S rRNA Hypervariable Region on Gut Microbiota Profiling.” mSystems 4: e00271‐18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Colman, D. R. , Toolson E. C., and Takacs‐Vesbach C.. 2012. “Do Diet and Taxonomy Influence Insect Gut Bacterial Communities?” Molecular Ecology 21: 5124–5137. [DOI] [PubMed] [Google Scholar]
  13. Davis, A. L. , Deschodt C. M., and Scholtz C. H.. 2020. Conservation Assessment of Scarabaeine Dung Beetles in South Africa, Botswana and Namibia: IUCN Red List Categories, Atlas and Ecological Notes. South African National Biodiversity Institute. [Google Scholar]
  14. Davis, A. L. , Scholtz C. H., and Sole C. L.. 2017. “Biogeographical and Co‐Evolutionary Origins of Scarabaeine Dung Beetles: Mesozoic Vicariance Versus Cenozoic Dispersal and Dinosaur Versus Mammal Dung.” Biological Journal of the Linnean Society 120: 258–273. [Google Scholar]
  15. Deschodt, C. M. , Scholtz C. H., and Kryger U.. 2007. “New Taxa of Relictual Canthonini Dung Beetles (Scarabaeidae: Scarabaeinae) Utilizing Rock Hyrax Middens as Refuges in South‐Western Africa.” Insect Systematics & Evolution 38: 361–376. [Google Scholar]
  16. Di Lelio, I. , Forni G., Magoga G., et al. 2023. “A Soil Fungus Confers Plant Resistance Against a Phytophagous Insect by Disrupting the Symbiotic Role of Its Gut Microbiota.” Proceedings of the National Academy of Sciences 120: e2216922120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Dinno, A. 2015. “Nonparametric Pairwise Multiple Comparisons in Independent Groups Using Dunn's Test.” Stata Journal 15: 292–300. [Google Scholar]
  18. Duffey, S. , Blum M., Fales H., et al. 1977. “Benzoyl Cyanide and Mandelonitrile Benzoate in the Defensive Secretions of Millipedes.” Journal of Chemical Ecology 3: 101–113. [Google Scholar]
  19. Ebert, K. M. , Arnold W. G., Ebert P. R., and Merritt D. J.. 2021. “Hindgut Microbiota Reflects Different Digestive Strategies in Dung Beetles (Coleoptera: Scarabaeidae: Scarabaeinae).” Applied and Environmental Microbiology 87: e02100‐20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Engel, P. , and Moran N. A.. 2013. “The Gut Microbiota of Insects–Diversity in Structure and Function.” FEMS Microbiology Reviews 37: 699–735. [DOI] [PubMed] [Google Scholar]
  21. Engl, T. , Eberl N., Gorse C., et al. 2018. “Ancient Symbiosis Confers Desiccation Resistance to Stored Grain Pest Beetles.” Molecular Ecology 27: 2095–2108. [DOI] [PubMed] [Google Scholar]
  22. Forgie, S. A. , Grebennikov V. V., and Scholtz C. H.. 2002. “Revision of Sceliages Westwood, a Millipede‐Eating Genus of Southern African Dung Beetles (Coleoptera: Scarabaeidae).” Invertebrate Systematics 16: 931–955. [Google Scholar]
  23. Franzini, P. Z. , Ramond J.‐B., Scholtz C. H., Sole C. L., Ronca S., and Cowan D. A.. 2016. “Correction: The Gut Microbiomes of Two Pachysoma MacLeay Desert Dung Beetle Species (Coleoptera: Scarabaeidae: Scarabaeinae) Feeding on Different Diets.” PLoS One 11: e0165376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Frolov, A. V. , Akhmetova L. A., and Scholtz C. H.. 2008. “Revision of the Obligate Mushroom‐Feeding African Dung Beetle Genus Coptorhina Hope (Coleoptera: Scarabaeidae: Scarabaeinae).” Journal of Natural History 42: 1477–1508. [Google Scholar]
  25. Gao, H. H. , Zhao S., Wang R. J., et al. 2023. “Gut Bacterium Promotes Host Fitness in Special Ecological Niche by Affecting Sugar Metabolism in Drosophila Suzukii.” Insect Science 0: 1–21. [DOI] [PubMed] [Google Scholar]
  26. Gassner, G. , Duh F.‐M., and Bromel M.. 2019. “Chitinolytic Activity: A Prelude to a Symbiotic Relationship Between Bacteria and the Screwworm Fly? Intracellular Space as Oligogenetic Ecosystem.” In Proceedings. De Gruyter, 2, 802–807.
  27. Groussin, M. , Mazel F., and Alm E. J.. 2020. “Co‐Evolution and Co‐Speciation of Host‐Gut Bacteria Systems.” Cell Host & Microbe 28: 12–22. [DOI] [PubMed] [Google Scholar]
  28. Gupta, A. K. , Dharne M. S., Rangrez A. Y., et al. 2011. “ Ignatzschineria indica sp. Nov. and Ignatzschineria ureiclastica sp. Nov., Isolated From Adult Flesh Flies (Diptera: Sarcophagidae).” International Journal of Systematic and Evolutionary Microbiology 61: 1360–1369. [DOI] [PubMed] [Google Scholar]
  29. Gupta, N. , Balomajumder C., and Agarwal V.. 2010. “Enzymatic Mechanism and Biochemistry for Cyanide Degradation: A Review.” Journal of Hazardous Materials 176: 1–13. [DOI] [PubMed] [Google Scholar]
  30. Guzman, J. , Poehlein A., Daniel R., Kämpfer P., and Vilcinskas A.. 2023. “ Vagococcus luciliae sp. Nov., Isolated From the Common Green Bottle Fly Lucilia Sericata.” International Journal of Systematic and Evolutionary Microbiology 73: 005787. [DOI] [PubMed] [Google Scholar]
  31. Hammer, T. J. , Dickerson J. C., and Fierer N.. 2015. “Evidence‐Based Recommendations on Storing and Handling Specimens for Analyses of Insect Microbiota.” PeerJ 3: e1190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Hammer, T. J. , Janzen D. H., Hallwachs W., Jaffe S. P., and Fierer N.. 2017. “Caterpillars Lack a Resident Gut Microbiome.” Proceedings of the National Academy of Sciences 114: 9641–9646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Hanski, I. , and Cambefort Y.. 2014. Dung Beetle Ecology. Princeton University Press. [Google Scholar]
  34. Harris, R. E. , Bunch A. W., and Knowles C. J.. 1987. “Microbial Cyanide and Nitrile Metabolism.” Science Progress 71: 293–304. [Google Scholar]
  35. Huang, K. , Wang J., Huang J., et al. 2021. “Host Phylogeny and Diet Shape Gut Microbial Communities Within Bamboo‐Feeding Insects.” Frontiers in Microbiology 12: 633075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Hyun, D.‐W. , Tak E. J., Kim P. S., and Bae J.‐W.. 2021. “Description of Vagococcus coleopterorum sp. Nov., Isolated From the Intestine of the Diving Beetle, Cybister lewisianus, and Vagococcus hydrophili sp. Nov., Isolated From the Intestine of the Dark Diving Beetle, Hydrophilus Acuminatus, and Emended Description of the Genus Vagococcus.” Journal of Microbiology 59: 132–141. [DOI] [PubMed] [Google Scholar]
  37. Itoh, H. , Tago K., Hayatsu M., and Kikuchi Y.. 2018. “Detoxifying Symbiosis: Microbe‐Mediated Detoxification of Phytotoxins and Pesticides in Insects.” Natural Product Reports 35: 434–454. [DOI] [PubMed] [Google Scholar]
  38. Jácome‐Hernández, A. , Lamelas A., Desgarennes D., Huerta C., Cruz‐Rosales M., and Favila M. E.. 2023. “Influence of Phylogenetic, Environmental, and Behavioral Factors on the Gut Bacterial Community Structure of Dung Beetles (Scarabaeidae: Scarabaeinae) in a Neotropical Biosphere Reserve.” Frontiers in Microbiology 14: 1224601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Jang, S. , and Kikuchi Y.. 2020. “Impact of the Insect Gut Microbiota on Ecology, Evolution, and Industry.” Current Opinion in Insect Science 41: 33–39. [DOI] [PubMed] [Google Scholar]
  40. Jiggins, F. , Hurst G., Jiggins C., Vd Schulenburg J., and Majerus M.. 2000. “The Butterfly Danaus Chrysippus Is Infected by a Male‐Killing Spiroplasma Bacterium.” Parasitology 120: 439–446. [DOI] [PubMed] [Google Scholar]
  41. Jing, T.‐Z. , Qi F.‐H., and Wang Z.‐Y.. 2020. “Most Dominant Roles of Insect Gut Bacteria: Digestion, Detoxification, or Essential Nutrient Provision?” Microbiome 8: 1–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Johnson, C. N. , Whitehead T. R., Cotta M. A., Rhoades R. E., and Lawson P. A.. 2014. “ Peptoniphilus stercorisuis sp. Nov., Isolated From a Swine Manure Storage Tank and Description of Peptoniphilaceae Fam. Nov.” International Journal of Systematic and Evolutionary Microbiology 64: 3538–3545. [DOI] [PubMed] [Google Scholar]
  43. Kennedy, S. R. , Tsau S., Gillespie R., and Krehenwinkel H.. 2020. “Are You What You Eat? A Highly Transient and Prey‐Influenced Gut Microbiome in the Grey House Spider Badumna longinqua .” Molecular Ecology 29: 1001–1015. [DOI] [PubMed] [Google Scholar]
  44. Kikuchi, Y. , Hosokawa T., and Fukatsu T.. 2007. “Insect‐Microbe Mutualism Without Vertical Transmission: A Stinkbug Acquires a Beneficial Gut Symbiont From the Environment Every Generation.” Applied and Environmental Microbiology 73: 4308–4316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Kim, J. M. , Choi M.‐Y., Kim J.‐W., et al. 2017. “Effects of Diet Type, Developmental Stage, and Gut Compartment in the Gut Bacterial Communities of Two Cerambycidae Species (Coleoptera).” Journal of Microbiology 55: 21–30. [DOI] [PubMed] [Google Scholar]
  46. Kokcam, I. , and Saki C. E.. 2005. “A Case of Cutaneous Myiasis Caused by Wohlfahrtia magnifica .” Journal of Dermatology 32: 459–463. [DOI] [PubMed] [Google Scholar]
  47. Krell, F. 1999. “Southern African Dung Beetles (Coleoptera: Scarabaeidae) Attracted by Defensive Secretions of Diplopoda.” African Entomology 7: 287–288. [Google Scholar]
  48. Kruskal, W. H. , and Wallis W. A.. 1952. “Use of Ranks in One‐Criterion Variance Analysis.” Journal of the American Statistical Association 47: 583–621. [Google Scholar]
  49. Kuwahara, Y. , Shimizu N., and Tanabe T.. 2011. “Release of Hydrogen Cyanide via a Post‐Secretion Schotten‐Baumann Reaction in Defensive Fluids of Polydesmoid millipedes .” Journal of Chemical Ecology 37: 232–238. [DOI] [PubMed] [Google Scholar]
  50. Leite‐Mondin, M. , Dilegge M., Manter D., Weir T., Silva‐Filho M. D. C., and Vivanco J.. 2021. “The Gut Microbiota Composition of Trichoplusia ni Is Altered by Diet and May Influence Its Polyphagous Behavior.” Scientific Reports 11: 5786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Liu, X. Y. , Wang S. S., Zhong F., et al. 2022. “Chitinase (CHI) of Spodoptera frugiperda Affects Molting Development by Regulating the Metabolism of Chitin and Trehalose.” Frontiers in Physiology 13: 1034926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Love, M. , Anders S., and Huber W.. 2014. “Differential Analysis of Count Data–the DESeq2 Package.” Genome Biology 15: 10–1186. [Google Scholar]
  53. Lysaght, T. B. , Wooster M. E., Jenkins P. C., and Koniaris L. G.. 2018. “Myiasis‐Induced Sepsis: A Rare Case Report of Wohlfahrtiimonas chitiniclastica and Ignatzschineria indica Bacteremia in the Continental United States.” Medicine 97: e13627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Ma, M. , Tu C., Luo J., Lu M., Zhang S., and Xu L.. 2021. “Metabolic and Immunological Effects of Gut Microbiota in Leaf Beetles at the Local and Systemic Levels.” Integrative Zoology 16: 313–323. [DOI] [PubMed] [Google Scholar]
  55. Makarov, S. E. , Ćurčić B. P., Tešević V. V., et al. 2010. “Defensive Secretions in Three Species of Polydesmids (Diplopoda, Polydesmida, Polydesmidae).” Journal of Chemical Ecology 36: 978–982. [DOI] [PubMed] [Google Scholar]
  56. Martinson, V. G. , Douglas A. E., and Jaenike J.. 2017. “Community Structure of the Gut Microbiota in Sympatric Species of Wild Drosophila.” Ecology Letters 20: 629–639. [DOI] [PubMed] [Google Scholar]
  57. Mcdonald, D. , Jiang Y., Balaban M., et al. 2022. “Greengenes2 Enables a Shared Data Universe for Microbiome Studies.” bioRxiv. 2022.12. 19.520774.
  58. Mcmurdie, P. J. , and Holmes S.. 2013. “Phyloseq: An R Package for Reproducible Interactive Analysis and Graphics of Microbiome Census Data.” PLoS One 8: e61217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Mlambo, S. , Sole C. L., and Scholtz C. H.. 2015. “A Molecular Phylogeny of the African Scarabaeinae (Coleoptera: Scarabaeidae).” Arthropod Systematics & Phylogeny 73: 303–321. [Google Scholar]
  60. Munson, E. , and Carroll K. C.. 2023. “Update on Accepted Novel Bacterial Isolates Derived From Human Clinical Specimens and Taxonomic Revisions Published in 2020 and 2021.” Journal of Clinical Microbiology 61: e00282‐22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Oksanen, J. , Blanchet F. G., Friendly M., et al. 2019. “Package Vegan.” Community Ecology Package, Version, 2.
  62. Panneerselvam, P. , Kumar U., Sahu S., et al. 2018. “Larvicidal Potential of Skermanella sp. Against Rice Leaf Folder (Cnaphalocrosis medinalis Guenee) and Pink Stem Borer (Sesamia inferens Walker).” Journal of Invertebrate Pathology 157: 74–79. [DOI] [PubMed] [Google Scholar]
  63. Poehlein, A. , Yutin N., Daniel R., and Galperin M. Y.. 2017. “Proposal for the Reclassification of Obligately Purine‐Fermenting Bacteria Clostridium acidurici (Barker 1938) and Clostridium purinilyticum (Dürre et al. 1981) as Gottschalkia acidurici Gen. Nov. Comb. Nov. and Gottschalkia purinilytica Comb. Nov. and of Eubacterium angustum (Beuscher and Andreesen 1985) as Andreesenia angusta Gen. Nov. Comb. Nov. in the Family Gottschalkiaceae Fam. Nov.” International Journal of Systematic and Evolutionary Microbiology 67: 2711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Prasanna, V. A. , Kayalvizhi N., Rameshkumar N., Suganya T., and Krishnan M.. 2014. “Characterization of Amylase Producing Bacillus megaterium From the Gut Microbiota of Silkworm Bombyx mori .” Research Journal of Chemistry and Environment 18: 38–45. [Google Scholar]
  65. Ravigné, V. , Becker N., Massol F., et al. 2022. “Fruit Fly Phylogeny Imprints Bacterial Gut Microbiota.” Evolutionary Applications 15: 1621–1638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Rettenmaier, R. , Neuhaus K., Liebl W., and Zverlov V. V.. 2019. “Draft Genome Sequence of Anaerosphaera sp. Strain GS7‐6‐2, a Coccal Bacterium Isolated From a Biogas‐Related Environment.” Microbiology Resource Announcements 8: e00205‐19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Ruiz Barrionuevo, J. M. , Vilanova‐Cuevas B., Alvarez A., et al. 2022. “The Bacterial and Fungal Gut Microbiota of the Greater Wax Moth, Galleria Mellonella L. Consuming Polyethylene and Polystyrene.” Frontiers in Microbiology 13: 918861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Santos‐Garcia, D. , Mestre‐Rincon N., Zchori‐Fein E., and Morin S.. 2020. “Inside Out: Microbiota Dynamics During Host‐Plant Adaptation of Whiteflies.” ISME Journal 14: 847–856. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Schmidt, K. , and Engel P.. 2021. “Mechanisms Underlying Gut Microbiota–Host Interactions in Insects.” Journal of Experimental Biology 224: jeb207696. [DOI] [PubMed] [Google Scholar]
  70. Schnürer, A. , Singh A., Bi S., Qiao W., and Westerholm M.. 2022. “Miniphocaeibacter Halophilus sp. Nov., an Ammonium‐Tolerant Acetate‐Producing Bacterium Isolated From a Biogas System.” International Journal of Systematic and Evolutionary Microbiology 72: 005328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Scholtz, C. 1989. “Unique Foraging Behaviour in Pachysoma (= Scarabaeus) Striatum Castelnau (Coleoptera: Scarabaeidae): An Adaptation to Arid Conditions?” Journal of Arid Environments 16: 305–313. [Google Scholar]
  72. Scholtz, C. , and Chown S.. 1995. “The Evolution of Habitat Use and Diet in the Scarabaeoidea: A Phylogenetic Approach in: Biology, Phylogeny and Classification of Coleoptera.” Papers Celebrating the 80th Birthday of Roy A. Museum i Instytut Zoologii PAN, Warsaw,Crowson, 355–374.
  73. Scholtz, C. H. , Davis A. L. V., and Kryger U.. 2009. Evolutionary Biology and Conservation of Dung Beetles. Pensoft. [Google Scholar]
  74. Schwab, D. B. , Riggs H. E., Newton I. L., and Moczek A. P.. 2016. “Developmental and Ecological Benefits of the Maternally Transmitted Microbiota in a Dung Beetle.” American Naturalist 188: 679–692. [DOI] [PubMed] [Google Scholar]
  75. Shapira, M. 2016. “Gut Microbiotas and Host Evolution: Scaling Up Symbiosis.” Trends in Ecology & Evolution 31: 539–549. [DOI] [PubMed] [Google Scholar]
  76. Shukla, S. P. , and Beran F.. 2020. “Gut Microbiota Degrades Toxic Isothiocyanates in a Flea Beetle Pest.” Molecular Ecology 29: 4692–4705. [DOI] [PubMed] [Google Scholar]
  77. Šigut, M. , Pyszko P., Šigutová H., et al. 2022. “Fungi Are More Transient Than Bacteria in Caterpillar Gut Microbiomes.” Scientific Reports 12: 15552. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Sikorska‐Zimny, K. , and Beneduce L.. 2021. “The Metabolism of Glucosinolates by Gut Microbiota.” Nutrients 13: 2750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Snyder, S. , Singh P., and Goldman J.. 2020. “Emerging Pathogens: A Case of Wohlfahrtiimonas chitiniclastica and Ignatzschineria indica Bacteremia.” IDCases 19: e00723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Stanković, S. , Dimkić I., Vujisić L., et al. 2016. “Chemical Defence in a Millipede: Evaluation and Characterization of Antimicrobial Activity of the Defensive Secretion From Pachyiulus hungaricus (Karsch, 1881) (Diplopoda, Julida, Julidae).” PLoS One 11: e0167249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Tabata, J. , Hattori Y., Sakamoto H., et al. 2011. “Male Killing and Incomplete Inheritance of a Novel Spiroplasma in the Moth Ostrinia Zaguliaevi.” Microbial Ecology 61: 254–263. [DOI] [PubMed] [Google Scholar]
  82. Takakura, T. , Francis R., Anani H., Bilen M., Raoult D., and Khalil J. B.. 2020. “ Anaerosphaera massiliensis sp. Nov., a New Bacterium Isolated From the Stool of a 39‐Year‐Old Pygmy.” New Microbes New Infections 33: 100633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Thompson, L. R. , Sanders J. G., Mcdonald D., et al. 2017. “A Communal Catalogue Reveals Earth's Multiscale Microbial Diversity.” Nature 551: 457–463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Tinker, K. A. , and Ottesen E. A.. 2016. “The Core Gut Microbiome of the American Cockroach, Periplaneta americana , Is Stable and Resilient to Dietary Shifts.” Applied and Environmental Microbiology 82: 6603–6610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  85. Tinsley, M. , and Majerus M.. 2006. “A New Male‐Killing Parasitism: Spiroplasma Bacteria Infect the Ladybird Beetle Anisosticta Novemdecimpunctata (Coleoptera: Coccinellidae).” Parasitology 132: 757–765. [DOI] [PubMed] [Google Scholar]
  86. Toth, E. M. , Schumann P., Borsodi A. K., Keki Z., Kovacs A. L., and Marialigeti K.. 2008. “ Wohlfahrtiimonas chitiniclastica Gen. Nov., Sp. Nov., a New Gammaproteobacterium Isolated From Wohlfahrtia magnifica (Diptera: Sarcophagidae).” International Journal of Systematic and Evolutionary Microbiology 58: 976–981. [DOI] [PubMed] [Google Scholar]
  87. Tóth, E. , Kovács G., Schumann P., et al. 2001. “ Schineria larvae Gen. Nov., Sp. Nov., Isolated From the 1st and 2nd Larval Stages of Wohlfahrtia magnifica (Diptera: Sarcophagidae).” International Journal of Systematic and Evolutionary Microbiology 51: 401–407. [DOI] [PubMed] [Google Scholar]
  88. Tully, J. G. , Rose D. L., Yunker C. E., et al. 1995. “ Spiroplasma ixodetis Sp. Nov., a New Species From Ixodes pacificus Ticks Collected in Oregon.” International Journal of Systematic and Evolutionary Microbiology 45: 23–28. [DOI] [PubMed] [Google Scholar]
  89. Ueki, A. , Abe K., Suzuki D., Kaku N., Watanabe K., and Ueki K.. 2009. “ Anaerosphaera aminiphila Gen. Nov., Sp. Nov., a Glutamate‐Degrading, Gram‐Positive Anaerobic Coccus Isolated From a Methanogenic Reactor Treating Cattle Waste.” International Journal of Systematic and Evolutionary Microbiology 59: 3161–3167. [DOI] [PubMed] [Google Scholar]
  90. Valiente Moro, C. , Tran F. H., Nantenaina Raharimalala F., Ravelonandro P., and Mavingui P.. 2013. “Diversity of Culturable Bacteria Including Pantoea in Wild Mosquito Aedes albopictus .” BMC Microbiology 13: 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  91. Van Ohlen, M. , Herfurth A.‐M., and Wittstock U.. 2017. “Herbivore Adaptations to Plant Cyanide Defenses.” In Herbivores, edited by Shields V. D. C., 29–57. InTech. [Google Scholar]
  92. Vera‐Ponce León, A. , Dominguez‐Mirazo M., Bustamante‐Brito R., Higareda‐Alvear V., Rosenblueth M., and Martínez‐Romero E.. 2021. “Functional Genomics of a Spiroplasma Associated With the Carmine Cochineals Dactylopius coccus and Dactylopius opuntiae .” BMC Genomics 22: 1–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  93. Višňovská, D. , Pyszko P., Šigut M., et al. 2020. “Caterpillar Gut and Host Plant Phylloplane Mycobiomes Differ: A New Perspective on Fungal Involvement in Insect Guts.” FEMS Microbiology Ecology 96: fiaa116. [DOI] [PubMed] [Google Scholar]
  94. Vujisić, L. V. , Makarov S. E., Ćurčić B. P., et al. 2011. “Composition of the Defensive Secretion in Three Species of European Millipedes.” Journal of Chemical Ecology 37: 1358–1364. [DOI] [PubMed] [Google Scholar]
  95. Wang, S. , Wang L., Fan X., Yu C., Feng L., and Yi L.. 2020. “An Insight Into Diversity and Functionalities of Gut Microbiota in Insects.” Current Microbiology 77: 1976–1986. [DOI] [PubMed] [Google Scholar]
  96. Wang, Z. , Cheng Y., Wang Y., and Yu X.. 2022. “Topical Fungal Infection Induces Shifts in the Gut Microbiota Structure of Brown Planthopper, Nilaparvata lugens (Homoptera: Delphacidae).” Insects 13: 528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  97. Weary, B. P. , and Will K. W.. 2020. “The Millipede‐Predation Behavior of Promecognathus and Exceptional Cyanide Tolerance in Promecognathus and Metrius (Coleoptera: Carabidae).” Annals of the Entomological Society of America 113: 473–480. [Google Scholar]
  98. Weon, H.‐Y. , Kim B.‐Y., Hong S.‐B., et al. 2007. “ Skermanella aerolata Sp. Nov., Isolated From Air, and Emended Description of the Genus Skermanella.” International Journal of Systematic and Evolutionary Microbiology 57: 1539–1542. [DOI] [PubMed] [Google Scholar]
  99. Wu, Y. , Zheng Y., Chen Y., et al. 2020. “Honey Bee ( Apis mellifera ) Gut Microbiota Promotes Host Endogenous Detoxification Capability via Regulation of P450 Gene Expression in the Digestive Tract.” Microbial Biotechnology 13: 1201–1212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  100. Xia, X. , Lan B., Tao X., Lin J., and You M.. 2020. “Characterization of Spodoptera litura Gut Bacteria and Their Role in Feeding and Growth of the Host.” Frontiers in Microbiology 11: 1492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  101. Yun, J. H. , Roh S. W., Whon T. W., et al. 2014. “Insect Gut Bacterial Diversity Determined by Environmental Habitat, Diet, Developmental Stage, and Phylogeny of Host.” Applied and Environmental Microbiology 80: 5254–5264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  102. Zhu, L. , Zhang Y., Cui X., et al. 2021. “Host Bias in Diet‐Source Microbiome Transmission in Wild Cohabitating Herbivores: New Knowledge for the Evolution of Herbivory and Plant Defense.” Microbiology Spectrum 9: e00756‐21. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data S1: Supporting Information.

EMI4-18-e70317-s001.docx (5.7MB, docx)

Data Availability Statement

The raw data that support the findings of this study are openly available in the SRA database at https://dataview.ncbi.nlm.nih.gov/object/PRJNA1249453, reference number PRJNA1249453.

Articles from Environmental Microbiology Reports are provided here courtesy of Wiley

RESOURCES